MiRNA marker kit for evaluating myocardial injury caused by cold exposure and application of miRNA marker kit

Abstract

The invention provides a miRNA marker hsa-miR-152-3p and application of a kit for detecting the miRNA marker. The application comprises one or more of the following applications: application in preparing a product for diagnosing myocardial injury caused by cold exposure, application in preparing a product for diagnosing myocardial injury caused by cold exposure, application in preparing a product for detecting myocardial injury caused by cold exposure, and application in preparing a product for detecting myocardial injury caused by cold exposure. The invention also relates to an application in preparation of products for screening myocardial injury caused by cold exposure. The application is used for preparing a product for evaluating the risk of myocardial injury caused by cold exposure; the application is used for preparing a prognostic evaluation product for myocardial injury caused by cold exposure. The miRNA marker hsa-miR-152-3p provided by the invention can be used for evaluating myocardial injury caused by cold exposure, and is good in sensitivity and specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of medical molecular diagnosis, and in particular to a miRNA marker kit for evaluating myocardial damage caused by cold exposure and its application. Background Art

[0002] In recent years, polar scientific exploration and resource development have attracted much attention. However, the extreme cold environment of the polar regions poses a severe challenge to operators: long-term work in low temperatures may not only cause frostbite, but also damage the cardiovascular system and increase the risk of heart disease. Therefore, it is very important to conduct cardiovascular health risk assessment for individuals working in cold environments, especially for those working in extreme cold environments such as the polar regions, who need to pay special attention and take corresponding measures.

[0003] In the prior art, it has been found through research that long-term exposure of the human body to a cold environment can cause myocardial damage, which in turn causes myocardial structural reconstruction and changes in cardiac function. At present, troponin markers are often used clinically to assess myocardial damage. Although troponin has a high specificity for myocardial damage, in some cases, such as skeletal muscle damage, a slight increase in troponin may also occur. In addition, some non-cardiac diseases, such as pancreatitis, severe diabetic ketoacidosis, etc., may also lead to an increase in troponin, which may lead to an increase in the false positive rate of diagnosis, that is, an increase in the number of cases of misdiagnosis of myocardial damage. At the same time, the use of troponin markers to assess myocardial damage has a low early sensitivity. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention proposes a miRNA marker kit and application for evaluating myocardial damage caused by cold exposure, so as to solve the technical problems in the prior art of using troponin markers to assess myocardial damage, with low early sensitivity and a certain false positive rate.

[0005] The technical solution adopted by the present invention is as follows:

[0006] In a first aspect, a miRNA marker is provided, wherein the miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.1.

[0007] In a second aspect, a kit for detecting miRNA markers is provided, wherein the kit comprises one or more of the following applications:

[0008] Application in the preparation of products for diagnosing myocardial damage caused by cold exposure;

[0009] Application in the preparation of products for screening myocardial damage caused by cold exposure;

[0010] Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure;

[0011] Application in the preparation of products for the prognosis evaluation of myocardial injury caused by cold exposure;

[0012] The miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa-miR-152-3p, or a reagent for detecting the expression level of hsa-miR-152-3p.

[0013] Furthermore, the reagent used in the kit to detect or specifically identify hsa-miR-152-3p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0014] In a third aspect, a primer for detecting a miRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0015] Application in the preparation of products for diagnosing myocardial damage caused by cold exposure;

[0016] Application in the preparation of products for screening myocardial damage caused by cold exposure;

[0017] Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure;

[0018] Application in the preparation of products for the prognosis evaluation of myocardial injury caused by cold exposure;

[0019] The primers are primers for detecting the expression level of hsa-miR-152-3p or specifically identifying hsa-miR-152-3p, and the miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.1.

[0020] Furthermore, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0021] In a fourth aspect, an application of a substance for detecting miRNA markers is provided, including one or more of the following applications:

[0022] Application in the preparation of products for diagnosing myocardial damage caused by cold exposure;

[0023] Application in the preparation of products for screening myocardial damage caused by cold exposure;

[0024] Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure;

[0025] Application in the preparation of products for the prognosis evaluation of myocardial injury caused by cold exposure;

[0026] The miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.1.

