A SNP molecular marker related to the growth traits of hybrid tiger and its application

Abstract

The present invention provides a SNP molecular marker and application related to the growth traits of the hybrid spot of cedar and tiger, and relates to the technical field of SNP molecular markers. The SNP molecular markers described in the present invention include any one of SNP1, SNP2 and SNP3, wherein the SNP1 is located at the 169th position of the sequence shown in SEQ ID NO: 1, and its mutation type is T / C; SNP2 is located at the 226th position of the sequence shown in SEQ ID NO: 1, and its mutation type is C / A; the SNP3 is located at the 177th position of the sequence shown in SEQ ID NO: 2, and its mutation type is A / G. The SNPs sites screened by the present invention are all significantly correlated with the growth traits of the hybrid spot of cedar and tiger, providing molecular markers for the breeding of excellent individuals of the hybrid spot of cedar and tiger.

Description

Technical Field

[0001] The invention belongs to the technical field of SNP molecular markers, and specifically relates to a SNP molecular marker related to the growth traits of a hybrid tiger and its application. Background Art

[0002] Both brown-spotted grouper and clearwater grouper belong to the family Serranidae and the genus Epinephelus. Brown-spotted grouper mainly lives in the Indian Ocean to the Pacific Ocean, while clearwater grouper lives in the Red Sea, the east coast of Africa, southern Japan and other waters. The hybrid of female brown-spotted grouper and male clearwater grouper yields the hybrid grouper of tiger and cedar. The hybrid grouper of tiger and cedar shows growth advantages over its parents at three months old. It has delicate meat and strong disease resistance, and is highly accepted in the market. However, during the preparation of batch hybridization, it was found that there was a phenomenon of different individual growth rates.

[0003] Breeding based on phenotypic traits is slow and cannot meet the purpose of screening at an early stage. Molecular markers are often closely linked to target traits. They are widely available, reliable, and not easily affected by the environment, making molecular markers an important means of individual breeding. Myosin is an important component of muscle cells and plays an important role in the composition of muscle fibers and muscle growth. Myosin is composed of 2 myosin heavy chains (MYH) and 4 myosin light chains. The MYH gene is an important gene for growth regulation. There are very few studies on molecular assisted breeding of grouper fish in combination with SNP sites of this gene. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a SNP molecular marker related to the growth traits of the hybrid spotted mullet. By detecting the genotype of the SNP molecular marker, the early growth individuals of the hybrid spotted mullet can be identified, and then the individuals with growth potential can be selected for breeding, which can shorten the breeding costs and increase the breeding income.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a SNP molecular marker related to the growth traits of cedar tiger hybrid spot, wherein the SNP molecular marker comprises any one of SNP1, SNP2 and SNP3; the SNP1 is located at the 169th position of the sequence shown in SEQ ID NO: 1, and its mutation type is T / C; the SNP2 is located at the 226th position of the sequence shown in SEQ ID NO: 1, and its mutation type is C / A; the SNP3 is located at the 177th position of the sequence shown in SEQ ID NO: 2, and its mutation type is A / G.

[0007] The present invention also provides a primer set for detecting the SNP molecular marker, the primer set comprising a forward primer and a reverse primer for detecting SNP1, a forward primer and a reverse primer for detecting SNP2, and a pair or several pairs of forward primers and reverse primers for detecting SNP3; wherein the nucleotide sequence of the forward primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 3; the nucleotide sequence of the reverse primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer for detecting SNP3 is shown in SEQ ID NO: 5; and the nucleotide sequence of the reverse primer for detecting SNP3 is shown in SEQ ID NO: 6.

[0008] The present invention also provides a kit for detecting the SNP molecular marker, and the kit comprises the primer set.

[0009] The present invention also provides an application of the SNP molecular marker, the primer set or the kit in breeding of hybrid spotted pine and tiger.

[0010] The present invention also provides a method for screening a hybrid spot of cedar and tiger with growth trait advantages, comprising the following steps: (1) extracting genomic DNA of the cedar and tiger hybrid spot to be tested; (2) using the primer set to perform PCR amplification on the genomic DNA of the cedar and tiger hybrid spot to be tested to obtain a PCR amplification product; (3) sequencing and analyzing the PCR amplification product to determine the genotype of the SNP molecular marker of the individual cedar and tiger hybrid spot to be tested, and screening the cedar and tiger hybrid spot with growth trait advantages.

[0011] Preferably, the growth trait is one or more of body weight, total length, body length, head length, body height and caudal peduncle height.

