Application of Ran-W gene in identifying gender of Chinese softshell turtle

Abstract

The invention relates to the technical field of Chinese softshell turtles, in particular to application of a Ran-W gene in identifying genders of Chinese softshell turtles. The embodiment of the invention finds a potential function of the Ran-W gene in sex determination of the Chinese softshell turtles, and provides a primer group, a kit, a method and application for identifying the sex of the Chinese softshell turtles. The primer group, the kit, the method and the application can accurately and sensitively identify the gender of the Chinese softshell turtles, and can also identify the development maturity of oocytes of the Chinese softshell turtles.

Description

Technical Field

[0001] The present application relates to the technical field of Chinese soft-shelled turtle, and in particular to the application of Ran-W gene in identifying the sex of Chinese soft-shelled turtle. Background Art

[0002] The sex determination mode of Chinese soft-shelled turtle is ZW-type genetic sex determination, and some key genes involved in the sex determination process of Chinese soft-shelled turtle have been identified, including Dmrt1, Amh, Sox8, Foxl2, Rspo1 and Esr1. They are significantly differentially expressed in the male and female gonads during the sex determination window period of Chinese soft-shelled turtle. Knockdown of Dmrt1, Amh and Sox8 will lead to upregulation of the expression of female sex marker genes and reversal of male to female sex. In contrast, knockdown of Foxl2, Rspo1 and Esr1 will lead to upregulation of the expression of male sex marker genes and reversal of female to male sex. However, there is evidence that these sex marker genes are not located on sex chromosomes. The genes on the W chromosome of Chinese soft-shelled turtle are the first to respond to sex determination / differentiation and are differentially expressed before the sex determination window period, followed by genes on the Z chromosome, and finally the module where autosomal genes such as Dmrt1 are located.

[0003] Therefore, it is necessary to develop sex marker genes located on the sex chromosomes of Chinese soft-shelled turtle. Summary of the invention

[0004] In view of this, the present application examples discovered the potential function of the Ran-W gene (NCBI gene name LOC102446816, mRNA sequence number XM_006116766.3, source genome sequence number NW_005853425.1) in the sex determination of Chinese soft-shelled turtle, and provided primer sets, kits, methods and applications for identifying the sex of Chinese soft-shelled turtle.

[0005] In the first aspect, the embodiment discloses a primer set for identifying the sex of Chinese soft-shell turtle, which includes DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2.

[0006] In a second aspect, the embodiment discloses a kit for identifying the sex of Chinese soft-shell turtle, comprising DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2, and reagents required for PCR amplification.

[0007] In the third aspect, the embodiment discloses a method for identifying the sex of a Chinese soft-shell turtle. The method comprises: extracting genomic DNA, performing PCR amplification on the genomic DNA using the primer set described in the first aspect, performing electrophoresis detection on the PCR amplification product, and identifying the sex of a Chinese soft-shell turtle according to the result of the electrophoresis detection.

[0008] In a fourth aspect, an embodiment discloses a method for identifying the sex of a Chinese soft-shelled turtle. The method comprises: extracting total RNA from a Chinese soft-shelled turtle tissue, reverse transcribing the total RNA into cDNA, performing fluorescent PCR amplification on the cDNA using the primer set described in the first aspect, reading a Ct value according to the amplification curve of the fluorescent PCR, and identifying the sex of the Chinese soft-shelled turtle according to the Ct value.

[0009] In a fifth aspect, an embodiment discloses a method for identifying the sex of a Chinese soft-shelled turtle. The method comprises: extracting total RNA from a Chinese soft-shelled turtle tissue, reverse transcribing the total RNA into cDNA, performing fluorescent PCR amplification on the cDNA using the primer set described in the first aspect, and performing electrophoresis detection on the product of the fluorescent PCR amplification; and identifying the sex of a Chinese soft-shelled turtle according to the electrophoresis bands.

[0010] In a sixth aspect, the embodiment discloses a method for identifying the developmental maturity of a Chinese soft-shell turtle oocyte. The method comprises: using a sense probe and / or an antisense probe to perform fluorescent in situ hybridization on a paraffin section containing an oocyte, wherein the sense probe is:

[0011] UUUAGGUGACACUAUAGAAUACU ACGGGAGTGAUACCGAAAG; the underlined part indicates the digoxigenin signal marker and the Sp6 linker;

[0012] The antisense probe is:

[0013] Antisense probes: UAAUACGACUCACUAUAGGGCGA AGCAAGAGCAGGCAUAGC; the underline indicates the digoxigenin signal tag and T7 linker.

