Lycium ruthenicum LrCHS1 gene and application of encoded protein thereof in regulating and controlling biosynthesis of lycium ruthenicum anthocyanin

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a lycium ruthenicum LrCHS1 gene and an encoded protein thereof in promotion of anthocyanin biosynthesis. It is found for the first time that the LrCHS1 gene can promote accumulation of anthocyanidin compounds and can be used for forward mediation of biosynthesis of fructus lycii anthocyanidin. By overexpressing the LrCHS1 gene in the plant, the anthocyanin can be obtained through a biosynthesis way, and a new method is provided for obtaining the anthocyanin. According to the construction method of the recombinant plasmid and the recombinant bacterium for overexpressing the lycium ruthenicum LrCHS1 gene, a recombinant expression vector for overexpressing the LrCHS1 gene can be obtained, and the obtained recombinant expression vector can improve the content of anthocyanin in plants and can be used for biosynthesis of the plants.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a ruthenic wolfberry LrCHS1 gene and a protein encoded therein in promoting anthocyanin biosynthesis. Background Art

[0002] Lycium ruthenicum Murr. is a perennial shrub belonging to the Solanaceae family. Its fruit is rich in active compounds such as polysaccharides, flavonoids, vitamins and proteins, and has high nutritional value. It also has antioxidant, anti-aging, lipid-lowering, anti-cancer, anti-fatigue and other effects, as well as potential gastrointestinal protection and radiation resistance. In addition, the content of anthocyanins in black wolfberry is higher than that in blackcurrant or blueberry. Anthocyanins are a class of water-soluble natural pigments unique to plants, which are biologically active and can be used to prevent and treat a variety of diseases; they are also widely used in food as natural food pigments. In addition, anthocyanins also play an important role in promoting plant reproduction and protecting plants from biotic and abiotic stresses.

[0003] Previous studies have shown that there are structural genes related to anthocyanin biosynthesis in black wolfberry. Therefore, it is necessary to continue to explore new structural genes in order to obtain more improved wolfberry varieties and provide more pathways for anthocyanin biosynthesis. Summary of the invention

[0004] In view of the above technical problems, the present invention provides the application of the LrCHS1 gene of Lycium ruthenicum and its encoded protein in promoting anthocyanin biosynthesis. The present invention firstly finds that the LrCHS1 gene can promote the accumulation of anthocyanin compounds and can be used to positively mediate the biosynthesis of anthocyanins in Lycium ruthenicum.

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides the use of the LrCHS1 gene of ruthenic wolfberry in increasing the anthocyanin content of plants. The nucleotide sequence of the LrCHS1 gene of ruthenic wolfberry is shown in SEQ ID NO.1, or the encoded amino acid sequence is shown in SEQ ID NO.2.

[0007] The present invention identifies the LrCHS1 gene from wolfberry for the first time, and through research finds that the LrCHS1 gene can positively mediate the biosynthesis of anthocyanins, significantly increasing the accumulation of anthocyanidin compounds procyanidin B1 (CAS No.: 20315-25-7) and pelargonidin chloride (CAS No.: 134-04-3) in the plant.

[0008] Proanthocyanidin B1 belongs to oligomeric proanthocyanidins (OPC). Oligomeric proanthocyanidins are currently internationally recognized natural antioxidants with strong antioxidant and free radical scavenging effects. They can not only protect and stabilize vitamin C, but also restore collagen activity; they can inhibit the activity of tyrosinase, thereby playing a whitening role; they are also powerful metal chelators that can chelate metal ions. Pelargonium chloride has antioxidant activity, can protect cells from damage caused by oxidative stress, and can be used in daily chemical products or food fields; it has an inhibitory effect on enzymes involved in the production of ROS, RNS and proinflammatory cytokines, and may help reduce inflammatory responses; it can be used to treat atherosclerosis, hypertension and thrombotic diseases, and has certain potential in the treatment of diseases such as Alzheimer's disease, Parkinson's disease and cancer. By overexpressing the LrCHS1 gene in plants, proanthocyanidin B1 and pelargonium chloride can be obtained through biosynthetic pathways, providing a new method for obtaining both.

[0009] Preferably, the plant is wolfberry.

[0010] Preferably, the anthocyanidins include procyanidin B1 and pelargonidin chloride.