[0012] Preferably, when the SNP molecular marker is SNP1, the weight, total length, body length, head length, body height and caudal peduncle height of the TT genotype are better than those of the CC and CT genotypes; when the SNP molecular marker is SNP2, the weight, total length, body length, head length, body height and caudal peduncle height of the CC genotype are better than those of the AA and AC genotypes; when the SNP molecular marker is SNP3, the weight, total length, body length, head length, body height and caudal peduncle height of the AA genotype are better than those of the AG and GG genotypes.

[0013] Preferably, the PCR amplification program is 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55-60°C annealing for 30 s, 72°C extension for 30 s, for a total of 32 cycles.

[0014] The present invention also provides an application of a reagent for detecting the SNP molecular marker in breeding of fir tiger stripes, wherein the application is a method for screening dominant traits of body weight, total length, body length, head length, body height or tail peduncle height.

[0015] Preferably, the reagent is a primer set, which includes a forward primer and a reverse primer for detecting SNP1, a forward primer and a reverse primer for detecting SNP2, and a pair or several pairs of forward primers and reverse primers for detecting SNP3; wherein the nucleotide sequence of the forward primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 3; the nucleotide sequence of the reverse primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer for detecting SNP3 is shown in SEQ ID NO: 5; and the nucleotide sequence of the reverse primer for detecting SNP3 is shown in SEQ ID NO: 6.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) The present invention provides a SNP molecular marker associated with the growth traits of the hybrid tiger spot. The present invention uses the SNP loci on the MYH gene that are significantly associated with the growth traits of the hybrid tiger spot to develop molecular markers and realize molecular assisted breeding. The present invention uses the growth-related SNP loci to identify the early growth individuals of the hybrid tiger spot, and then selects individuals with growth potential for breeding, which can reduce breeding costs and increase breeding benefits.

[0018] The present invention also provides SNP molecular marker primers capable of rapidly screening individuals of hybrid spotted cedar tiger with growth advantages. The primers can be used to achieve rapid identification, and the operation is simple and convenient. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figures are the sequencing peak graphs of CC, CT and TT genotypes at the SNP1 molecular marker site, in which A is the sequencing peak graph of CC genotype, B is the sequencing peak graph of CT genotype, and C is the sequencing peak graph of TT genotype;

[0020] Figure 2 The figures are the sequencing peak graphs of AA, AC and CC genotypes at the SNP2 molecular marker site, where A is the sequencing peak graph of the AA genotype, B is the sequencing peak graph of the AC genotype, and C is the sequencing peak graph of the CC genotype;

[0021] Figure 3 These are the sequencing peak graphs of AA, AG and GG genotypes at the SNP3 molecular marker site. In the figure, A is the sequencing peak graph of the AA genotype, B is the sequencing peak graph of the AG genotype, and C is the sequencing peak graph of the GG genotype. DETAILED DESCRIPTION

[0022] The present invention provides a SNP molecular marker related to the growth traits of cedar tiger hybrid spot, wherein the SNP molecular marker comprises any one of SNP1, SNP2 and SNP3; the SNP1 is located at the 169th position of the sequence shown in SEQ ID NO: 1, and its mutation type is T / C; the SNP2 is located at the 226th position of the sequence shown in SEQ ID NO: 1, and its mutation type is C / A; the SNP3 is located at the 177th position of the sequence shown in SEQ ID NO: 2, and its mutation type is A / G.