[0014] In the seventh aspect, the embodiment discloses a method for improving the sensitivity of sex identification of Chinese soft-shelled turtle. The method comprises: injecting 50 μg / μL of 17α-methyltestosterone and 50 μg / μL of 17β-estradiol into Chinese soft-shelled turtle, with an injection dose of 10 mg / kg, and obtaining its gonadal tissue DNA; using the above primers to perform PCR amplification on it, and identifying the sex of Chinese soft-shelled turtle according to the PCR amplification results. In this way, after the injection of 17α-methyltestosterone and 17β-estradiol, the expression level of the 15th and 26th stages of the Ran-W gene can be promoted, so that the sex identification of the Chinese soft-shelled turtle using the Ran-W gene is facilitated, and the sensitivity of sex identification is improved.

[0015] In the eighth aspect, the embodiment provides the application of the primer set of the first aspect and the kit of the second aspect, wherein the application is selected from at least one of identifying the sex of Chinese soft-shelled turtle, identifying the developmental maturity of oocytes for the sex of Chinese soft-shelled turtle, and improving the sensitivity of sex identification of Chinese soft-shelled turtle. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1The electrophoresis result diagram of using Ran-W gene and Ef1α gene to identify the genetic sex of Chinese soft-shelled turtle provided in the example.

[0017] Figure 2 This is a statistical result diagram of the relative expression of the Ran-W gene in various tissues of male and female Chinese soft-shelled turtles provided in the examples, and all data are expressed in the form of mean ± standard error. ***, P < 0.001.

[0018] Figure 3 The electrophoresis results of the fluorescent PCR amplification products of the Ran-W gene and the Ef1α gene in various tissues of male and female individuals of the Chinese soft-shelled turtle provided in the examples are shown.

[0019] Figure 4 This is a result diagram of the method for identifying the developmental maturity of Chinese soft-shelled turtle oocytes provided in the embodiment. Figure 4 A is the fluorescence hybridization image of the ovarian tissue of Chinese soft-shell turtle in winter. Figure 4 B is Figure 4 A. Cell nuclear staining. Figure 4 C is Figure 4 A and Figure 4 The merged graph of B. Figure 4 D is the fluorescence hybridization image of the ovarian tissue of Chinese soft-shell turtle in winter 3. Figure 4 E is Figure 4 D Nuclear staining, Figure 4 F is Figure 4 D and Figure 4 Merged image of E. IV, primary oocyte; VII, growing oocyte; IX, mature oocyte; fc, granulosa cell. Image scale is 100 μm.

[0020] Figure 5 The expression changes of Ran-W gene after E2 and MT treatment provided in the examples. Figure 5 A shows the effects of E2 and MT treatment on the expression of Ran-W in the ovaries of one-winter female Chinese soft-shelled turtle. Figure 5 B and Figure 5 C shows the expression response of Ran-W in the gonads of female embryos at stages 15 and 26 after treatment with E2 and MT. All data are expressed as mean ± standard error. *, P < 0.05; **, P < 0.01. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0022] One implementation method: Ran-W gene for identifying the sex of Chinese soft-shell turtle (conventional PCR)

[0023] The embodiment discloses a primer set for identifying the sex of Chinese soft-shelled turtle, including DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2. The embodiment also discloses a kit for identifying the sex of Chinese soft-shelled turtle, including DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2, and reagents required for PCR amplification. Among them, the reagents required for PCR amplification include 2×TaqMasterMix and double distilled water. Further, in some embodiments, the kit also includes DNA molecules such as SEQ ID NO: 3 and SEQ ID NO: 4, which are used as positive controls for the sex of Chinese soft-shelled turtle.

[0024] The embodiment provides a method for identifying the sex of a Chinese soft-shell turtle, which includes extracting genomic DNA, performing PCR amplification on the genomic DNA using F1 (SEQ ID NO: 1) and R1 (SEQ ID NO: 2) as a primer pair, performing electrophoresis detection on the PCR amplification product, and identifying the sex of a Chinese soft-shell turtle according to the result of the electrophoresis detection.

