Breast cancer cell precise imaging platform based on self-energized DNAzyme logic circuit and application of breast cancer cell precise imaging platform

Abstract

The invention discloses a breast cancer cell precise imaging platform based on a self-energized DNAzyme logic circuit and application of the breast cancer cell precise imaging platform, a DNAzyme element capable of realizing dual-microRNA logic detection after sequence modification and a substrate hairpin element of the DNAzyme element construct an intracellular logic circuit for breast cancer cell recognition, and in order to enhance the output capability of the circuit and the stability of intracellular operation, the DNAzyme element can realize dual-microRNA logic detection. The DNA is integrated on a DNA tetrahedron, and the problems of output capacity and stability are solved by utilizing local reaction concentration increase caused by a space confinement effect of the tetrahedron and an anti-enzymolysis effect enhanced by high nucleic acid concentration; meanwhile, by means of the characteristic that MnO2 nanosheets are degraded into Mn < 2 + > by GSH when exposed to a tumor microenvironment, self-sufficiency of in-situ divalent metal ions is achieved, an intelligent imaging platform is constructed and applied to accurate imaging of breast cancer cells, and a new thought and technical support are provided for early diagnosis and prognosis improvement of breast cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a breast cancer cell precision imaging platform based on a self-powered DNAzyme logic circuit, and also to its application in in situ imaging of breast cancer. Background Art

[0002] The incidence of breast cancer has been rising year by year, posing a serious threat to women's physical and mental health. How to achieve accurate diagnosis of early breast cancer patients is an important problem that needs to be solved in the clinic. At present, the commonly used breast cancer detection technologies in the clinic mainly include ultrasound imaging, mammography, and puncture pathological biopsy. There is a certain lag in the acquisition of tumor information, which is not conducive to the early diagnosis of tumors. MicroRNA is an emerging tumor marker. Its molecular level changes usually occur in the early stage of the disease. Before obvious anatomical and physiological changes occur, the highly sensitive detection of abnormally expressed microRNAs in the process of tumor occurrence, development, invasion, and metastasis is expected to achieve early diagnosis of the disease and monitoring of subsequent treatment effects. However, although microRNA is sensitive, it lacks specificity. Therefore, it is difficult to distinguish tumor cells with a single miRNA. Using multiple microRNAs to construct molecular logic gate detection can distinguish different tumors well by using the differences in microRNA expression profiles, which has great application prospects in the accurate detection and identification of tumors.

[0003] As a powerful functional nucleic acid, DNAzyme is a powerful in situ imaging agent due to its strong cutting efficiency, inherent programmability and biocompatibility. There are two bottlenecks in the application of DNAzyme in complex intracellular environments. First, the secondary structure of engineered DNAzyme is relatively simple and difficult to resist degradation in the intracellular nuclease-rich environment, thus affecting the stability of its signal output. Second, the activity of most DNAzymes is dependent on divalent metal ions, while the concentration of free divalent metal ions in living cells is low, with the highest concentration of free divalent metal ions being Mg. 2+ , the concentration is only 0.5mM, which makes it difficult to maintain the normal activity of DNAzyme. The above two points greatly limit its application in in situ cell detection, especially in living animals.

[0004] Establishing an engineered DNAzyme circuit to realize the AND logic operation of two microRNAs for accurate imaging of breast cancer, and ensuring its self-supply of divalent metal ions in the cell and stable operation is still challenging and rarely reported. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide a breast cancer cell precision imaging platform based on a self-powered DNAzyme logic circuit; a second object of the present invention is to provide the application of the breast cancer cell precision imaging platform in in situ imaging of breast cancer.