[0023] In the present invention, the SEQ ID The nucleotide sequence of NO:1 is as follows: ACTTTCATAGATTTTGGGATGGACTTGCAGGCCTGCATTGACCTGATTGAAAAGGTGAGATACTGGACTATTACATGTCCAGACAAACATAAAGATTGACTGAAATATTGTGACTGTTTTCTTCCACTCATATTTTTGTCCCCTCACCCCATGGGTATCATGTCCATTCTTGAAGAGGAGTGCATGTTCCCCAAAG CTTCTGATAACCACCTTTAAAGCTAAGCTCTATGACAACCATCTGGGGAAATCTGCCAATTTCCAGAAGCCCAGAATTGTCAAAGGGAAACCAGAGGCCCATTTTGCCCTGATCCACTATGCTGGAATTGTTGATTATAACATCAACAACTGGCTGGTGAAGAACAAAGATCCTCTGAATGAGACCGTTGTTGCGCTCTACCAGAAGTCTA. In the present invention, the nucleotide sequence of SEQ ID NO: 2 is as follows: ATAAAATATTCTGTCCCTCCAAGATGGAACTGGGAGTTCAATGTAGTGAATAAATGTCTGGATATGTCTAATGCTGACAATTAGTTAACAGTGCTTGTGAACAATGATGTATTTCTTTTGAAGACTATCTTAGAGAAGACCTGCAGAACTTTGGAGGATCAAATGAATGAATACAGGAACAGGTGTGATGAAAATCAGAGATCCCTTCATGACTTCACCACCCAGAAAGCCAAGCTTCAAGCTGAGAATGGTCAGCATTACTCTTTTCACTTGAATAATAAAATTGTTTGATGCAGAACACTGCAACTCTTAAAACTAAATGCTGCCCATCTAGATGAACTTTCAAGACA. The present invention studies the SNP sites of the MYH gene in the hybrid spot of cedar and tiger, and performs association analysis on these sites with growth phenotypic traits, so as to obtain the molecular markers related to growth in the present invention, and provide technical means for breeding hybrid spot individuals of cedar and tiger with growth advantages.The present invention selects a population of hybrid spotted cedar tigers living in the same environment and the same growth period, measures and counts their weight and phenotypic traits, designs amplification primers based on the MYH gene sequence, and then amplifies in 60 hybrid spotted cedar tigers to obtain the full-length sequence; multiple comparison analysis is performed on the full-length sequence to screen and obtain the SNP molecular marker of the present invention. The present invention uses bioinformatics analysis software, preferably Popgene32, PLINK software, etc. to calculate the genetic information of the SNP site, and conducts association analysis between the site and the phenotypic trait.

[0024] The present invention also provides a primer set for detecting the SNP molecular marker, the primer set comprising a forward primer and a reverse primer for detecting SNP1, a forward primer and a reverse primer for detecting SNP2, and a pair or several pairs of forward primers and reverse primers for detecting SNP3; wherein the nucleotide sequence of the forward primer for detecting SNP1 and SNP2 is ACTTTCATAGATTTTGGGAT (SEQ ID NO: 3); the nucleotide sequence of the reverse primer for detecting SNP1 and SNP2 is TAGACTTCTGGTAGAGCGCA (SEQ ID NO: 4); the nucleotide sequence of the forward primer for detecting SNP3 is ATAAAATATTCTGTCCCTCC (SEQ ID NO: 5); and the nucleotide sequence of the reverse primer for detecting SNP3 is TGTCTTGAAAGTTCATCTAG (SEQ ID NO: 6).

[0025] The present invention also provides a kit for detecting the SNP molecular marker, the kit comprising the primer set. In the present invention, the kit also includes but is not limited to 2×Taq plus Master Mix.

[0026] The present invention also provides an application of the SNP molecular marker, the primer set or the kit in breeding of hybrid spotted pine and tiger.

[0027] The present invention also provides a method for screening a hybrid spot of cedar and tiger with growth trait advantages, comprising the following steps: (1) extracting genomic DNA of the cedar and tiger hybrid spot to be tested; (2) using the primer set to perform PCR amplification on the genomic DNA of the cedar and tiger hybrid spot to be tested to obtain a PCR amplification product; (3) sequencing and analyzing the PCR amplification product to determine the genotype of the SNP molecular marker of the individual cedar and tiger hybrid spot to be tested, and screening the cedar and tiger hybrid spot with growth trait advantages. In the present invention, the genomic DNA extraction kit preferably uses the animal sample genomic DNA extraction kit of Sobolai.

[0028] In the present invention, the growth trait is one or more of body weight, total length, body length, head length, body height and caudal peduncle height.

[0029] In the present invention, when the SNP molecular marker is SNP1, the weight, total length, body length, head length, body height and caudal peduncle height of the TT genotype are better than those of the CC and CT genotypes; when the SNP molecular marker is SNP2, the weight, total length, body length, head length, body height and caudal peduncle height of the CC genotype are better than those of the AA and AC genotypes; when the SNP molecular marker is SNP3, the weight, total length, body length, head length, body height and caudal peduncle height of the AA genotype are better than those of the AG and GG genotypes.

[0030] In the present invention, the PCR amplification program is preferably 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55-60°C annealing for 30 s, 72°C extension for 30 s, for a total of 32 cycles.

[0031] In a specific embodiment of the present invention, the reaction system for PCR amplification is preferably: based on a total volume of 10 μL reaction system, it includes 5 μL 2×Taq plus Master Mix, 1 μL genomic DNA, 0.5 μL each of forward and reverse primers, and 3 μL water.

[0032] The present invention also provides an application of a reagent for detecting the SNP molecular marker in breeding of fir tiger stripes, wherein the application is a method for screening dominant traits of body weight, total length, body length, head length, body height or tail peduncle height.