[0025] In some embodiments, the step of extracting genomic DNA includes: extracting the genomic DNA of the liver tissue of Chinese soft-shell turtle using the GENERAY Cell / Tissue Genomic DNA Extraction Kit (centrifugal column type) according to the instructions of the kit.

[0026] In some embodiments, the PCR reaction system in 25 μL includes: 1 μL of Chinese soft-shell turtle genomic DNA as template, 12.5 μL of 2×Taq Master Mix, 2 μL of 10 μmol / μL F1, 2 μL of 10 μmol / μL R1, and 9.5 μL of ddHO. 2 O. Positive control, the same identification steps were performed using Ef1α-F and Ef1α-R as primer pairs.

[0027] In some embodiments, the qPCR reaction program is as follows: 94°C for 3 min, 94°C for 30 s, 61°C for 30 s, 72°C for 30 s for a total of 35 cycles, and extension at 72°C for 5 min.

[0028] like Figure 1 As shown, the primer set, kit and method provided in the embodiment can only amplify the target band in female Chinese soft-shelled turtles, but no band is amplified in male individuals, and the accuracy of the identification result is 100%; the Ef1α-F / R primer used as a positive control can amplify the target band in 6 female and 6 male individuals. This shows that the primer set, kit and method provided in the embodiment can be used to identify the sex of Chinese soft-shelled turtles.

[0029] Another embodiment: Ran-W gene for identifying the sex of Chinese soft-shell turtle (fluorescence PCR)

[0030] 1. Fluorescence kit

[0031] Based on this, the embodiment also discloses a fluorescent kit for identifying the sex of Chinese soft-shell turtle, including DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2, and a DNA binding dye. In some embodiments, the DNA binding dye is SYBRGreen.

[0032] In some embodiments, the fluorescence kit further comprises FastKingGRTSuperMix.

[0033] 2. Identification method provided by an embodiment

[0034] The embodiment provides a method for identifying the sex of a Chinese soft-shelled turtle. The method comprises extracting total RNA from a Chinese soft-shelled turtle tissue, reverse transcribing the total RNA into cDNA, using F1 and R1 as primers to perform fluorescent PCR amplification on the cDNA, reading a Ct value according to the amplification curve of the fluorescent PCR, and identifying the sex of the Chinese soft-shelled turtle according to the Ct value.

[0035] In some embodiments, the reverse transcription reaction system comprises 4 μL 5×FastKingGRT SuperMix and 16 μL RNA in 20 μL. The reverse transcription procedure includes 42° C. for 15 min and 95° C. for 3 min.

[0036] In some embodiments, the reaction system of the fluorescent PCR contains 1 μL of 10 μmol / L DNA as shown in SEQ ID NO: 1, 1 μL of 10 μmol / L DNA as shown in SEQ ID NO: 2, 10 μL of 2×SYBRGreen, 2 μL of cDNA and 6 μL of double distilled water in 20 μL. The reaction steps of the fluorescent PCR include: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 40 s, extension at 72°C for 30 s, for a total of 40 cycles.

[0037] In some embodiments, the same method as in the embodiment is used to perform fluorescent PCR amplification using DNA shown in SEQ ID NO: 8 and 9 as primers, and the amplification curve of the fluorescent PCR is obtained to read the Ct value as a control, 2 -△△Ct The relative expression level of Ran-W gene was calculated by this method.

[0038] In a specific embodiment, total RNA is extracted from the heart, liver, spleen, lung, kidney, brain, intestine and muscle tissues of Chinese soft-shelled turtle, reverse transcribed into cDNA, and amplified by fluorescent PCR. The Ct value is read according to the amplification curve of the fluorescent PCR, and the sex of the Chinese soft-shelled turtle is identified according to the Ct value.

[0039] like Figure 2 As shown, the relative expression levels of male individuals were significantly lower than those of female individuals ("***" indicates P < 0.001). This shows that sampling the tissues of Chinese soft-shelled turtle can effectively distinguish between male and female individuals, which is very helpful for identifying the sex of Chinese soft-shelled turtle.

