MicroRNA fluorescent biosensor for quantitatively detecting colorectal cancer as well as preparation method and application of microRNA fluorescent biosensor

Abstract

The invention provides a microRNA fluorescent biosensor for quantitative detection of colorectal cancer. The microRNA fluorescent biosensor comprises a microRNA padlock probe for colorectal cancer, diethyl pyrocarbonate treatment water, T4DNA ligase, T7RNA polymerase, an rNTPs mixture, DNA endonuclease, a signal probe, a biological buffer solution and a Simply P total RNA extraction kit. According to the invention, simultaneous detection of a plurality of miRNAs (miR-21, miR-17, miR-31 and miR-92a) related to colorectal cancer can be realized; the adopted fluorescent probe has universal capability and can be applied to other gene detection by changing a target object recognition domain; a promoter is not needed to start transcription, so that the experimental design and operation are simplified.

Description

Technical Field

[0001] The present invention belongs to the technical field of biosensors, and specifically discloses a microRNA fluorescent biosensor for quantitatively detecting colorectal cancer. The present invention also discloses a preparation method of the fluorescent biosensor and a detection method of the fluorescent biosensor. Background Art

[0002] As a malignant tumor, colorectal cancer has a high morbidity and mortality rate. Colorectal cancer can spread to other tissues and organs through the lymphatic system, blood circulation or direct transmission, and is more common in middle-aged men. In general, in clinical practice, the duration of asymptomatic colorectal cancer is unknown, and the number of patients who are asymptomatic at admission and diagnosed with colorectal cancer after admission has steadily increased. At present, colorectal cancer can be diagnosed by clinical manifestations, rectal examination or sigmoidoscopy. Although invasive colonoscopy is relatively convenient for detecting advanced lesions, colorectal cancer may present very subtle mucosal lesions in the early stage, and only have obvious symptoms in the late stage. Diagnosis after the onset of clinical symptoms is often of little significance. Early diagnosis and timely surgical intervention are crucial for the treatment and prognosis of colorectal cancer. In recent years, biomarkers including proteins and genes have received increasing attention in cancer diagnosis. It is currently believed that carcinoembryonic antigen is related to malignant tumors, but it is not specific to colorectal cancer, has low sensitivity, and is not suitable for large-scale early screening. In addition, colorectal cancer has a variety of clinical courses and manifestations during the development of the disease, with different pathological types and molecular subtypes, and different lesions in the same individual at different stages have obvious heterogeneity. Therefore, finding a timely, convenient and accurate method for diagnosing colorectal cancer in early screening is crucial for clinical practice and personalized medicine.

[0003] Tumorigenesis is a multi-step, multi-stage, and multi-gene process. Studies have confirmed that both oncogenes and tumor suppressor genes are regulated by microRNA (miRNA) during tumor formation. miRNA is a short RNA sequence of 19-24 nucleotides in length that pairs with specific bases of target messenger RNA, either preventing translation or destroying it, thereby regulating the post-transcriptional expression of genes. In a series of important biological activities such as cell differentiation, cell cycle regulation, and fertility, miRNA plays an important role in regulating gene expression. The study of miRNA has revolutionized the diagnosis, prognosis analysis, clinical pathological analysis, and treatment sensitivity assessment of colorectal cancer. However, due to the short length and high homology of miRNA, sensitive detection and differentiation of miRNA remains extremely challenging. To date, microarray, northern blotting, reverse transcription polymerase chain reaction, and next-generation sequencing are the most widely used miRNA detection methods. However, the above technologies cannot meet the needs of rapid, economical, and accurate detection of low-concentration miRNA. In order to improve the analytical performance, various signal amplification technologies, such as polymerase chain reaction, and emerging multiple isothermal methods, including recombinase polymerase amplification, loop-mediated isothermal amplification, hybridization chain reaction, and rolling circle transcription (RCT), are often coupled for the analysis of various nucleic acids. RCT is widely used because of its superior signal amplification ability and the advantage of not requiring promoter drive. In addition, a technology that converts nucleic acid signals into detectable signals is also needed.