[0033] In the present invention, the reagent is a primer set, which includes a forward primer and a reverse primer for detecting SNP1, a forward primer and a reverse primer for detecting SNP2, and a pair or several pairs of forward primers and reverse primers for detecting SNP3; wherein the nucleotide sequence of the forward primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 3; the nucleotide sequence of the reverse primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer for detecting SNP3 is shown in SEQ ID NO: 5; the nucleotide sequence of the reverse primer for detecting SNP3 is shown in SEQ ID NO: 6.

[0034] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0036] Example 1 Screening of SNP sites

[0037] 1. Amplification of MYH gene in hybrid spot of cedar tiger. The whole genome DNA of tail fin tissue of 60 hybrid spot of cedar tiger was extracted. The extraction kit used the animal sample genomic DNA extraction kit of Sobolai. Then, Primer 5.0 was used to design multiple pairs of primers at different positions of the gene to amplify the sequence fragment for the MYH gene sequence. The PCR system is as follows: 5μL 2×Taqplus Master Mix, 1μL genomic DNA, 0.5μL each of forward and reverse primers, 3μL water. The PCR amplification procedure is as follows: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s, 55~60℃ annealing for 30s, 72℃ extension for 30s, a total of 32 cycles.

[0038] 2. Detect the amplified product under 1% gel electrophoresis. Select the target fragment according to the amplified product band. Recover the target fragment using a gel recovery kit (Sangon Biotech (Shanghai) Co., Ltd.), then connect the recovered product to the pMD18-T vector (Takara Biotech Co., Ltd.), place the connection product at 4°C, and then transform the connection product into Escherichia coli DH5α. Spread the transformed Escherichia coli on a solid culture medium with ampicillin and culture it overnight at 37°C. Then select large, scattered positive monoclonal clones and inoculate them into liquid culture medium with ampicillin resistance for expansion culture. Finally, extract the plasmid from Escherichia coli, obtain plasmid DNA, and perform PCR amplification. Perform Sanger sequencing on individuals with a single amplified band that is consistent with the position of the target band (Sangon Biotech (Shanghai) Co., Ltd.).

[0039] 3. Compare and analyze the sequencing results to preliminarily determine the SNP sites. Then use the sequencing peak graph to re-verify these SNP sites. Figure 1 This is the sequencing peak diagram of CC, CT and TT genotypes at the SNP1 molecular marker site. Figure 2 This is the sequencing peak diagram of AA, AC and CC genotypes at the SNP2 molecular marker site. Figure 3 The figure shows the sequencing peaks of AA, AG and GG genotypes at the SNP3 molecular marker site. Subsequently, three SNPs sites related to growth traits, SNP1, SNP2 and SNP3, were found in the exon region of the MYH gene. Among them, SNP1 and SNP2 sites are located in exon 14 of the MYH gene, and SNP3 site is located in exon 25 of the MYH gene.

[0040] Among them, the amplification primer pairs for SNP1 and SNP2 sites are:

[0041] Forward primer: 5′-ACTTTCATAGATTTTGGGAT-3′ (SEQ ID NO: 3);

[0042] Reverse primer: 5′-TAGACTTCTGGTAGAGCGCA-3′ (SEQ ID NO: 4);

[0043] The amplified sequence is shown in SEQ ID NO:1.

[0044] The primer pair for amplification of SNP3 locus is:

[0045] forward primer, 5′-ATAAAATATTCTGTCCCTCC-3′ (SEQ ID NO: 5);

[0046] Reverse primer, 5'-TGTCTTGAAAGTTCATCTAG-3' (SEQ ID NO: 6).

[0047] The amplified sequence is shown in SEQ ID NO:2.

[0048] Example 2 Identification of Growth-related SNP Sites

[0049] Data were measured for the 60 hybrid tigers in Example 1, including weight, total length, body length, head length, body height and tail peduncle height. The weight was weighed with an electronic scale, and the remaining data were measured and read with a vernier caliper. The above measured data were statistically analyzed using SPSS 17.0 software.

[0050] Popgene32 and PLINK were used to analyze the genetic polymorphism of the three loci SNP1, SNP2 and SNP3 of the amplified sequences, and the results are shown in Table 1. The general linear model of PLINK was used to analyze the correlation between SNP loci and the weight, total length, body length, head length, body height and tail peduncle height of the hybrid tiger, and the results are shown in Tables 2-4.

[0051] Table 1 Genetic analysis of MYH gene SNPs

[0052]

[0053] Table 2 Correlation analysis between MYH gene SNP1 locus and growth traits (mean ± SD)

[0054]

[0055] Note: Different letters in the same row indicate significant differences ( p <0.05).