[0040] 3. Identification method provided by another embodiment

[0041] The embodiment provides a method for identifying the sex of a Chinese soft-shelled turtle. The method comprises extracting total RNA from a Chinese soft-shelled turtle tissue, reverse transcribing the total RNA into cDNA, performing fluorescent PCR amplification on the cDNA using F1 and R1 as primers, performing electrophoresis detection on the product of the fluorescent PCR amplification, and identifying the sex of the Chinese soft-shelled turtle based on the electrophoresis bands.

[0042] In a specific embodiment, total RNA is extracted from the heart, liver, spleen, lung, kidney, brain and muscle tissues of female and male Chinese soft-shelled turtles, respectively, reverse transcribed into cDNA, and amplified by fluorescent PCR. The products of the fluorescent PCR amplification are detected by electrophoresis, and the sex of the Chinese soft-shelled turtle is identified based on the electrophoresis bands.

[0043] like Figure 3 As shown in the figure, obvious amplified bands can be seen in the muscle tissue of female individuals, while no bands are shown in the muscle tissue of male individuals. This shows that sampling the tissues of Chinese soft-shelled turtle can effectively distinguish between male and female individuals, which is very helpful for identifying the sex of Chinese soft-shelled turtle.

[0044] Methods for identifying the developmental maturity of oocytes of Chinese soft-shell turtle

[0045] In one aspect, the embodiment also discloses a method for identifying the developmental maturity of a Chinese soft-shell turtle oocyte. The method comprises:

[0046] On the one hand, the embodiments also disclose that the probe can be used to identify the developmental maturity of oocytes of Chinese soft-shell turtle.

[0047] The probe disclosed in the embodiment includes a sense probe:

[0048] UUUAGGUGACACUAUAGAAUACU ACGGGAGTGAUACCGAAAG; the underline indicates the digoxigenin signal tag, Sp6 linker, SEQ ID NO: 10;

[0049] Antisense probes: UAAUACGACUCACUAUAGGGCGA AGCAAGAGCAGGCAUAGC; the underline indicates the digoxigenin signal tag, T7 linker, SEQ ID NO:11.

[0050] On the one hand, the embodiment also provides a method for distinguishing the developmental maturity of oocytes of Chinese soft-shelled turtle. The method comprises:

[0051] 1) Preparation of sections: cryosectioning was performed on the embedded ovarian tissues of one-winter-age and three-winter-age Chinese soft-shell turtles. The cryosections were fixed with 4% (volume fraction) neutral formaldehyde, embedded in paraffin, and then dewaxed and rehydrated;

[0052] 2) Prehybridization: After the sections were washed with DEPC water and PBST solution, they were digested with 2μg / ml proteinase K at 37℃ for 12min; then incubated with 0.1M TEA for 10min; washed twice with PBST for 10min; fixed with 4% paraformaldehyde in the dark for 20min; then washed twice with PBST for 10min; and then prehybridized with HB hybridization solution at 60℃ for 4h. The HB hybridization solution contains 10mL deionized formyl, 5mL 20×SSC, 4mL BR, 400μL yeast tRNA (5μg / ml), 400μL DEPC water and 200μL 0.1% Tween-20.

[0053] 3) Probe denaturation and hybridization: 200 ng of sense probe and / or 200 ng of antisense probe were mixed into 30 μL HB hybridization solution and denatured at 95°C for 5 min. The mixture was quickly cooled on ice and added into 270 μL HB hybridization solution at 60°C. After thorough mixing, the mixture was added into the sample wells and hybridized at 60°C for 17 h.

[0054] 4) Elution of probe: All reagents used for elution of probe need to be preheated at 37℃ / 60℃ and eluted in the corresponding environment. The elution conditions are shown in Table 1.

[0055] Table 1

[0056] Eluent temperature Washing time Washing times 2×SSC 60℃ 20min 2 2×SSC 37℃ 10min 2 2×SSC 60℃ 20min 1 1×SSC 60℃ 20min 1 0.2×SSC+0.1% Tween 20 60℃ 20min 1

[0057] 5) Blocking and antibody incubation

[0058] Add 500 μL MaNaT (0.1M maleic acid, 0.15M NaCl, 0.1% Tween-20, pH 7.5) to the sample well and wash for 10 min in the dark, wash twice. Add 300 μL blocking buffer (1% blocking reagent, 0.1M MaNaT, 0.15M NaCl, 0.1% Tween-20) and block for 1.5 h in the dark. Add Anti-digoxigenin-AP (Roche Applied Science) antibody to the Blocking buffer at a ratio of 1:3000, mix thoroughly, pipette 300 μL into the sample well, and incubate for 1 h in the dark.