[0004] At the same time, existing miRNA detection probes have the following disadvantages: single-target detection probes are not specific and are prone to false positive and false negative results; they are not sensitive enough to identify low-concentration targets in the early stages of the disease. Summary of the invention

[0005] In view of the defects in the prior art, the present application provides a microRNA fluorescent biosensor for quantitative detection of colorectal cancer, including: a microRNA padlock probe for colorectal cancer, diethyl pyrocarbonate treated water, T4 DNA ligase, T7 RNA polymerase, rNTPs mixture, DNA endonuclease, signal probe, biological buffer, and Simply P total RNA extraction kit.

[0006] Preferably, the microRNA padlock probe for rectal cancer is divided into three functional domains;

[0007] The first functional domain is a complementary fragment of the target miRNA;

[0008] The second functional domain is the T7 promoter complementation domain;

[0009] The third functional domain is the scaffold generation area of ​​the complete crRNA. The first functional domain can modify the base sequence according to the target miRNA, and the base sequences of the second and third functional domains remain unchanged.

[0010] Preferably, the microRNA padlock probe for colorectal cancer is designed according to the target miR, including one of Padlock-17, Padlock-21, Padlock-31 or Padlock-92a; wherein the corresponding Padlock-17 padlock probe is designed according to the miR-17 sequence; the corresponding Padlock-21 padlock probe is designed according to the miR-21 sequence; the corresponding Padlock-31 padlock probe is designed according to the miR-31 sequence; and the corresponding Padlock-92a padlock probe is designed according to the miR-92a sequence.

[0011] Further preferably, Padlock-17 is as shown in SEQ No.1;

[0012] Padlock-21 is shown in SEQ No. 2;

[0013] Padlock-31 is shown in SEQ No. 3;

[0014] Padlock-92a is shown as SEQ No.4.

[0015] Preferably, the rNTPs mixture specifically comprises: rATP, rCTP, rGTP and rUTP;

[0016] The biological buffer comprises T4 DNA ligase buffer, RNAPol reaction buffer, and NEBuffer r2.1;

[0017] The DNA endonuclease is EnGen Lba Cas12a;

[0018] The signal probe is FAM-TTTATT-BHQ1;

[0019] The Simply P total RNA extraction kit comprises: lysis solution R1, lysis solution R2, washing solution, eluent, and purification column.

[0020] The present invention also provides a method for preparing a microRNA fluorescent biosensor for quantitatively detecting colorectal cancer, comprising the following steps:

[0021] Step S1: Extract miRNA from cell samples using Simply P total RNA extraction kit;

[0022] Step S2: incubating the miRNA obtained in step S1 with a universal programmable padlock probe, T4 DNA ligase, and T4 DNA ligase buffer;

[0023] Step S3: Add T7 RNA polymerase, RNAPol reaction buffer and rNTP to the incubation in step S2 for co-incubation;

[0024] Step S4: adding DNA endonuclease, NEBuffer r2.1 and signal probe to the incubation in step S3 for co-incubation;

[0025] Step S5: The fluorescence instrument is set to have an excitation wavelength of 488 nm, an emission wavelength of 520 nm, and a detection range of 505 nm-600 nm.

[0026] Preferably, the co-incubation condition in step S4 is 37°C.

[0027] Preferably, the fluorescence instrument is set to have an excitation wavelength of 488 nm, an emission wavelength of 520 nm, a detection range of 505 nm-600 nm, and reads changes in the fluorescence signal to detect the target.

[0028] The beneficial effects of the present invention are:

[0029] 1. It can realize the simultaneous detection of multiple colorectal cancer-related miRNAs (miR-21, miR-17, miR-31 and miR-92a);

[0030] 2. Fluorescent probes have universal capabilities and can be applied to other gene detection by changing the target recognition domain;

[0031] 3. Combining rolling circle transcription and CRISPR / Cas12a dual signal amplification technology can significantly reduce background signals and improve detection sensitivity.

[0032] 4. No promoter is required to initiate transcription, which simplifies experimental design and operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the concentration optimization diagram of T4 ligase response to the target.

[0034] Figure 2 This is the concentration optimization diagram of T7 polymerase response to the target.

[0035] Figure 3 Concentration optimization diagram for EnGen Lba Cas12a response to target

[0036] Figure 4 This is a time optimization diagram for T4 ligase response to the target.