[0011] The second aspect of the present invention provides the use of a protein having an amino acid sequence as shown in SEQ ID NO. 2 in increasing the anthocyanin content of a plant.

[0012] Preferably, the plant is wolfberry.

[0013] Preferably, the anthocyanidins include procyanidin B1 and pelargonidin chloride.

[0014] The third aspect of the present invention provides a recombinant expression vector for overexpressing the above-mentioned Lycium ruthenicum LrCHS1 gene.

[0015] Preferably, the recombinant expression vector includes a recombinant plasmid and a recombinant bacterium.

[0016] More preferably, the recombinant bacteria is Agrobacterium.

[0017] The fourth aspect of the present invention provides a method for constructing a recombinant plasmid that overexpresses the above-mentioned black wolfberry LrCHS1 gene: using the primer LrCHS1-F with a sequence as shown in SEQ ID NO.5 and the primer LrCHS1-R with a sequence as shown in SEQ ID NO.6, the black wolfberry LrCHS1 gene is transformed into a plasmid to obtain the recombinant plasmid that overexpresses the black wolfberry LrCHS1 gene.

[0018] Preferably, the plasmid is pCambia 1300-35s.

[0019] The fifth aspect of the present invention provides a method for constructing a recombinant bacterium that overexpresses the above-mentioned black wolfberry LrCHS1 gene: a recombinant plasmid is constructed using a primer OE-LrCHS1-F with a sequence as shown in SEQ ID NO.5 and a primer OE-LrCHS1-R with a sequence as shown in SEQ ID NO.6, and the recombinant plasmid is transformed into Agrobacterium to obtain the recombinant bacterium that overexpresses the black wolfberry LrCHS1 gene.

[0020] Preferably, the plasmid is pCambia 1300-35s.

[0021] Preferably, the Agrobacterium is Agrobacterium GS115, Agrobacterium LBA4404, Agrobacterium GV3101 or Agrobacterium EHA105.

[0022] A sixth aspect of the present invention provides the use of the above-mentioned recombinant bacteria overexpressing the LrCHS-1 gene of Lycium ruthenicum in increasing the anthocyanin content of plants.

[0023] Preferably, the recombinant bacterium is Agrobacterium GV3101.

[0024] Preferably, the plant is wolfberry.

[0025] Preferably, the anthocyanidins include procyanidin B1 and pelargonidin chloride.

[0026] Preferably, the bacterial suspension of the above recombinant bacteria is injected into plants.

[0027] The beneficial effects of the present invention are as follows: the present invention first identified the LrCHS1 gene from wolfberry, and discovered for the first time through homologous cloning, wolfberry transient transformation, fluorescence quantitative detection and other technologies that overexpression of the LrCHS1 gene can promote the accumulation of anthocyanidin compounds, increase the content of anthocyanidin compounds proanthocyanidin B1 and chloropelargonidin, and thus can be used for the biosynthesis of the above anthocyanidin compounds. The construction method of the recombinant plasmid and recombinant bacteria for overexpressing the LrCHS1 gene of black wolfberry provided by the present invention can obtain a recombinant expression vector for overexpressing the LrCHS1 gene, and the obtained recombinant expression vector can increase the content of proanthocyanidin B1 and chloropelargonidin in plants, and can be used for their biosynthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the expression level of the LrCHS1 gene in the OE-LrCHS1 overexpressing plant and the control in Example 1 of the present invention;

[0029] Figure 2 It is the anthocyanin compound content of the OE-LrCHS1 overexpressing plant and the control in Example 1 of the present invention. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0031] Anthocyanin is one of the most important nutrients of black wolfberry. The present invention uses a combination of homologous cloning, transcriptome differential expression, wolfberry transient transformation detection and other technologies to find the important structural gene LrCHS-1 that regulates the biosynthesis of wolfberry anthocyanin. The test results show that the gene can be effectively used in the biosynthesis of wolfberry anthocyanin compounds procyanidin B1 and pelargonidin chloride.