[0006] In order to achieve the above object, the present invention provides the following technical solutions: 1. Precision imaging platform for breast cancer cells based on self-powered DNAzyme logic circuits The imaging platform is prepared by the following steps: seven chains, namely, S1-S4 chains shown in SEQ ID NO.3-6, E6 DNAzyme chain shown in SEQ ID NO.8, miR-10b locker shown in SEQ ID NO.10, and miR-155 locker shown in SEQ ID NO.11, are mixed in a buffer at equal molar concentrations, and the temperature is gradually reduced to form a basic tetrahedron, and then a reporter hairpin probe shown in SEQ ID NO.13 or 14 is added at a 3-fold corresponding molar concentration, and incubated to form a fully assembled tetrahedral structure, and finally the solution containing the fully assembled tetrahedral structure is mixed with a MnO2 nanosheet solution, and incubated to form an imaging platform; In the fully assembled tetrahedral structure, the S1-S4 chains constitute the basic skeleton of the tetrahedron, and the E6 DNAzyme chain and the reporter hairpin probe are fixed on the vertices of the tetrahedron in a ratio of 1:3; the two locking chains miR-10b locker and miR-155 locker complementarily hybridize with the 5' end and 3' end of the E6 DNAzyme chain respectively, blocking the core catalytic sequences at both ends and making it lose its cleavage activity; when the target miR-10b and miR-155 are present, the two locking chains bind to the targets respectively, so that the E6 DNAzyme chain can transform and restore the active structure, and its two side arms can complementarily hybridize with the sequences on both sides of the rA site on the reporter hairpin probe, and cleave the rA site in the presence of a divalent metal cofactor so that the reporter hairpin probe is cut and separated, releasing a fluorescent signal; the MnO2 nanosheet is degraded into Mn when exposed to the tumor microenvironment. 2+ , achieving self-sufficiency of in situ divalent metal ions.

[0007] In some embodiments of the present invention, the buffer is 10 mM HEPES buffer containing 150 mM NaCl and pH=7.3.

[0008] In some embodiments of the present invention, the gradient cooling is 95°C for 5 min; 65°C for 30 min; 50°C for 30 min; 42°C for 30 min; 37°C for 30 min; 22°C for 30 min; and stored at 4°C.

[0009] In some embodiments of the present invention, the incubation is carried out at 30-40° C. for 0.5-1 h.

[0010] In some embodiments of the present invention, the reporter hairpin probe needs to be heated to 95° C. in a buffer in advance and cooled naturally to ensure that the hairpin structure is fully formed.

[0011] In some embodiments of the present invention, the preparation method of the MnO2 nanosheet solution is: a mixed solution of H2O2 with a mass concentration of 3% and tetramethylammonium hydroxide with a concentration of 0.6M is quickly added to a 0.3M MnCl2 solution in a volume ratio of 2:1, and the mixture is reacted overnight under magnetic stirring. The next day, the reaction solution is centrifuged, the upper liquid is discarded, and the lower solid is vacuum dried and ground into powder after washing with water and methanol respectively, and then water is added for ultrasonic dissolution to prepare a 3.47mM solution.

[0012] In some embodiments of the present invention, the concentration of the solution of the fully assembled tetrahedral structure is 500 nM, and the volume ratio of the solution of the fully assembled tetrahedral structure to the 3.47 mM MnO2 nanosheet solution is 2.826:1.

[0013] 2. Application of the breast cancer cell precision imaging platform in in situ imaging of breast cancer.

[0014] The beneficial effect of the present invention is that we have invented a new DNAzyme molecular logic gate imaging platform. The DNAzyme element that can realize dual microRNA logic detection after sequence modification and its substrate hairpin element are constructed into an intracellular logic circuit for breast cancer cell recognition. In order to enhance the output capacity of this circuit and the stability of intracellular operation, it is integrated into the DNA tetrahedron, and the local reaction concentration increase brought about by the spatial confinement effect of the tetrahedron and the high nucleic acid concentration enhanced anti-enzymatic effect are used to solve the problems of output capacity and stability. In addition, in order to solve the problem that the intracellular divalent metal ion concentration is not enough to support the operation of DNAzyme, MnO2 nanosheets are used for loading, and MnO2 nanosheets are degraded into Mn by GSH when exposed to the tumor microenvironment (with high expression of GSH, H2O2, slightly acidic, etc. as the basic characteristics). 2+ The characteristics of the MRI system are used to achieve self-sufficiency of in-situ divalent metal ions and build an intelligent imaging platform. It is applied to the precise imaging of breast cancer cells, providing new ideas and technical support for the early diagnosis of breast cancer and improving prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1Characterization analysis of the successful synthesis of MnO2 nanosheets; (A) Transmission electron microscope image of synthesized MnO2 nanosheets (B) element distribution analysis of synthesized MnO2 nanosheets.

[0016] Figure 2 Analysis of the successful construction of the imaging platform; (A) Analysis of the AND logic response ability of functionalized tetrahedrons to two microRNAs (B) Changes in the UV absorption spectrum of synthetic manganese dioxide nanosheets before and after assembly with functionalized tetrahedrons (C) Analysis of the elemental distribution of synthetic manganese dioxide nanosheets after assembly with functionalized tetrahedrons.