[0037] Figure 5 This is a time optimization diagram for T7 polymerase response to the target.

[0038] Figure 6 This is a time optimization diagram for EnGen Lba Cas12a's response to the target.

[0039] Figure 7 This is a concentration optimization diagram of the target miRNA-21 in the EnGen Lba Cas12a reaction system.

[0040] Figure 8 This is the concentration optimization diagram of the target miRNA-17 in the EnGen Lba Cas12a reaction system.

[0041] Fig. 9 This is a concentration optimization diagram of the target miRNA-31 in the EnGen Lba Cas12a reaction system.

[0042] Fig.10 This is a concentration optimization diagram of the target miRNA-92a in the EnGen Lba Cas12a reaction system.

[0043] Fig.11 Quantitative detection of different miRNAs in NCM460 and HT29 cells in the EnGen Lba Cas12a reaction system. DETAILED DESCRIPTION

[0044] Clustered regularly interspaced short palindromic repeats (CRISPR) provide a new approach for nucleic acid recognition and detection of signal transduction due to the specific enzymatic activity of its associated (Cas) proteins. There are many types of Cas proteins, among which Cas12a is an RNA-guided export protein that recognizes target DNA under the guidance of CRISPR RNA (crRNA) and indiscriminately cuts single-stranded DNA (ssDNA) at a high rate of thousands of times per second. In recent years, based on the specific recognition of the activation strand guided by crRNA and the efficient trans-cutting of fluorescein-labeled ssDNA signal probes, the CRISPR / Cas12a system has been widely explored for the construction of biosensors, greatly improving the sensitivity and specificity of traditional diagnostic techniques and showing excellent potential in molecular diagnosis. However, even in the absence of a target, the pre-assembled Cas12a / crRNA complexes used in most systems are often redundant and may lead to undesirable high background. Given the programmability of the crRNA sequence, with a fixed scaffold motif and a variable spacer motif, the CRISPR / Cas12a system can become a versatile detection tool by establishing different transcription initiation mechanisms and changing the crRNA spacer sequence. To the best of our knowledge, an RNA transcription-assisted CRISPR / Cas12a platform for multiplexed profiling of colorectal cancer-associated miRNAs with arbitrary programmability has not been reported before.

[0045] Embodiment 1

[0046] This embodiment provides a method for preparing a fluorescent probe for quantitatively detecting colorectal cancer-related microRNA, comprising the following steps:

[0047] 1. Design the corresponding padlock probe according to the target miRNA sequence, where:

[0048] The corresponding padlock probe designed according to miR-21 is Padlock-21, and the sequence of Padlock-21 is SEQ No. 2, specifically: 5'P-CTGATAAGCTACCCTATAGTGAGTCGTATTAATCTACACTTAGTAGAAATTATTCAACATCAGT-3';

[0049] The corresponding padlock probe designed according to miR-17 is Padlock-17, and the sequence of Padlock-17 is SEQ No. 1, specifically: 5'P-TAAGCACTTTGCCCTATAGTGAGTCGTATTAATCTACACTTAGTAGAAATTATCTACCTGCACTG-3';

[0050] The corresponding padlock probe designed according to miR-31 is Padlock-31, and the sequence of Padlock-31 is SEQ No. 3, specifically: 5'P-CATCTTGCCTCCCTATAGTGAGTCGTATTAATCTACACTTAGTAGAAATTATAGCTATGCCAG-3';

[0051] The corresponding padlock probe designed according to miR-92a is Padlock-92a, and the sequence of Padlock-92a is SEQ No. 4, specifically: 5'P-CAAGTGCAATACCCTATAGTGAGTCGTATTAATCTACACTTAGTAGAAATTATACAGGCCGGGA-3'.

[0052] It should be noted that the universal template sequence of the padlock probe is 5'P-XXXXXXXXXXXCCC TATAGTGAGTCGTATTAATCTACACTTAGTAGAAATTATXXXXXXXXXXX-3', where X (first functional domain) represents any base in ATCG, which is randomly arranged. The padlock probe template technology used in this embodiment is different from the existing padlock probe sequence. The existing sequence has been modified and simplified, and can be designed accordingly as needed.

[0053] 2. Based on the designed padlock probe, obtain the corresponding fluorescent biosensor.