[0032] Based on the above research results, the embodiment of the present invention provides the use of the LrCHS1 gene of black wolfberry in increasing the anthocyanin content of plants, and the nucleotide sequence of the LrCHS1 gene of black wolfberry is shown in SEQ ID NO.1, or the protein encoded by the amino acid sequence is shown in SEQ ID NO.2. Under the premise of not affecting the structure and activity of the protein, the amino acid sequence and the nucleotide sequence encoding the amino acid sequence obtained by substituting, deleting or adding one or more amino acids or terminally modifying the amino acid sequence shown in SEQ ID NO.2 also fall within the protection scope of the present invention.

[0033] The embodiment of the present invention also provides a recombinant expression vector for overexpressing the above-mentioned Lycium ruthenicum LrCHS1 gene and a construction method thereof.

[0034] The following is further described with reference to specific embodiments.

[0035] Unless otherwise specified, the raw materials, reagents, drugs or instruments used in the following examples are all conventional commercial products obtained from commercial channels. The methods used in the following examples are all conventional methods in the art unless otherwise specified.

[0036] Example 1

[0037] This example provides the cloning and functional verification of the LrCHS1 gene of Lycium ruthenicum.

[0038] 1. Cloning of LrCHS1 gene from Lycium ruthenicum

[0039] Total RNA from Lycium ruthenicum fruit was isolated using the RNA extraction kit from Takara (Takara, Dalian, China). Single-stranded cDNA of the LrCHS1 gene was prepared using the Reverse Aid First-strand cDNA Synthesis Kit from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA). The open reading frame (CDS) of the LrCHS1 gene was amplified using primers LrCHS1-F and LrCHS1-R. The amplification system consisted of 25 μL 2× PCR buffer, 10 μL dNTP (2 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 5 μL single-stranded cDNA, 1 μL KOD FX Neo (Toyo Life Science, Osaka, Japan), and 10 μL Millipore H 2 O. The PCR reaction program was set as follows: 98°C pre-denaturation for 3 minutes, followed by 30 cycles, each cycle including denaturation for 10 seconds, 58°C annealing for 30 seconds, and 68°C extension for 2 minutes; and finally 68°C extension for 5 minutes. The amplified products were purified and independently cloned into the pMD18-T vector (Toyobo Life Science, Osaka, Japan) for Sanger sequencing.

[0040] LrCHS1-F (as shown in SEQ ID NO. 3): ATGGTCACCGTCGAGGAGGT;

[0041] LrCHS1-R (as shown in SEQ ID NO. 4): CTAAGTAGAGACACTATGGAG.

[0042] The full length of the LrCHS1 open reading frame (CDS) is 1170 bp, and the nucleotide sequence is shown in SEQ ID NO.1:

