Molecular marker located in chromosome 4 and related to drought resistance of medicago sativa and application of molecular marker

Abstract

The invention provides a molecular marker located in chromosome 4 and related to drought resistance of medicago sativa and application, and belongs to the technical field of biology. And the nucleotide sequence of the insertion or deletion fragment is shown as SEQ ID NO.3 in the sequence table. The nucleotide sequences of the primer pair used for amplifying the molecular marker are shown as SEQ ID NO.1-2. The molecular marker and the primer pair thereof can be used for identifying or assisting in identifying the drought resistance character of medicago sativa. Meanwhile, the invention also provides a method for rapidly identifying the drought resistance and drought resistance genotype of medicago sativa by using the molecular marker, and the method is simple, convenient and rapid, and accurate in identification result, and has good popularization and application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an InDel molecular marker related to drought resistance of alfalfa located on chromosome 4 and an application thereof. Technical Background

[0002] Molecular markers provide high accuracy through selection at the gene level, avoiding the influence of environmental factors on phenotypic evaluation. Molecular markers can speed up screening, significantly shorten the breeding cycle, and improve breeding efficiency. It can help discover and utilize genetic diversity and protect genetic resources. In addition, molecular markers have wide adaptability and are suitable for breeding improvement of a variety of crops, reducing the waste of breeding resources. By providing accurate genetic typing information, it supports more effective genome selection, further accelerates the development of superior varieties, makes breeding work more scientific and efficient, and promotes the sustainable development of agriculture.

[0003] Whole genome association analysis has attracted much attention in the field of breeding. By analyzing the association between a large number of genetic markers and target traits, key genes or loci related to the traits can be identified. The research and development and application of this technology has become one of the important hot spots and competitive fields in the current breeding field. Drought-resistant breeding of alfalfa (Medicago sativa L.) is crucial to improving crop drought tolerance, increasing yields, and reducing resource consumption. Against the background of climate change and increasing water scarcity, the development of drought-resistant varieties can improve the growth adaptability of crops under drought conditions, reduce disaster risks, maintain the stability of agricultural production, promote sustainable agricultural development, and increase economic benefits for farmers. It is of great significance to ensure food security and the continuous improvement of the ecological environment. The breeding of alfalfa started late, and there are very limited reports on the development and positioning of drought-resistant related markers combined with whole genome association analysis. Therefore, the development of molecular markers related to drought resistance in alfalfa is of great significance for the construction of assisted selection breeding systems, the improvement of germplasm resources, and the breeding of new varieties. Summary of the invention

[0004] One of the purposes of the present invention is to provide an InDel molecular marker related to drought resistance of alfalfa.

[0005] The second object of the present invention is to provide the application of the above-mentioned InDel molecular marker related to drought resistance of alfalfa.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The drought resistance-related InDel molecular marker disclosed in the invention is located on chromosome 4 of alfalfa, and the molecular marker is named Ms_Chr4_23084811.

[0008] A primer pair for amplifying the InDel molecular marker associated with drought resistance of alfalfa, the primer pair sequence corresponding to the molecular marker Ms_Chr4_23084811 is:

[0009] Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA (shown in SEQ ID NO. 1);

[0010] Ms_Chr4_23084811-R: GCGAAGCTTTATTAATGCTATAAACAC (shown in SEQ ID NO. 2).

[0011] The present invention also discloses the application of the molecular marker primer pair in drought-resistant assisted breeding of alfalfa. That is to say, the molecular marker of the present invention can be used in future molecular marker assisted breeding, by extracting DNA from leaves at the seedling stage, detecting whether the molecular marker of the present invention exists, and then identifying drought-resistant related traits of alfalfa varieties. The detection can use a PCR detection method, specifically the molecular marker primer pair, and the detection can also be performed by a sequencing method.

[0012] The present invention also discloses the application of the molecular marker in identifying the drought resistance of alfalfa, especially in screening and identifying the drought resistance of alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the above molecular marker Ms_Chr4_23084811 was used for PCR amplification. The reaction system of PCR amplification is shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 10 min; storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 3 μL and judge the drought resistance of alfalfa based on the results of the bands.

[0018] PCR amplification is performed using primer pairs Ms_Chr4_23084811-F and Ms_Chr4_23084811-R. If the PCR amplification product has only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa is a drought-sensitive type; if the PCR amplification product has only one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, or has both one characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, the alfalfa is a drought-resistant type.

[0019] In addition, the present invention also protects a kit for identifying the drought resistance of alfalfa, wherein the kit comprises primer pairs Ms_Chr4_23084811-F and Ms_Chr4_23084811-R. The other components of the kit are all conventional reagents. Specifically, 10×PCR Buffer, dNTP and Taq DNA polymerase are also included. The present invention has no special restrictions on the concentration of the primer pair, and the primer concentration well known in the art can be used. The present invention has no special restrictions on the sources of the 10×PCR Buffer, dNTP and Taq DNA polymerase, and ordinary PCR amplification reagents well known in the art can be used.