[0027] Furthermore, the substance is a reagent for detecting the expression level of hsa-miR-152-3p, or a reagent for specifically identifying hsa-miR-152-3p, or a reagent for detecting the content of hsa-miR-152-3p.

[0028] Further, the substance is a substance for detecting hsa-miR-152-3p, including:

[0029] (a) Primers for detecting or specifically recognizing hsa-miR-152-3p;

[0030] (b) a reagent set comprising (a); or

[0031] (c) A kit comprising (a) or (c).

[0032] Furthermore, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0033] Furthermore, the product is a product for diagnosing myocardial damage caused by cold exposure by detecting the expression level of hsa-miR-152-3p through RT-PCR, qPCR, in situ hybridization, chip or high-throughput sequencing platform.

[0034] It can be seen from the above technical solution that the beneficial technical effects of the present invention are as follows:

[0035] A new biomarker, hsa-miR-152-3p, is provided for the assessment of myocardial injury induced by cold exposure with good sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for the specific embodiments or the prior art description. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn according to the actual scale.

[0037] Figure 1A volcano plot of the difference in plasma miRNA expression between the cold exposure-induced myocardial injury group and the control group obtained by RNA transcriptome sequencing in Example 1 of the present invention;

[0038] Figure 2 This is a comparison chart of the hsa-miR-152-3p content in the plasma of the cold exposure-induced myocardial injury group and the control group measured by RT-qPCR method in Example 1 of the present invention;

[0039] Figure 3 The ROC curve of hsa-miR-152-3p in Example 1 of the present invention for diagnosing myocardial injury caused by cold exposure;

[0040] Figure 4 It is a line graph of the correlation between the expression levels of plasma cTnI and hsa-miR-152-3p in Example 1 of the present invention;

[0041] Figure 5 This is a RT-qPCR verification diagram of knocking down miR-152-3p by transfection with lentiviral miR-152-3p-inhibitor in Example 1 of the present invention;

[0042] Figure 6 This is a comparison chart of the expression levels of cTnI in the mice cold exposure-induced myocardial injury group, the control group, and the miR-152-3p knockdown group in Example 2 of the present invention;

[0043] Figure 7 This is a comparison of myocardial tissue pathological staining of the mice cold exposure-induced myocardial injury group, the control group, and the miR-152-3p knockdown group in Example 2 of the present invention;

[0044] Figure 8 This is a comparison chart of the expression levels of cTnI in the cell-level simulated cold exposure myocardial cell injury group, the control group, the lentiviral miR-152-3p-inhibitor transfection knockdown group and the negative control virus transfection group of Example 2 of the present invention. DETAILED DESCRIPTION

[0045] The following embodiments of the technical solution of the present invention are described in detail in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention.

[0046] It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0047] Among various molecular markers, small non-coding RNA (micro RNA, miRNA) is a type of naturally occurring small non-coding RNA molecule, about 21-25 nucleotides long, generated by a single-stranded RNA precursor of about 70-90 bases in size with a hairpin structure after Dicer enzyme processing, and partially complementary to one or more messenger RNA (mRNA) molecules. Its main function is to downregulate gene expression in various ways, including translation inhibition, mRNA shearing and deadenylation. MiRNA with clearer functions has been proven to be a biomarker for the diagnosis of various diseases, and miRNA markers have the potential advantage of high sensitivity. The inventors of this application have found through research that miRNA is associated with a variety of cardiovascular diseases. Because the changes in myocardial damage caused by cold exposure are relatively hidden, it is urgent to explore more sensitive diagnostic evaluation markers, so this embodiment uses miRNA as a marker for testing.

[0048] Example 1

[0049] In this embodiment, the screening and correlation study of miRNA markers for myocardial injury caused by cold exposure was carried out. 70 subjects who worked in cold areas for a long time were selected to exclude the possibility of other heart diseases. After venous blood sampling, the Arraystar Human miRNA Array of Arraystar was used to detect the difference in miRNA expression profiles in the serum of individuals with myocardial injury and those without myocardial injury among these subjects. Then, the results were analyzed using R software, and the test results were analyzed to screen out miRNAs with significant differences in expression (Fold change ≥ 2.0, P value < 0.05). Subsequently, the contents of the top 10 results of these miRNA chips in the plasma of the subjects were determined by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) technology, and the first one with a significant increase was selected for post-analysis. The details are as follows:

[0050] 1. Clinical sample selection

[0051] Venous blood samples were collected from 70 subjects (aged 20-40 years old, and other heart diseases were excluded) who had lived in Mohe area of ​​Heilongjiang Province (located at 52-53°N, with a winter lasting 8 months, an average minimum temperature of -23°C in winter, and a historical minimum temperature of -53°C) for more than 1 year and had been engaged in long-term outdoor cold environment work.