[0043] ATGGTCACCGTCGAGGAGGTACGAAAGGCACAACGTGCACAAGGTCCGG

[0044] CCACCATCATGGCCATTGGCACAGCCACTCCTTCGAATTGTGTTGATCAAA

[0045] GCACCTATCCCGATTATTATTTTCGAGTCACTAATAGTGAGCATATGACTGA

[0046] GCTTAAGGAGAAATTTAAGCGCATGTGTGACAAATCTATGATTAAGAAGA

[0047] GGTACATGCACTTAACTGAAGAAATCCTAAAAGAAAACCCCAATATTTGT

[0048] GAATACATGGCTCCTTCTATTGATGCTAGGCAAGACATAGTGGTGGTTGAA

[0049] GTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATCAAAGAATGGG

[0050] GCCAACCCAAGTCCAAGATTACCCATTTGGTATTTTGCACCACTAGTGGGG

[0051] TGGACATGCCTGGGGCCGACTACCAGCTCACTAAGCTTCTTGGGCTTCGA

[0052] CCCTCCGTTAAGAGGTTCATGATGTACCAACAAGGTTGTTTTGCTGGTGGT

[0053] ACTGTTATCAGATTGGCCAAGGACTTAGCCGAAAACAACAAGGGTGCTCG

[0054] AGTCCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTCGTGGCCCAAG

[0055] TGACACTCACTTGGATAGTATGGTTGGACAAGCCTTATTTGGGGATGGGGC

[0056] AGGTGCACTCATTGTAGGTTCTGATCCATTACCTGAGGTTGAAAGGCCTTT

[0057] ATTCGAGCTTGTCTCAGCAGCCCAAACTCTGCTCCCAGACAGCGAAGGTG

[0058] CTATCGATGGGCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTCAAAG

[0059] ATGTTCCTGGATTGATCTCAAAGAACATTGAGAAGAGCTTGATGGAAGCA

[0060] TTCCAACCATTGGGCATTTCTGATTGGAACTCTCTCTTTTGGATTGCTCATC

[0061] CAGGTGGGCCGGCAATTCTGGACCAAGTTGAACTAAAGTTGGCCTTAAAG

[0062] CCCGAAAAACTTCGAGCTACAAGGCAAGTCTTGAGTGACTATGGAAATAT

[0063] GTCTAGTGCTTGTGTTTTGTTTATTTTGGATGAAATGAGGAAGGCCTCAGC

[0064] CAAAGAAGGGCTTGGTAGCACTGGTGAAGGCCTTGATTGGGGTGTACTCT

[0065] TTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTGCTCCATAGTGTCTCTACTTAG。

[0066] The LrCHS1 gene encodes 389 amino acids, and the sequence is shown in SEQ ID NO.2: MVTVEEVRKAQRAQGPATIMAIGTATPSNCVDQSTYPDYYFRVTNSEHMTELKEKFKRMCDKSMIKKRYMHLTEEILKENPNICEYMAPSIDARQDIVVVEVPKLGKEAAQKAIKEWGQPKSKITHLVFCTTSGVDMPGADYQLTKLLGLRPSVKRFMMYQQGCFAGGTVIRLAKDLAENNKGARVLVVCSEITAVTFRGPSDTHLDSMVGQALFGDGAGALIVGSDPLPEVERPLFELVSAAQTLLPDSEGAIDGHLREVGLTFHLLKDVPGLISKNIEKSLMEAFQPLGISDWNSLFWIAHPGGPAILDQVELKLALKPEKLRATRQVLSDYGNMSSACVLFILDEMRKASAKEGLGSTGEGLDWGVLFGFGPGLTVETVVLHSVST。

[0067] 2. Functional verification of LrCHS1 gene in Lycium ruthenicum

[0068] 2.1 Transient overexpression transformation

[0069] The LrCHS1 sequence obtained by cloning was constructed into the pCambia 1300-35s vector using primers OE-LrCHS1-F and OE-LrCHS1-R, and the OE-LrCHS1 overexpression vector was obtained. The OE-LrCHS1 overexpression vector was transformed into Agrobacterium GV3101 to obtain the OE-LrCHS1 overexpression engineered bacteria. The engineered bacteria were inoculated in infection buffer (5 g / L D-glucose, 50 mM MES, 2 mM Na 3 PO 4 12H 2 O and 0.1 mM acetobutyric acid) to adjust the concentration to OD 600 The concentration of 0.5-0.6 was injected into the leaves of Ningxia wolfberry seedlings that had been cultured for 30 days in advance, and 5-10 mL was injected per seedling; pCambia1300-35 s-GFP was used as a negative control. The leaves injected with the engineered bacterial suspension were collected 72 hours after injection, and subsequent real-time fluorescence quantitative PCR (qRT-PCR) and anthocyanin content detection were performed.

[0070] OE-LrCHS1-F (as shown in SEQ ID NO. 5): GCCGACTACCAGCTCACTAA;

[0071] OE-LrCHS1-R (as shown in SEQ ID NO. 6): CACCCTTGTTGTTTTCGGCT.

[0072] 2.2qRT-PCR detection

[0073] Using Lycium barbarum Ef1a as the internal reference gene, the SYBR Green dye method and BIO-RAD fluorescence quantitative PCR instrument were used to detect and analyze the overexpression of the LrCHS1 gene in Lycium barbarum leaves (primers: CCATACCAGCATCACCATTCTTC, as shown in SEQ ID NO.7;

[0074] GTCACACTTCCCACATTGCC, as shown in SEQ ID NO.8).

[0075] qRT-PCR reaction system: 12μL Power Green PCR Master Mix, 1 μL qRTF (10 μM), 5 μL cDNA template and 20 μL ddHO 2O; reaction conditions: 95.0℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 20 s (40 cycles); melting curve from 65℃ to 95℃, each reading increased by 0.5℃. -ΔΔCT The relative expression level of the target gene was determined by the method.

[0076] The results of testing the OE-LrCHS1 overexpression plants and the control showed that the expression level of the LrCHS1 gene in the OE-LrCHS1 overexpression plants was significantly higher than that of GFP. Figure 1 As shown, this construction method achieved overexpression of the LrCHS1 gene.