[0017] Figure 3 Analysis of the degradation ability of synthesized MnO2 nanosheets by GSH; (A) Images of solutions containing different concentrations of synthesized manganese dioxide nanosheets; a→i: 20, 30, 40, 50, 60, 70, 80, 90, 100 μg / mL; (B) Images of the corresponding solutions in A after reaction with 2 mm GSH; (C) UV absorption spectra of the corresponding solutions in A and B.

[0018] Figure 4 Mg 2+ and Mn 2+ Analysis of the effects on DNAzyme activity.

[0019] Figure 5 RT-PCR detection and analysis of the expression levels of two miRNAs in different cells.

[0020] Figure 6 Four cell competence analyses were performed to distinguish the constructed self-powered DNAzyme logic circuit.

[0021] Figure 7 To analyze the normal operation of each component of the constructed self-powered DNAzyme logic circuit in cells.

[0022] Figure 8 To verify whether the platform can respond to changes in intracellular target levels; (A) Laser confocal microscopy results and (B) RT-PCR results of MDA-MB-231 cells treated with miR-10b mimics (miR-10b M), miR-155 mimics (miR-155 M), miR-10b mimics & miR-155 mimics, miR-10b inhibitors (miR-10b I), miR-155 inhibitors (miR-155 I), and miR-10b inhibitors & miR-155 inhibitors; (C) Average fluorescence intensity statistics in A.

[0023] Figure 9Analysis of the ability of this platform to be used for in vivo imaging of breast cancer; (A) Time-dependent fluorescence monitoring results of live mice under different treatments. (B) Corresponding apparent fluorescence curve intensity. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0025] Table 1. DNA / RNA sequences and modifications used in the present invention Sequence Name Sequence Information (5’- 3’) hsa-miR-10b-5p UACCCUGUAGAACCGAAUUUGUG (SEQ ID NO.1) hsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID NO.2) S1 ACCCGCTAATGCCGCTCCATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO.3) S2 ATCCTCCGCACGCCTACCACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO.4) S3 ATCCTCCGCACGCCTACCACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.5) S4 ATCCTCCGCACGCCTACCACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO.6) Cy3-labelled S4 / Cy3 / ATCCTCCGCACGCCTACCACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO.7) E6 DNAzyme GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCAGCGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACCCATGTTCGTCCAG (SEQ ID NO.8) E6 -scrambledsequence GGAGCGGCATTAGCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCCGCGGCTCTGATACGACCCTGTAGAACCGCATACAATCGTGATAGGGGTCGTCACGTTGACTCGTCCAG (SEQ ID NO.9)(The scrambled positions areitalicized and bolded) Locking chainfor miR-10b CACAAATTCGGTTCTACAGGGTCGTATC (SEQ ID NO.10) Locking chainfor miR-155 TGACGACCCCTATCACGATTAGCATTAA (SEQ ID NO.11) 10-23 hairpin GGTAGGCGTGCGGAGGATTCGTCCAGGTCGTGTTTTTTTTTTCTGGACGAT / rA / GGCCGCGGCCAGGCTAGCTACAACGACCTGGACGA (SEQ ID NO.12) BHQ1 and FAMlabelled 10-23hairpin GGTAGGCGTGCGGAGGAT / iBHQ1dT / CGTCCAGGTCGTGTTTTTTTTTTCTGGACGAT / rA / GGCCGCGGCCAGGCTAGCTACAACGACCTGGACGA / FAM / (SEQ ID NO.13) BBQ650 and Cy5.5labelled 10-23hairpin GGTAGGCGTGCGGAGGAT / iBBQ650 / TCGTCCAGGTCGTGTTTTTTTTTTCTGGACGAT / rA / GGCCGCGGCCAGGCTAGCTACAACGACCTGGACGA / Cy5.5 / (SEQ ID NO.14) miR-10b Forwardprimer (FP) AACGATATACCCTGTAGAACCGA (SEQ ID NO.15) miR-10b Reverseprimer (RP) CAGTGCAGGGTCCGAGGT (SEQ ID NO.16) miR-10b Stem-loop RT Primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAA (SEQ IDNO.17) miR-155 FP AAGCGCCTTTAATGCTAATCGT (SEQ ID NO.18) miR-155 RP CAGTGCAGGGTCCGAGGT (SEQ ID NO.19) miR-155 Stem-loop RT Primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT (SEQ IDNO.20) U6 FR AGAGAAGATTAGCATGGCCCCTG (SEQ ID NO.21) U6 RP ATCCAGTGCAGGGTCCGAGG (SEQ ID NO.22) U6 Stem-loop RTPrimer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA (SEQ IDNO.23) miR-10b mimic F:UACCCUGUAGAACCGAAUUUGUG (SEQ ID NO.1); R:CAAAUUCGGUUCUACAGGGUAUU (SEQ ID NO.24) miR-155 mimic F:UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID NO.2); R:CCCCUAUCACGAUUAGCAUUAAUU(SEQ ID NO.25) miR-10binhibitor (mC)(mA)(mC)(mA)(mA)(mA)(mU)(mU)(mC)(mG)(mG)(mU)(mU)(mC)(mU)(mA)(mC)(mA)(mG)(mG)(mG)(mU)(mA) (SEQ ID NO.26) miR-155inhibitor (mA)(mA)(mC)(mC)(mC)(mC)(mU)(mA)(mU)(mC)(mA)(mC)(mG)(mA)(mU)(mU)(mA)(mG)(mC)(mA)(mU)(mU)(mA)(mA) (SEQ ID NO.27) Note: All DNA and RNA oligonucleotides in the present invention were synthesized by Takara Biotech (Dalian) Co., Ltd. and Shanghai Shenggong Biotech Co., Ltd. and purified by HPLC.