[0054] 3. Extract miRNA from cell samples using Simply P total RNA extraction kit.

[0055] 4. Incubate the miRNA obtained in the previous step with the padlock probe, T4 DNA ligase, and T4 DNA ligase buffer;

[0056] 5. Add T7 RNA polymerase, RNAPol reaction buffer and rNTP to the incubation in the previous step and incubate together;

[0057] 6. Add DNA endonuclease, NEBuffer r2.1 and signal probe to the cells for co-incubation based on the incubation in the previous step;

[0058] 7. The fluorescence instrument is set to have an excitation wavelength of 488 nm, an emission wavelength of 520 nm, and a detection range of 505 nm-600 nm.

[0059] In this embodiment, the composition of T4 DNA ligase buffer is 50mM Tris-HCl, 10mM MgCl2, 10mM DTT, and 1mM ATP; the composition of RNAPol reaction buffer is 40mM Tris-HCl, 6mM MgCl2, 2mM spermidine, and 1mM DTT; the composition of NEBuffer r2.1 is 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, and 100μg / ml recombinant albumin; the signal probe is FAM-TTTATT-BHQ1; all the above materials are purchased from New England Biolabs (NEB).

[0060] Simply P total RNA extraction kit was purchased from Bioflux, USA.

[0061] Embodiment 2

[0062] This example uses miRNA-21 and Padlock-21 as examples to investigate the effect of T4 ligase concentration on the response of target miR-21. The steps are as follows:

[0063] miR-21 and Padlock-21 were incubated with different concentrations of T4 DNA ligase (0-800U / mL) and T4 DNA ligase buffer, and then incubated with T7 RNA polymerase, RNAPol reaction buffer, and rNTP. EnGen LbaCas12a, NEBuffer r2.1, and signal probe were added and incubated at 37°C, and the fluorescence intensity at 520nm was measured. Figure 1 shown.

[0064] pass Figure 1 It can be seen that with the increase of T4 ligase concentration, the fluorescence intensity first increases and then maintains, and the signal-to-noise ratio (S / N) first increases and then decreases.

[0065] Embodiment 3

[0066] This example uses miRNA-21 and Padlock-21 as examples to investigate the effect of T7 RNA polymerase concentration on the response of target miR-21. The steps are as follows:

[0067] miR-21 was incubated with Padlock-21, T4 DNA ligase and T4 DNA ligase buffer, and different concentrations of T7 RNA polymerase (0-400U / mL), RNAPol reaction buffer, and rNTP were added for co-incubation. EnGen Lba Cas12a, NEBuffer r2.1, and signal probe were added for co-incubation at 37°C, and the fluorescence intensity at 520nm was measured. The results are shown in Figure 2shown.

[0068] pass Figure 2 It can be seen that with the increase of T7 polymerase concentration, the fluorescence intensity first increases and then maintains, and the signal-to-noise ratio (S / N) first increases and then decreases.

[0069] Embodiment 4

[0070] This example takes miRNA-21 and Padlock-21 as examples to investigate the effect of Cas12a concentration on the response of target miR-21. The steps are as follows:

[0071] miR-21 was incubated with Padlock-21, T4 DNA ligase and T4 DNA ligase buffer, and then T7 RNA polymerase, RNAPol reaction buffer and rNTP were added for co-incubation. Different concentrations of EnGen Lba Cas12a (0-150nM), NEBuffer r2.1 and signal probe were added for co-incubation at 37°C, and the fluorescence intensity at 520nm was measured. Figure 3 shown.

[0072] pass Figure 3 It can be seen that with the increase in the concentration of EnGen Lba Cas12a, the fluorescence intensity first increases and then maintains.

[0073] Embodiment 5

[0074] This example uses miRNA-21 and Padlock-21 as examples to investigate the effect of T4 ligase reaction time on the response of target miR-21. The steps are as follows:

[0075] After incubating miR-21 with Padlock-21, T4 DNA ligase and T4 DNA ligase buffer for 0-120 min, T7 RNA polymerase, RNAPol reaction buffer and rNTP were added for co-incubation, and EnGen Lba Cas12a, NEBufferr2.1 and signal probe were added for co-incubation at 37°C, and the fluorescence intensity at 520 nm was measured. Figure 4 shown.