[0077] 2.3 Anthocyanin content detection,

[0078] Liquid chromatography tandem mass spectrometry (LC-MS / MS) was used to determine the anthocyanin content in OE-LrCHS1 overexpressing plants.

[0079] 2.3.1 Sample pretreatment

[0080] Accurately weigh 0.2 g of sample into a 2 ml centrifuge tube, add 1 ml of 5% formic acid, extract on ice for 30 min, centrifuge at 12000 rpm for 10 min, and take the supernatant for LC-MS / MS analysis.

[0081] 2.3.2 Chromatographic mass spectrometry acquisition conditions

[0082] The chromatographic system used a Waters ultra-high performance liquid system (AcQuity UPLC, Waters, USA), a Waters HSS T3 (100*2.1 mm, 1.8 um) liquid chromatography column, an injection volume of 2 μL, a column temperature of 40°C; mobile phase A (0.1% formic acid in water), mobile phase B (0.1% formic acid-acetonitrile).

[0083] The mass spectrometry system uses the Q exactive high-resolution mass spectrometry detection system of Thermo Corporation, USA, equipped with an electrospray ionization (ESI) source and an Xcalibur workstation. The mass spectrometry conditions mainly include: using an electrospray ionization (ESI) source, the analyte is analyzed in single ion detection (SIM) mode under positive ion simultaneous scanning, which can greatly improve the sensitivity; sheath gas pressure 40arb; auxiliary gas pressure 10arb; ion spray voltage +3000V; temperature 350℃; ion transfer tube temperature 320℃.

[0084] The results (such as Figure 2The results showed that overexpression of OE-LrCHS1 significantly increased the accumulation of anthocyanin compounds Procyanidin B1 and Pelargonidin chloride in plants, indicating that LrCHS1 can promote the accumulation of anthocyanin compounds.

[0085] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of the LrCHS1 gene of black wolfberry in increasing the anthocyanin content of plants, characterized in that: The nucleotide sequence of the LrCHS1 gene of Lycium ruthenicum is shown as SEQ ID NO.1, or the encoded amino acid sequence is shown as a protein as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The plant is wolfberry; and / or The anthocyanidins include procyanidin B1 and pelargonidin chloride.

3. Application of the protein with the amino acid sequence as shown in SEQ ID NO.2 in increasing the anthocyanin content of plants.

4. The use according to claim 3, characterized in that: The plant is wolfberry; and / or The anthocyanidins include procyanidin B1 and pelargonidin chloride.

5. A recombinant expression vector for overexpressing the LrCHS1 gene of Lycium ruthenicum according to claim 1.

6. A method for constructing a recombinant plasmid for overexpressing the LrCHS1 gene of Lycium ruthenicum according to claim 1, characterized in that: The primer OE-LrCHS1-F with a sequence as shown in SEQ ID NO.5 and the primer OE-LrCHS1-R with a sequence as shown in SEQ ID NO.6 are used to transform the LrCHS1 gene of Lycium ruthenicum into a plasmid, thereby obtaining the recombinant plasmid overexpressing the LrCHS1 gene of Lycium ruthenicum.

7. The construction method according to claim 6, characterized in that: The plasmid is pCambia1300-35s.

8. A method for constructing a recombinant bacterium overexpressing the LrCHS1 gene of Lycium ruthenicum according to claim 1, characterized in that: The recombinant plasmid was constructed using the primer OE-LrCHS1-F with a sequence as shown in SEQ ID NO.5 and the primer OE-LrCHS1-R with a sequence as shown in SEQ ID NO.6, and the recombinant plasmid was transformed into Agrobacterium to obtain the recombinant bacteria overexpressing the LrCHS1 gene of Lycium ruthenicum.

9. Use of a recombinant bacterium overexpressing the LrCHS1 gene of Lycium ruthenicum according to claim 1 in increasing the anthocyanin content of a plant.

10. The use according to claim 9, characterized in that: The recombinant bacterium is Agrobacterium GV3101; and / or The plant is wolfberry; and / or The anthocyanidins include proanthocyanidin B1 and pelargonidin chloride; and / or The application method is: injecting the bacterial suspension of the recombinant bacteria into plants.

Images