[0059] 6) Washing the antibody

[0060] Add 500 μL of MaNaT washing antibody to the sample well, wash for 5 min in the dark for 2 times, then add 500 μL of MaNaT washing antibody, wash for 15 min in the dark for 4 times.

[0061] 7) Color development and termination reaction

[0062] Aspirate MaNaT and add 500 μL AP Buffer (5.844 μg / ml NaCl, 12.114 μg / ml Tris, 10.1 μg / ml MaCl·6H 2 O, pH 9.5) for two washes, each for 5 min; NBT / BCIP (nitro bluetetrazolium / 5-bromo-4-chloro-3-indolyl phosphate) was added to AP Buffer at a ratio of 1:50, and 400 μL was pipetted into the sample well after thorough mixing. The color was developed for 10 min in the dark. When the green signal was observed under the microscope, the color development solution was aspirated.

[0063] 8) Counterstaining

[0064] Aspirate PBST, add 500 μL 4% paraformaldehyde to fix for 40 min; aspirate the fixative, add 500 μL PBST to wash twice, each time for 10 min; aspirate PBST, add 300 μL 1% DAPI staining solution for counterstaining.

[0065] 9) Seal the slide

[0066] After restaining, pick up the slides with tweezers and dehydrate them in gradient ethanol (70%, 95%, 100%, 100%) in sequence; soak them in 100% anhydrous ethanol: xylene (1:1) for 2 minutes; soak them in xylene for 5 minutes; and finally seal the slides with neutral gum.

[0067] 10) Microscopic observation

[0068] Use 1-4x magnification to observe the overall signal expression of tissue hybridization, use 10x, 20x and 40x magnification to observe local hybridization signals, and take pictures.

[0069] 11) Results

[0070] like Figure 4 As shown, the fluorescence signal is strongest in the granulosa cells surrounding the stage IV oocyte. As the oocyte matures, the expression signal of Ran-W in the granulosa cells gradually weakens.

[0071] Methods for improving the sensitivity of sex identification of Chinese soft-shell turtle

[0072] 1. Treatment of adult Chinese soft-shelled turtles and fertilized eggs with 17α-methyltestosterone and 17β-estradiol

[0073] Thirty-three healthy one-winter-aged Chinese soft-shelled turtles were divided into two groups, 15 in each group, and 17α-methyltestosterone (MT) and 17β-estradiol (E2) were injected intraperitoneally, with a solution concentration of 50 μg / μL and an injection dose of 10 mg / kg. Three female Chinese soft-shelled turtles were randomly selected for gonad sampling at 6 hours, 12 hours, 24 hours, 48 ​​hours and 7 days after injection. Another three female Chinese soft-shelled turtles were injected with the same dose of solvent as negative controls. In addition, 400 fertilized Chinese soft-shelled turtle eggs were taken and divided into two groups, 200 in each group. The incubation temperature was set at 31°C and the humidity was 75-85%. When the embryos developed to 12 and 14 days (the sex determination window period), 5 μL of 17α-methyltestosterone and 17β-estradiol solution with a concentration of 20 μg / μL was applied to the animal pole of the fertilized eggs. [9 ，10] The control group was smeared with an equal amount of solvent. Female gonads were collected at embryonic development stages 15 and 26, and the sex of the embryos was identified using the female-specific markers of Chinese soft-shelled turtle developed in Chapter 2. [1] , then, RNA extraction and qPCR experiments were performed.

[0074] 2. Results

[0075] The results of the study in Example 1 showed that the expression of the Ran-W gene in the ovaries of 1-winter-aged female Chinese soft-shelled turtles was significantly upregulated after E2 and MT treatment (P < 0.01). After E2 and MT treatment, its expression level gradually increased, reaching a peak at 12 hours. Subsequently, its expression level gradually decreased and returned to the level before treatment at 7 days ( Figure 5 A). The results of embryo hormone treatment showed that both E2 and MT treatment significantly upregulated the 15th stage ( Figure 5 B) and 26 ( Figure 5 C) The expression level of Ran-W gene in female embryonic gonads (P<0.05).