[0076] pass Figure 4 It can be seen that as the reaction time increases, the fluorescence intensity first increases and then remains constant.

[0077] Embodiment 6

[0078] This example uses miRNA-21 and Padlock-21 as examples to investigate the effect of T7 RNA polymerase reaction time on the response of target miR-21. The steps are as follows:

[0079] miR-21 was incubated with Padlock-21, T4 DNA ligase and T4 DNA ligase buffer, T7 RNA polymerase, RNAPol reaction buffer and rNTP were added for 0-180 min, and then EnGen Lba Cas12a, NEBufferr2.1 and signal probe were added for incubation at 37°C, and the fluorescence intensity at 520 nm was measured. Figure 5 shown.

[0080] pass Figure 5 It can be seen that as the reaction time increases, the fluorescence intensity first increases and then remains constant.

[0081] Embodiment 7

[0082] This example takes miRNA-21 and Padlock-21 as examples to investigate the effect of the reaction time of EnGen Lba Cas12a on the response of target miR-21. The steps are as follows:

[0083] miR-21 was incubated with Padlock-21, T4 DNA ligase and T4 DNA ligase buffer, and then T7 RNA polymerase, RNAPol reaction buffer and rNTP were added for co-incubation. EnGen Lba Cas12a, NEBuffer r2.1 and signal probe were added for co-incubation at 37°C for 0-100 min, and the fluorescence intensity at 520 nm was measured. Figure 6 shown.

[0084] pass Figure 6 It can be seen that as the reaction time increases, the fluorescence intensity first increases and then remains constant.

[0085] Embodiment 8

[0086] The quantitative detection of four colorectal cancer-related microRNAs is as follows:

[0087] miR-21 was incubated with Padlock-21 (miR-17 with Padlock-17, or miR-31 with Padlock-31, or miR-92a with Padlock-92a), T4 DNA ligase and T4 DNA ligase buffer, T7 RNA polymerase, RNAPol reaction buffer, rNTP were added, EnGen Lba Cas12a, NEBuffer r2.1, and signal probe were added and incubated at 37°C, and the fluorescence intensity at 520nm was measured. The results are shown in Figure 7 , Figure 8 , Fig. 9 , Fig.10 shown.

[0088] pass Figure 7 As can be seen from A, the fluorescence intensity of FAM gradually increases with the increase of miR-21 concentration; Figure 7 B shows that in the range of 0.005-0.5 nM, the fluorescence signal is linearly related to the concentration of miR-21. The correlation equation is F = 5276.4c miR-21 -98.037, correlation coefficient is 0.9891. According to the 3σ standard deviation of blank response, the detection limit is 2.1pM.

[0089] pass Figure 8 As can be seen from A, the fluorescence intensity of FAM gradually increases with the increase of miR-17 concentration. Figure 8 B shows that in the range of miR-170.005 to 0.5 nM, the fluorescence signal increases proportionally, and the corresponding regression equation is F = 5581.8c miR-17 +2.534(R 2 =0.9804), LOD was 1.6pM.

[0090] pass Fig. 9 As can be seen from A, the fluorescence intensity of FAM gradually increases with the increase of miR-31 concentration. Fig. 9 As can be seen from B, the linear relationship between the fluorescence intensity and the miR-31 concentration in the range of 0.005 to 0.5 nM was shown to be F = 5644.8c miR-31 -70.642(R 2 =0.9782), LOD is 1.0 pM.

[0091] pass Fig.10 As can be seen from A, the fluorescence intensity of FAM gradually increases with the increase of miR-92a concentration. Fig.10 B shows that the regression equation corresponding to miR-92a is F = 4657.4c miR-92a -58.919(R 2 =0.9869), LOD was 3.7pM.

[0092] Embodiment 9

[0093] In this example, the quantitative detection of four colorectal cancer-related microRNAs in actual cell samples is performed in the following steps:

[0094] The miRNAs in NCM460 and HT29 cell samples were extracted and incubated with the corresponding padlock probes (Padlock-21, Padlock-17, Padlock-31, Padlock-92a), T4 DNA ligase and T4 DNA ligase buffer, T7 RNA polymerase, RNAPol reaction buffer, rNTP were added, EnGen Lba Cas12a, NEBuffer r2.1, and signal probe were added and incubated at 37°C, and the fluorescence intensity at 520nm was measured. The results are shown in Fig.11 shown.