[0052] 2. Definition and grouping of myocardial injury

[0053] Myocardial injury was considered to be present if any of the following conditions occurred: (1) the ejection fraction of the heart ultrasound decreased by more than 5% after exposure to cold environment compared with the baseline level before exposure; (2) ischemic changes were found in electrocardiogram; (3) clinical symptoms such as chest tightness, chest pain and shortness of breath after activity occurred; (4) serum myocardial injury markers exceeded the upper limit of normal reference values. All subjects were divided into a cold exposure-induced myocardial injury group and a control group.

[0054] 3. RNA Extraction

[0055] Human peripheral blood was collected using EDTA anticoagulation blood collection tubes, centrifuged at 2500g for 15min, and the upper plasma was taken to a 2ml sterile tube. Total RNA was extracted using the RNA extraction and separation kit (DP419). According to the instructions, 1ml TRIZOL reagent and 200u1 chloroform were added to the plasma, oscillated for 20s, and allowed to stand at room temperature for 10min. Centrifuged at 13000rpm and 4℃ for 15min. Carefully aspirate the supernatant, add 800u1 isopropanol, gently mix upside down, and stand at -20℃ for 1h. Then centrifuge at 13000rpm and 4℃ for 15min, and discard the supernatant. Next, add 1ml 75% ethanol, gently wash the precipitate, centrifuge at 13000rpm and 4℃ for 5min, remove the supernatant, and blow dry. Finally, add an appropriate amount of nuclease-free H2O, dissolve at 65℃ for 10min to detect the OD value and concentration of RNA, and store at -80℃ for later use.

[0056] 4. miRNA Sequencing Analysis

[0057] Total RNA was extracted from blood samples of the cold exposure-induced myocardial injury group and the control group and sent to Arraystar Biotech for miRNA sequencing. The miRNAs with significant expression differences (Fold chang ≥ 2.0, P value < 0.05) were screened and then RT-qPCR was used to determine the content of the miRNA results in the patient's plasma. The measurement results are shown in the table below. The first one with significant increase was taken for subsequent experiments.

[0058] miRNA log2FoldChange pvalue Adjust up / down hsa-miR-152-3p 4.26 0.000315575 Up hsa-miR-29c-3p 2.63 0.009144836 Up hsa-miR-199a-3p 1.59 0.006537749 Up hsa-miR-34c-5p 1.51 0.029897081 Up hsa-miR-499-5p 1.5 0.003744145 Up hsa-miR-93-5p 1.43 0.004845961 Up hsa-miR-301a-3p 1.4 0.028831021 Up hsa-miR-140-5p 1.37 0.034200705 Up hsa-miR-148b-3p 1.3 0.022444365 Up hsa-miR-125b-5p 1.28 0.037971899 Up

[0059] 5.RT-qPCR detection

[0060] Using a reverse transcription kit (RR037A), 500 ng of RNA was reverse transcribed into cDNA, and a reaction system of 20u1 was constructed (as shown in the following table). The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and maintained at 4°C.

[0061]

[0062] Design miRNA primer sequences, dilute the cDNA obtained by reverse transcription reaction at 1:10, use high specificity qPCR kit (RR820A) for reaction, refer to the instructions, build reaction system 20u1 (as shown in the following table), the reaction procedure is: 95℃ pre-denaturation for 2min; 95℃ denaturation for 5s, 60℃ annealing for 30s, 95℃ extension for 15s, repeat 40 cycles. Use GAPDH protein to quantify the relative level of miRNA and express it as relative ratio.