[0076] The present application embodiment provides a method for improving the sensitivity of sex identification of Chinese soft-shelled turtle. The method comprises: injecting 17α-methyltestosterone and 17β-estradiol into Chinese soft-shelled turtle, obtaining its gonadal tissue DNA; using the above primers to perform PCR amplification on it, and identifying the sex of Chinese soft-shelled turtle according to the PCR amplification result. In this way, after the Chinese soft-shelled turtle is injected with 17α-methyltestosterone and 17β-estradiol, it can promote the upregulation of the expression level of the 15th and 26th stages of the Ran-W gene, thereby facilitating the sex identification using the Ran-W gene and improving the sensitivity of sex identification.

[0077] In some embodiments, 17α-methyltestosterone (MT) and 17β-estradiol (E2) are injected, the solution concentration is 50 μg / μL, and the injection dose is 10 mg / kg.

[0078] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A primer set for identifying the sex of Chinese soft-shell turtle, comprising DNA molecules such as SEQ ID NO: 1 and SEQ ID NO:

2.

2. A kit for identifying the sex of Chinese soft-shelled turtle, comprising DNA molecules such as SEQ ID NO: 1 and SEQ ID NO: 2, and reagents required for PCR amplification.

3. The kit according to claim 2, wherein the reagents required for PCR amplification include 2×TaqMasterMix, double distilled water, and DNA molecules such as SEQ ID NO: 3 and SEQ ID NO:

4. The kit according to claim 2 , further comprising a DNA binding dye.

5. Methods for identifying the sex of Chinese soft-shelled turtle include: Extract genomic DNA, use the primer set as claimed in claim 1 to perform PCR amplification on the genomic DNA, perform electrophoresis detection on the product of the PCR amplification, and identify the sex of the Chinese soft-shelled turtle according to the result of the electrophoresis detection.

6. Methods for identifying the sex of Chinese soft-shelled turtle include: Total RNA is extracted from Chinese soft-shell turtle tissue, and the total RNA is reverse transcribed into cDNA. The cDNA is amplified by fluorescent PCR using the primer set as claimed in claim 1, and the Ct value is read according to the amplification curve of the fluorescent PCR, and the sex of the Chinese soft-shell turtle is identified according to the Ct value.

7. Methods for identifying the sex of Chinese soft-shelled turtle include: The total RNA of Chinese soft-shell turtle tissue is extracted, and the total RNA is reverse transcribed into cDNA. The cDNA is amplified by fluorescent PCR using the primer set as claimed in claim 1, and the product of the fluorescent PCR amplification is detected by electrophoresis; and the sex of Chinese soft-shell turtle is identified according to the electrophoresis bands.

8. A method for identifying the developmental maturity of oocytes of Chinese soft-shell turtles, comprising the step of performing fluorescent in situ hybridization on paraffin sections containing oocytes using a sense probe and / or an antisense probe, wherein the sense probe is: UUUAGGUGACACUAUAGAAUACU ACGGGAGTGAUACCGAAAG; the underlined part indicates the digoxigenin signal marker and the Sp6 linker; The antisense probe is: Antisense probes: UAAUACGACUCACUAUAGGGCGA AGCAAGAGCAGGCAUAGC; the underline indicates the digoxigenin signal tag and T7 linker.

9. Methods for improving the sensitivity of sex identification of Chinese soft-shelled turtles include: After injecting 50μg / μL 17α-methyltestosterone and 50μg / μL 17β-estradiol into Chinese soft-shell turtles (10mg / kg), DNA from their gonadal tissues was obtained. The primer set according to claim 1 is used for PCR amplification, and the sex of the Chinese soft-shelled turtle is identified according to the PCR amplification result.

10. Use of the primer set of claim 1 or the kit of claims 2 to 4, wherein the use is selected from at least one of identifying the sex of Chinese soft-shelled turtle, identifying the developmental maturity of oocytes for the sex of Chinese soft-shelled turtle, and improving the sensitivity of sex identification of Chinese soft-shelled turtle.

Images