[0056] Table 3 Correlation analysis between MYH gene SNP2 locus and growth traits (mean ± SD)

[0057]

[0058] Note: Different letters in the same row indicate significant differences ( p <0.05).

[0059] Table 4 Correlation analysis between MYH gene SNP3 locus and growth traits (mean ± SD)

[0060]

[0061] Note: Different letters in the same row indicate significant differences ( p <0.05).

[0062] As shown in Tables 2 to 4, at the SNP1 site, the TT genotype individuals were significantly higher than the CC and CT type individuals in all growth traits of weight, total length, body length, head length, body height and tail peduncle height. At the SNP2 site, the CC genotype individuals were also significantly higher than the AA and AC type individuals in all growth traits of weight, total length, body length, head length, body height and tail peduncle height. At the SNP3 site, the AA genotype individuals showed advantages in all growth traits of weight, total length, body length, head length, body height and tail peduncle height. Therefore, the three SNPs sites significantly correlated with the growth traits of the hybrid spot of the cedar tiger obtained by the screening of the present invention provide molecular markers for the breeding of excellent growth individuals of the hybrid spot of the cedar tiger.

[0063] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a primer set for detecting SNP molecular markers related to the growth traits of cedar tiger hybrid spot in breeding of cedar tiger hybrid spot, characterized in that: The application is to screen hybrid cedar-tiger spots with growth trait advantages; the growth trait is one or more of weight, total length, body length, head length, body height and tail peduncle height; the primer set consists of one or more pairs of forward primers and reverse primers for detecting SNP1, forward primers and reverse primers for detecting SNP2, and forward primers and reverse primers for detecting SNP3; the SNP1 is located at the 169th position of the sequence shown in SEQ ID NO: 1, and its mutation type is T / C; the SNP2 is located at the 226th position of the sequence shown in SEQ ID NO: 1, and its mutation type is C / A; the SNP3 is located at the 177th position of the sequence shown in SEQ ID NO: 2, and its mutation type is A / G; when the SNP molecular marker is SNP1, cedar-tiger hybrid spot individuals with TT genotype are screened; when the SNP molecular marker is SNP2, cedar-tiger hybrid spot individuals with CC genotype are screened; when the SNP molecular marker is SNP3, cedar-tiger hybrid spot individuals with AA genotype are screened.

2. The use according to claim 1, characterized in that: In the primer set, the nucleotide sequence of the forward primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 3; the nucleotide sequence of the reverse primer for detecting SNP1 and SNP2 is shown in SEQ ID NO: 4; the nucleotide sequence of the forward primer for detecting SNP3 is shown in SEQ ID NO: 5; and the nucleotide sequence of the reverse primer for detecting SNP3 is shown in SEQ ID NO:

6.

3. A kit for detecting SNP molecular markers related to the growth traits of cedar-tiger hybrid spotted in breeding of cedar-tiger hybrid spotted, characterized in that: The kit comprises the primer set according to claim 1; the application is to screen hybrid spot of cedar-tiger with growth trait advantages; the growth trait is one or more of body weight, total length, body length, head length, body height and caudal peduncle height; when the SNP molecular marker is SNP1, the hybrid spot individuals of cedar-tiger with TT genotype are screened; when the SNP molecular marker is SNP2, the hybrid spot individuals of cedar-tiger with CC genotype are screened; when the SNP molecular marker is SNP3, the hybrid spot individuals of cedar-tiger with AA genotype are screened.

4. A method for screening hybrid cedar tiger spots with growth trait advantages, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of the tested cedar-tiger hybrid spot; (2) using the primer set described in claim 1 to perform PCR amplification on the genomic DNA of the tested cedar-tiger hybrid spot to obtain a PCR amplification product; (3) performing sequencing analysis on the PCR amplification product to determine the genotype of the individual SNP molecular markers of the tested cedar-tiger hybrid spot, and screening the cedar-tiger hybrid spot with growth trait advantages; the growth trait is one or more of body weight, total length, body length, head length, body height and caudal peduncle height; When the SNP molecular marker is SNP1, the TT genotype of the hybrid spotted individuals of the cedar-tiger is screened; when the SNP molecular marker is SNP2, the CC genotype of the hybrid spotted individuals of the cedar-tiger is screened; when the SNP molecular marker is SNP3, the AA genotype of the hybrid spotted individuals of the cedar-tiger is screened.

5. The method according to claim 4, characterized in that The PCR amplification procedure was 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 55-60°C annealing for 30 s, 72°C extension for 30 s, for a total of 32 cycles.

Images