[0063]

[0064] 6. Plasma Troponin Determination

[0065] Human cardiac troponin I (cTnI) EILSA assay kit (ZC-35149) was used for the assay. First, 100ul of standard or test sample was added to each well, the kit was equilibrated at room temperature for 30min, and then the required strips were taken out of the aluminum foil bag. Standard wells and sample wells were set up, and 50μl of standard of different concentrations was added to each standard well. 50μL of the test sample was added to the sample well, and nothing was added to the blank well. Except for the blank well, 100μL of HRP-labeled detection antibody was added to each well of the standard well and sample well. The reaction wells were sealed with a sealing film and incubated in a 37℃ water bath or incubator for 60 minutes. The liquid was discarded, patted dry on absorbent paper, and each well was filled with washing solution, left to stand for 1 minute, the washing solution was shaken off, and the plate was patted dry on absorbent paper. Repeat the washing process 5 times. Substrate was added to each well and incubated at 37℃ in the dark for 15 minutes. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes.

[0066] 7. Statistical Analysis

[0067] The t-test and analysis of variance were used for normally distributed variables, and the MannWhitney U test and Kruskal Wallis test were used for non-normally distributed variables. Statistical analysis was performed using R software (v 4.3.2) and GraphPad Prism software (v8.01). Biological replicates were shown as single data points superimposed on the bar graph. P < 0.05 was considered to be significantly different. Linear regression was used to analyze the potential relationship between variables, and the Spearman correlation coefficient was used to evaluate the data effect. The receiver operating characteristic (ROC) curve was used to determine the diagnostic efficacy of the marker for endpoint events.

[0068] 8. Verify the results

[0069] like Figure 1As shown in the figure, the differential expression analysis of human plasma miRNA between the cold exposure-induced myocardial injury group and the control group revealed that hsa-miR-152-3p was significantly overexpressed in the cold exposure-induced myocardial injury group. The left side of the origin 0 coordinate in the figure is Upregulated, and the right side is Down regulated.

[0070] like Figure 2 As shown, the hsa-miR-152-3p content in the plasma of the subjects in the cold exposure-induced myocardial injury group was determined by RT-qPCR. The results showed that the hsa-miR-152-3p content in the plasma of the subjects in the cold exposure-induced myocardial injury group was significantly higher than that in the control group, indicating that hsa-miR-152-3p is a potential biomarker for cold exposure-induced myocardial injury.

[0071] like Figure 3 As shown, the ROC curve of hsa-miR-152-3p in diagnosing myocardial injury caused by cold exposure suggested that hsa-miR-152-3p had good diagnostic efficacy;

[0072] like Figure 4 As shown, the relationship between the expression levels of cTnI and hsa-miR-152-3p in the plasma of the subjects; cTnI is a marker protein for myocardial injury. It can be seen from the figure that the expression of cTnI and hsa-miR-152-3p is significantly positively correlated.

[0073] The above results show that there is a significant positive correlation between the expression of cTnI and hsa-miR-152-3p in the plasma of the subjects. cTnI is a regulatory protein unique to myocardial tissue and plays a key role in myocardial contraction. It achieves its function by inhibiting the binding of myosin to actin. cTnI is one of the sensitive and specific serum markers of myocardial cell injury and is widely used in the diagnosis of acute myocardial infarction in clinical practice. Given the positive correlation between hsa-miR-152-3p and cTnI levels, it can be concluded that the level of hsa-miR-152-3p in plasma can reflect the severity of myocardial injury caused by cold exposure.

[0074] Example 2

[0075] Hsa-miR-152-3p is a human-derived miR-152-3p. Due to the high conservation of miR-152-3p among species, it is also expressed in mice. Therefore, in this example, the relationship between miR-152-3p and myocardial injury caused by cold exposure was verified at the cellular level using animal models, as follows:

[0076] 1. Animal modeling

[0077] Six-week-old C57 mice were purchased from Beijing Sibeifu Biotechnology Co., Ltd. and randomly divided into two groups. One group of mice was placed in a temperature-controlled box that simulated a cold environment (the temperature was set at -20°C for 6 hours a day), while the other group was kept at room temperature (21°C) as a control group. After two weeks, blood samples and heart tissues were collected from the two groups of mice for subsequent analysis.