[0026] Example 1. Synthesis of MnO2 nanosheets 20mL of a mixed solution of 3% H2O2 and 0.6M tetramethylammonium hydroxide was quickly added (15s) to 10mL of 0.3M MnCl2 solution. This process was carried out on a conical flask on a magnetic stirrer, with a stirring speed of 800r / min overnight. The next day, the reaction solution was centrifuged (4000rpm; 10min), and obvious solid-liquid stratification was observed. The upper layer of liquid was discarded, and then washed with water and methanol (blowing and shaking and centrifuging again) three times, and it can be seen that the washing liquid has been completely clarified. The lower layer of solid obtained was then dried at 60℃ in a vacuum drying oven for 6h, and then ground into powder. Take 0.01g of powder and add it to 20mL of water, continuously ultrasonicate for 10h, centrifuge at 3000rpm for 20min, and collect the supernatant as the MnO2 nanosheet solution. Store at 4℃ for later use.

[0027] The synthesized MnO2 nanosheets were photographed by transmission electron microscopy to analyze their morphology and element distribution. The results showed that the synthesized MnO2 nanosheets had a nano-thin layer structure ( Figure 1 , A), the element distribution results show that the O and Mn elements are distributed in an overlapping manner, and there is no enrichment of C, N, P and other elements, indicating that the MnO2 nanosheets are successfully synthesized ( Figure 1 , B).

[0028] Example 2. Assembly of DNAzyme logic circuits The seven chains of S1-S4 (SEQ ID NO.3~6), E6 DNAzyme chain (SEQ ID NO.8), miR-10b locker (SEQ ID NO.10), and miR-155 locker (SEQ ID NO.11) were mixed in a buffer (HEPES 10mM; pH=7.3; containing 150mM NaCl) with equal molar concentrations, and programmed gradient cooling was performed at 95℃ for 5min; 65℃ for 30min; 50℃ for 30min; 42℃ for 30min; 37℃ for 30min; 22℃ for 30min; and stored at 4℃ to form a basic tetrahedron. Then, a reporter hairpin (SEQ ID NO.12~14) with a 3-fold corresponding molar concentration was added and the fully assembled tetrahedral structure was formed at 37℃ for 1h. The reporter hairpin needed to be heated to 95℃ in a buffer (HEPES 10mM; pH=7.3; containing 150mM NaCl) in advance and cooled naturally to ensure that the hairpin structure was fully formed. Then the solution containing the tetrahedron machine was mixed with the MnO2 nanosheet solution in the corresponding volume ratio of 500nM functionalized tetrahedron: 3.47mM MnO2 nanosheet = 2.826:1, and incubated at 37°C for 30min to form a platform.