[0095] pass Fig.11 It can be seen that the fluorescence signal intensity in the colorectal tumor cell line HT29 is significantly higher than that in the normal colorectal epithelial cell NCM460.

[0096] This paper combines rolling circle transcription and CRISPR / Cas12a dual signal amplification technology to construct a universal fluorescent probe for quantitative detection of the concentration of four colorectal cancer-related microRNAs. Compared with traditional detection methods, it not only has the advantages of high sensitivity, good selectivity, and simple detection, but also can reduce the occurrence of false positives and false negatives in actual detection; at the same time, the universal template can be extended to the quantitative detection of other gene sequences.

Claims

1. A microRNA fluorescent biosensor for quantitative detection of colorectal cancer, characterized in that: include: microRNA padlock probe for colorectal cancer, diethyl pyrocarbonate treated water, T4 DNA ligase, T7 RNA polymerase, rNTPs mix, DNA endonuclease, signal probe, biological buffer, Simply P total RNA extraction kit.

2. The microRNA fluorescent biosensor for quantitative detection of colorectal cancer according to claim 1, characterized in that: The microRNA padlock probe for colorectal cancer is divided into three functional domains; The first functional domain is a complementary fragment of the target miRNA; The second functional domain is the T7 promoter complementation domain; The third functional domain is the scaffold generation region of the complete crRNA.

3. The microRNA fluorescent biosensor for quantitative detection of colorectal cancer according to claim 1, characterized in that: The microRNA padlock probe for colorectal cancer is designed according to the target miR, and includes one of Padlock-17, Padlock-21, Padlock-31 or Padlock-92a; Among them, the corresponding Padlock-17 padlock probe was designed according to the miR-17 sequence; the corresponding Padlock-21 padlock probe was designed according to the miR-21 sequence; the corresponding Padlock-31 padlock probe was designed according to the miR-31 sequence; and the corresponding Padlock-92a padlock probe was designed according to the miR-92a sequence.

4. The microRNA fluorescent biosensor for quantitative detection of colorectal cancer according to claim 3, characterized in that: Padlock-17 is shown in SEQ No. 1; Padlock-21 is shown in SEQ No. 2; Padlock-31 is shown in SEQ No. 3; Padlock-92a is shown as SEQ No.

4.

5. The microRNA fluorescent biosensor for quantitative detection of colorectal cancer according to claim 1, characterized in that: The rNTPs mixture specifically includes: rATP, rCTP, rGTP and rUTP; The biological buffer comprises T4 DNA ligase buffer, RNAPol reaction buffer, and NEBuffer r2.1; The DNA endonuclease is EnGen Lba Cas12a; The signal probe is FAM-TTTATT-BHQ1; The Simply P total RNA extraction kit comprises: lysis solution R1, lysis solution R2, washing solution, eluent, and purification column.

6. The method for preparing a microRNA fluorescent biosensor for quantitatively detecting colorectal cancer according to any one of claims 1 to 5, characterized in that: The following steps are involved: Step S1: Extract miRNA from cell samples using Simply P total RNA extraction kit; Step S2: incubating the miRNA obtained in step S1 with a universal programmable padlock probe, T4 DNA ligase, and T4 DNA ligase buffer; Step S3: Add T7 RNA polymerase, RNAPol reaction buffer and rNTP to the incubation in step S2 for co-incubation; Step S4: adding DNA endonuclease, NEBuffer r2.1 and signal probe to the incubation in step S3 for co-incubation; Step S5: The fluorescence instrument is set to have an excitation wavelength of 488 nm, an emission wavelength of 520 nm, and a detection range of 505 nm-600 nm.

7. The preparation method according to claim 6, characterized in that: The co-incubation condition in step S4 is 37°C.

8. A detection method for the fluorescent biosensor prepared by the preparation method of claim 6, characterized in that: include: The fluorescence instrument excitation wavelength is set to 488nm, the emission wavelength is set to 520nm, the detection range is 505nm-600nm, and the fluorescence signal changes are read to detect the target.

Images