[0078] 2. Pathological staining

[0079] Masson staining was used to reflect the degree of myocardial tissue fibrosis. According to the instructions for use of the Masson staining kit (RY-0003), the paraffin sections were dewaxed to water, and the sections were placed in xylene I for 20 minutes, xylene II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and 75% alcohol for 5 minutes, and then washed with tap water. The sections were immersed in Masson A solution overnight and washed with tap water. After that, the sections were immersed in a dye solution mixed with Masson B solution and Masson C solution in equal proportions, immersed for 1 minute, washed with tap water, differentiated with 1% hydrochloric acid alcohol, and washed with tap water. The sections were immersed in Masson D solution for 6 minutes and rinsed with tap water. Then, the sections were immersed in Masson E solution for 1 minute, without washing with water, and directly immersed in Masson F solution for 2-30 seconds after draining. Finally, the slices were rinsed and differentiated with 1% glacial acetic acid, and then placed in anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, xylene I for 5 min, and xylene II for 5 min to make them transparent, and then sealed with neutral gum. Microscope examination and image acquisition and analysis were performed.

[0080] 3. Mouse plasma RNA extraction and RT-qPCR method, the steps are the same as Example 1.

[0081] 4. Determination of cTnI in mouse plasma / cell culture supernatant

[0082] Mouse cardiac troponin I EILSA assay kit (ZC-38813) was used for the assay. The operation was carried out according to the instructions of the kit, and the steps were the same as those in Example 1.

[0083] 5. Knockdown of miRNA

[0084] The knockdown virus miR-152-3p-inhibitor and its corresponding negative control virus were purchased from Shanghai GeneCare Gene Medical Technology Co., Ltd. According to the instructions, transfection was performed by tail vein injection, and the effect was detected 24 hours after injection.

[0085] 6. In vitro culture of mouse cardiomyocytes:

[0086] Mouse cardiomyocyte cell line (HL-1) was purchased from Wuhan Shanen Bio (SNL-319). The culture medium used: 89% MEM medium + 10% FBS + 1% double antibody. Growth conditions: gas phase: 95% air + 5% carbon dioxide; temperature: 37°C; humidity: 70-80%. Passaging method: 1:2 to 1:4, 2-3 times a week. Studies have shown that myocardial H2O2 levels are significantly increased after cold exposure, and H2O2 is considered to be a potential mechanism for cold-induced myocardial damage. HL-1 cells were treated with H2O2 (concentration 2mmol / L) to simulate myocardial cell damage caused by cold stimulation.

[0087] 7. Experimental results:

[0088] Figure 5 After mice were transfected with lentiviral miR-152-3p-inhibitor, the expression of plasma miR-152-3p decreased, indicating that the transfection was successful. Subsequent experiments were completed on this basis.

[0089] Figure 6 The expression of cTnI in the cold exposure-induced myocardial injury group, control group and miR-152-3p knockdown group of mice showed that cold environment exposure can cause increased expression of miR-152-3p, while the expression level of cTnI decreased after knocking down miR-152-3p. This is the cellular and molecular basis for miR-152-3p to be used as a biomarker for diagnosing cold exposure-induced myocardial injury.

[0090] Figure 7 The myocardial tissue pathological staining was performed for the mice in the cold exposure-induced myocardial injury group, the control group and the miR-152-3p knockdown group. The results showed that cold environment exposure can cause myocardial fibrosis, and the degree of myocardial fibrosis was significantly reduced after knocking down miR-152-3p, indicating that the degree of damage was reduced.

[0091] Figure 8 The expression levels of cTnI in the myocardial cell injury group, control group, lentiviral miR-152-3p-inhibitor transfection knockdown group and negative control virus transfection group simulated cold exposure at the cellular level. The results showed that the expression level of cTnI in H2O2-treated cardiomyocytes was reduced after knocking down miR-152-3p. The in vitro cell level verified that reducing miR-152-3p expression had a significant improvement effect on myocardial injury.

[0092] The above implementation results show that hsa-miR-152-3p is closely related to myocardial injury caused by cold exposure, and is a new biological marker for myocardial injury caused by cold exposure; plasma cTnI is significantly positively correlated with hsa-miR-152-3p expression; ROC curve shows that hsa-miR-152-3p has good diagnostic ability for myocardial injury caused by cold exposure. In addition, miR-152-3p expression is upregulated in animal models of cold exposure; miR-152-3p knockdown significantly reduces cTnI levels and improves the phenotype of myocardial injury caused by cold exposure.