[0029] Among them, S1-S4 constitute the basic skeleton of the DNA tetrahedron, and the E6 DNAzyme chain and the reporter hairpin probe are fixed on the vertices of the tetrahedron. The two locking chains miR-10b locker and miR-155 locker complementarily hybridize with the 5' and 3' ends of the E6 DNAzyme chain, respectively, blocking the core catalytic sequences at both ends and making it lose its cleavage activity; when the target microRNA (miR-10b and miR-155) are present, the two locking chains bind to the target microRNA respectively, making the E6 DNAzyme chain conformationally restore the active structure, and its two side arms can complementarily hybridize with the sequences on both sides of the rA site on the reporter hairpin probe, and cleave the rA site in the presence of metal cofactors, so that the reporter hairpin probe is cut and separated, releasing fluorescent signals.

[0030] First, the DNA tetrahedron equipped with a DNAzyme circuit to achieve dual microRNA AND logic detection capabilities was analyzed. The results showed that only dual microRNA input would cause the DNAzyme circuit to start and release the reporter molecule ( Figure 2 , A). The imaging platform was then analyzed by transmission electron microscopy element distribution. The results showed that after the MnO2 nanosheets were assembled with the functionalized DNA tetrahedrons, in addition to O and Mn elements, there were also aggregated distributions of C, N, P and other elements, indicating that the DNA tetrahedrons were physically adsorbed by the MnO2 nanosheets to form an integrated platform ( Figure 2, C). In addition, atomic force microscopy can be used to observe that in addition to the MnO2 absorption peak at about 360nm, the UV absorption spectrum also shows a DNA characteristic absorption peak, indicating that the MnO2 nanosheets and functionalized DNA tetrahedrons are effectively integrated, indicating that the platform is successfully constructed ( Figure 2 , B).

[0031] Example 3. Reduction ability of MnO2 by GSH The MnO2 nanosheet solution was diluted to a concentration of 20 / 30 / 40 / 50 / 60 / 70 / 80 / 90 µg / mL, and then glutathione solution (GSH, 100mM) was added to make the final concentration reach 2mM. Incubate at 37°C for 30min, and then take photos and record. Then perform UV absorption spectrum test to analyze the peak change.

[0032] In order to verify whether the synthesized nanosheets can be digested by glutathione after entering the cells, the average glutathione concentration (2mM) in the cells was simulated and reacted with nanosheets of different concentrations. The results showed that at this GSH concentration, nanosheets with a concentration of up to 70 µg / mL were easily degraded ( Figure 3 ). This indicates that we have successfully synthesized ideal manganese dioxide nanosheets, which can meet the requirements of divalent metal ion supply in cells.

[0033] Example 4. Effect of metal ions on DNAzyme activity The corresponding DNAzyme and its corresponding substrate (reporter hairpin) were added to the annealing buffer (without divalent metal ions) at a concentration of 500 nM. Then Mg 2+ and Mn 2+ The solution makes the metal ions reach the corresponding concentration value, reacts at 37°C for a corresponding period of time, and then PAGE is performed to analyze the cleavage of the corresponding substrate by DNAzyme. It is important to explore the dependence of DNAzymes on divalent metal ions to ensure the normal function of E6 DNAzyme in cells. E6 was first reported to be mainly dependent on Mg 2+ However, as the most abundant free divalent metal ion in human cells, its average concentration is only about 0.5 mM, which is far from enough to ensure the cleavage activity of E6. We found that when 0.5 mM Mn 2+ ions, the activity of E6 is greatly enhanced and can meet the application requirements ( Figure 4 ).

[0034] Example 5. Cell culture Human breast cancer MDA-MB-231 cells and human melanoma SK-MEL-28 cells were cultured in DMEM medium supplemented with 10% serum and 1% double antibody, and human cervical squamous cell carcinoma Siha cells were cultured in MEM medium supplemented with 10% serum and 1% double antibody. Human normal breast epithelial MCF-10A cell line was cultured in DMEM + 5% HS + 20ng / mL EGF + 0.5μg / mL Hydrocortisone + 10μg / mL Insulin + 1% NEAA + 1% P / S in a 5% CO2 constant temperature incubator. When the cells grew to about 80%, they were passaged.

[0035] Nucleic acids were extracted from the breast cancer cells MDA-MB-231 and the three control cells MCF 10A, SK-MEL-28 and SiHa for RT-PCR detection of the expression of two microRNAs (primers used were SEQ ID NO.15-23). ​​The results showed that compared with the expression of miR-10b in MCF 10A, MDA-MB-231 and SK-MEL-28 showed relatively high expression, and the expression of miR-10b in SiHa was significantly lower than that in these two cells. Compared with the expression of miR-155 in MCF 10A, MDA-MB-231 and SiHa showed significantly high expression, and SK-MEL-28 showed significantly low expression ( Figure 5 ).

[0036] Example 6. Laser confocal microscopy analysis of cell fluorescence Cells were plated on confocal dishes, 1×10^5 cells / dish, 1mL / dish. After the cells were attached overnight, the culture dish was removed at the desired time point, the culture medium was discarded, and 200µL of fresh culture medium containing 32.26µL platform (the 10-23 hairpin used for platform assembly for intracellular imaging is SEQ ID NO.13) was added. Incubate at 37℃ for the corresponding time. Then wash twice with PBS. Then add 1mL Hoechst33342 dye solution and stain at 37℃ for 15min. Wash three times with PBS and shoot confocal images.

[0037] In order to exclude the possibility that different output signals are caused by different numbers of platforms entering the cell, one chain of the DNA tetrahedron was labeled with Cy3 fluorescence (i.e., SEQ ID NO.7 was used to assemble the platform instead of SEQ ID NO.6) to observe its entry and distribution in the cell. The experimental results showed that after incubation with the platform solution, the FAM fluorescence intensity of the MDA-MB-231 cell line was significantly higher than that of the other three cell lines ( Figure 6 ), indicating that the platform can accurately identify target cells based on the tumor microenvironment and miRNA expression levels.

[0038] To further determine whether the DNA circuit operates normally in cells, we constructed two control groups. In one group, the core sequence of E6 was disrupted (E6-S group); that is, SEQ ID NO.9 was used instead of SEQ ID NO.8 during platform assembly), so that it no longer had cutting activity, and thus could not cut the functional hairpin, that is, the AND logic gate element was damaged. The other group had only one functional DNA tetrahedron and lacked the MnO2 nanosheet (MnO2-L group), so it could not self-supply divalent metal ions after internalization, which seriously affected the activity of E6 DNAzyme, that is, lacked the YES logic gate element. When MDA-MB-231 was incubated with the established platform and these two control groups, obvious fluorescence was observed only in the platform group (Figure 7). The results show that the DNA logic circuit operates normally in cells.

[0039] Example 7. Cell transfection experiment Cells were plated in 6-well plates, 1.5×10^5 cells / well, 2.5mL / well, and cells were allowed to adhere overnight. Preparation of transfection complex: 125µL of opti-MEM (purchased from Gibco) reduced serum medium was added to a nearly sterile centrifuge tube, and 100pmol of miRNA mimics / inhibitor (SEQ ID NO.24-27) was added. After gentle mixing, 4µL of lipo8000 (purchased from Biyuntian Biotechnology) was added. After gentle mixing (note that centrifugation or vortexing is not allowed), the cells were placed at room temperature for 20 minutes for later use. The medium in the 6-well plate where cells have adhered was discarded and replaced with fresh medium. 125µL of the corresponding transfection complex was added to each well, and the mixture was gently mixed. The cells were cultured in a 37°C incubator for two days, and then subsequent operations such as qPCR and platform detection were performed.

[0040] Example 8. miRNA RT-PCR To test whether the platform can monitor the expression fluctuations of the target miRNA, MDA-MB-231 cells were treated with two miRNA mimics and inhibitors before incubation with the platform. The total RNA of the collected cells (cell number 1-2×10^6) was then quickly extracted using the Spark easy cell RNA kit. The relevant steps were carried out according to the operation manual, and then the A260 / A280 and A260 / 230 parameters were measured using NanoDrop to determine whether the extraction purity was qualified. Reverse transcription was then performed according to the operating instructions of the Sangon miRNA first-strand cDNA synthesis (stem-loop method) kit, and the cDNA concentration was determined again using Nanodrop and stored at 4°C for PCR reaction. The PCR reagent used was Clontech's TB GreenAdvantage qPCR Premix kit, and the PCR reaction was performed according to the operation manual to determine the miRNA expression level.

[0041] The results showed that the fluorescence signal was significantly weakened when any one of the two microRNA inhibitors was treated, and it was only significantly enhanced when the two mimics were treated simultaneously ( Figure 8 ). The above results fully prove that the YES-AND logic operation has been successfully constructed in cells, and this platform can monitor the expression changes of miRNA in cells.