[0093] The above results further prove that hsa-miR-152-3p can be used as a new biomarker and therapeutic target for evaluating myocardial injury induced by cold exposure.

[0094] Example 3

[0095] Based on the research results of Example 1 and Example 2, this example provides a miRNA marker hsa-miR-152-3p, whose nucleotide sequence is shown in SEQ ID No. 1:

[0096] SEQ ID No.1:UCAGUGCAUGACAGAACUUGG

[0097] This embodiment also provides a primer pair for specifically recognizing hsa-miR-152-3p, including an upstream primer as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3:

[0098] SEQ ID No.2:AACCGGTCAGTGCATGACA

[0099] SEQ ID No.3: GTCGTATCCAGTGCAGGGT

[0100] This embodiment also provides a kit, wherein the reagent for detecting or specifically identifying hsa-miR-152-3p is a specific primer, the specific primer is an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3, and the kit comprises:

[0101] Prime Script buffer (5x), Prime Script Prime Script reverse transcriptase mix I, Random6mers, nuclease-free H2O, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10uM), ROX control dye (50x).

[0102] By adopting the above technical solution, a new biomarker hsa-miR-152-3p is provided, which can be used to evaluate myocardial damage caused by cold exposure with good sensitivity and specificity.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. These modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and specification of the present invention.

Claims

1. A miRNA marker, characterized in that The miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.

1.

2. A kit for detecting miRNA markers, characterized in that: The kit includes one or more of the following applications: Application in the preparation of products for diagnosing myocardial damage caused by cold exposure; Application in the preparation of products for screening myocardial damage caused by cold exposure; Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure; Application in the preparation of products for evaluating the prognosis of myocardial injury caused by cold exposure; The miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa-miR-152-3p, or a reagent for detecting the expression level of hsa-miR-152-3p.

3. The kit for detecting miRNA markers according to claim 2, characterized in that: The reagent used in the kit for detecting or specifically identifying hsa-miR-152-3p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

4. A primer for detecting miRNA markers, characterized in that: The primers include one or more of the following applications: Application in the preparation of products for diagnosing myocardial damage caused by cold exposure; Application in the preparation of products for screening myocardial damage caused by cold exposure; Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure; Application in the preparation of products for evaluating the prognosis of myocardial injury caused by cold exposure; The primers are primers for detecting the expression level of hsa-miR-152-3p or specifically identifying hsa-miR-152-3p, and the miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.

1.

5. The primer for detecting miRNA markers according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

6. An application of a substance for detecting miRNA markers, characterized in that: Includes one or more of the following applications: Application in the preparation of products for diagnosing myocardial damage caused by cold exposure; Application in the preparation of products for screening myocardial damage caused by cold exposure; Application in the preparation of products for assessing the risk of myocardial injury caused by cold exposure; Application in the preparation of products for evaluating the prognosis of myocardial injury caused by cold exposure; The miRNA marker is hsa-miR-152-3p, and its nucleotide sequence is shown in SEQ ID No.

1.

7. The use of the substance for detecting miRNA markers according to claim 6, characterized in that: The substance is a reagent for detecting the expression level of hsa-miR-152-3p, or a reagent for specifically identifying hsa-miR-152-3p, or a reagent for detecting the content of hsa-miR-152-3p.

8. The use of the substance for detecting miRNA markers according to claim 6, characterized in that: The substance is a substance for detecting hsa-miR-152-3p, including: (a) Primers for detecting or specifically recognizing hsa-miR-152-3p; (b) a reagent set comprising (a); or (c) A kit comprising (a) or (c).

9. The use of the substance for detecting miRNA markers according to claim 8, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

10. The use of the substance for detecting miRNA markers according to claim 6, characterized in that: The product is a product for diagnosing myocardial damage caused by cold exposure by detecting the expression level of hsa-miR-152-3p through RT-PCR, qPCR, in situ hybridization, chip or high-throughput sequencing platform.

Images