[0042] Example 9. In vivo animal imaging To explore whether the platform can directly identify tumor cells in vivo, 4-week-old female nude mice were taken and adapted to the environment in the SPF animal room for 1 week. Then, MDA-MB-231 breast cancer cells were inoculated to establish a model. Each mouse was inoculated with 3×10^6 cells. After the tumor grew for two weeks, the platform group, E6-S group and MnO2-L group were injected into the MDA-MB-231 tumor mice at a dosage of 48.39 μL (the 10-23 hairpin used for platform assembly for animal imaging is SEQ ID NO.14), and three-dimensional in vivo imaging was performed at 1, 2, 4, 8, 12, 24, 48, and 72 hours. At the same time, the platform group was injected into the same area of ​​healthy mice (control group). Then fluorescence monitoring was performed for 72 hours. The results showed that the fluorescence intensity was significantly higher than that of the other three groups, indicating that the platform can be used for in situ imaging of breast cancer ( Figure 9 ).

[0043] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A breast cancer cell precision imaging platform based on a self-powered DNAzyme logic circuit, characterized in that: The imaging platform is prepared by the following steps: seven chains, namely, S1-S4 chains shown in SEQ ID NO.3-6, E6DNAzyme chain shown in SEQ ID NO.8, miR-10b locker shown in SEQ ID NO.10, and miR-155 locker shown in SEQ ID NO.11, are mixed in a buffer at equal molar concentrations, and the temperature is gradually reduced to form a basic tetrahedron, and then a reporter hairpin probe shown in SEQ ID NO.13 or 14 is added at a 3-fold corresponding molar concentration, and incubated to form a fully assembled tetrahedral structure, and finally the solution containing the fully assembled tetrahedral structure is mixed with a MnO2 nanosheet solution, and incubated to form an imaging platform; In the fully assembled tetrahedral structure, the S1-S4 chains constitute the basic skeleton of the tetrahedron, and the E6 DNAzyme chain and the reporter hairpin probe are fixed on the vertices of the tetrahedron in a ratio of 1:3; the two locking chains miR-10b locker and miR-155 locker complementarily hybridize with the 5' end and 3' end of the E6 DNAzyme chain respectively, blocking the core catalytic sequences at both ends and making it lose its cleavage activity; when the target miR-10b and miR-155 are present, the two locking chains bind to the targets respectively, so that the E6 DNAzyme chain can transform and restore the active structure, and its two side arms can complementarily hybridize with the sequences on both sides of the rA site on the reporter hairpin probe, and cleave the rA site in the presence of a divalent metal cofactor so that the reporter hairpin probe is cut and separated, releasing a fluorescent signal; the MnO2 nanosheet is degraded into Mn when exposed to the tumor microenvironment. 2+ , achieving self-sufficiency of in situ divalent metal ions.

2. The breast cancer cell precision imaging platform according to claim 1, characterized in that: The buffer is 10 mM HEPES buffer containing 150 mM NaCl and pH=7.

3.

3. The breast cancer cell precision imaging platform according to claim 1, characterized in that: The gradient cooling is 95°C for 5 min; 65°C for 30 min; 50°C for 30 min; 42°C for 30 min; 37°C for 30 min; 22°C for 30 min; and stored at 4°C.

4. The breast cancer cell precision imaging platform according to claim 1, characterized in that: The incubation is carried out at 30-40° C. for 0.5-1 h.

5. The breast cancer cell precision imaging platform according to claim 1, characterized in that: The reporter hairpin probe needs to be heated to 95° C. in a buffer in advance and cooled naturally to ensure that the hairpin structure is fully formed.

6. The breast cancer cell precision imaging platform according to claim 1, characterized in that: The preparation method of the MnO2 nanosheet solution is as follows: a mixed solution of H2O2 with a mass concentration of 3% and tetramethylammonium hydroxide with a concentration of 0.6M is quickly added to a 0.3M MnCl2 solution in a volume ratio of 2:1, and the mixture is reacted overnight under magnetic stirring. The reaction solution is centrifuged the next day, the upper liquid is discarded, and the lower solid is vacuum dried and ground into powder after being washed with water and methanol respectively, and then water is added for ultrasonic dissolution to prepare a 3.47mM solution.

7. The breast cancer cell precision imaging platform according to claim 2, characterized in that: The concentration of the solution of the fully assembled tetrahedral structure is 500 nM, and the volume ratio of the solution of the fully assembled tetrahedral structure mixed with the 3.47 mM MnO2 nanosheet solution is 2.826:

1.

8. Use of the breast cancer cell precision imaging platform of claim 1 in in situ imaging of breast cancer.

Images