[0020] The kit of the present invention can be used to quickly identify the drought resistance of alfalfa, and can also quickly identify the drought resistance genotype of alfalfa. The specific method refers to the specific steps of identifying whether alfalfa has drought resistance, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous drought-sensitive genotype; if the PCR amplification product has both a characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 263 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous drought-resistant genotype.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of the present invention screened out a molecular marker Ms_Chr4_23084811 related to drought resistance of alfalfa, which is located on chromosome 4. The molecular marker Ms_Chr4_23084811 of the present invention can be used to quickly and accurately identify the drought resistance trait of alfalfa.

[0023] (2) Screening with markers linked to drought resistance traits is conducive to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0024] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification product and high specificity, and can be applied to alfalfa drought-resistant breeding practice and variety identification in a simple, rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The whole genome association analysis result of alfalfa drought tolerance is a Manhattan diagram obtained based on the EMMXA model analysis. The green dots indicate the InDel positions associated with the present invention.

[0026] Figure 2 The box plot is a distribution of drought resistance index corresponding to the genotype of the Ms_Chr4_23084811 locus of the alfalfa population in Example 1 of the present invention. 0 / 0 means that the genotype of the Ms_Chr4_23084811 locus is a homozygous drought-sensitive genotype, and 0 / 1 means that the Ms_Chr4_23084811 locus is a heterozygous drought-resistant genotype. The dots are extreme values ​​of the data, and **** represents P < 0.0001.

[0027] Figure 3 This is the result of partial sequence alignment between drought-tolerant varieties and drought-sensitive varieties in drought-tolerance-related regions.

[0028] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 23 alfalfa germplasm resources. The concentration of agarose gel is 2%. In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the specific experimental methods involved in the following examples are all conventional methods or implemented under the conditions recommended by the manufacturer's instructions unless otherwise specified.

[0030] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0031] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0032] Example 1 Development of molecular markers related to drought resistance in alfalfa

[0033] The present invention uses the alfalfa drought resistance index (DRI) to measure the drought resistance of alfalfa. The higher the value, the more drought-resistant the alfalfa is; the lower the value, the less drought-resistant the alfalfa is (drought-sensitive). After measuring the DRI of the alfalfa population, an InDel site was located in alfalfa through GWAS analysis ( Figure 1 Green site), named Ms_Chr4_23084811. This site is located at the 23084811 site on chromosome 4 of the alfalfa reference genome, where the first allele type is 0 / 0; its second allele type is 0 / 1. The distribution box plot of the drought resistance index corresponding to the genotype of the population Ms_Chr4_23084811 site ( Figure 2 ), indicating that the drought tolerance of the alfalfa strain with genotype 0 / 1 is significantly higher than that of the alfalfa with genotype 0 / 0. At the 23084811 site on chromosome 4 of alfalfa, the insertion / deletion fragment AATCTCTCTTGAGAAATTTGTTGGATTACACAATATG (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the drought resistance of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is drought-sensitive alfalfa; the alfalfa without the fragment shown in SEQ ID NO.3 is drought-resistant alfalfa.

[0034] According to the InDel variation and its upstream and downstream sequences, the following primers were designed using primer 5.0 software:

[0035] Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA (shown in SEQ ID NO. 1);

[0036] Ms_Chr4_23084811-R: GCGAAGCTTTATTAATGCTATAAACAC (shown in SEQ ID NO. 2).

[0037] Then, the primers were used to perform PCR amplification on the samples to be tested. The results showed that the PCR product of the homozygous drought-sensitive alfalfa sample had only a 300bp characteristic band, while the PCR product of the heterozygous drought-resistant alfalfa sample had both a 300bp characteristic band and a 263bp characteristic band.

[0038] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0039] 214 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0040] Table 2 Drought resistance of 2214 germplasm materials and the genotype corresponding to the Ms_Chr4_23084811 locus

[0041]

[0042]

[0043]

[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0045] The reaction system of PCR amplification is as follows: template DNA 10-100ng, 10μM forward primer 1μL, 10μM reverse primer 1μL, 2×Taq PCR Master Mix 10μL, deionized water to 20μL; the reaction program of PCR amplification is preferably: 94℃ pre-denaturation for 4min; 94℃ denaturation for 30s, 59℃ annealing for 30s, 72℃ extension for 20s, 35 cycles; 72℃ extension for 10min; 4℃ storage. 2% agarose gel electrophoresis separation, after spotting, electrophoresis at 140V DC voltage for 2h, and then read the PCR band type of each sample.

[0046] 2) judging the drought resistance of alfalfa according to the size of the PCR product: when the PCR product of the alfalfa to be identified lacks the fragment shown in SEQ ID NO.3, the alfalfa to be identified is a drought-resistant alfalfa;

[0047] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa;

[0048] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 300 bp (SEQ ID NO.4), then the alfalfa to be identified is drought-sensitive alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the PCR product of the alfalfa to be identified is two bands, namely a band with the fragment shown in SEQ ID NO.3 inserted and a band with the fragment shown in SEQ ID NO.3 deleted, and one band of the PCR product is 300 bp in length and the other is 263 bp (SEQ ID NO.5), then the alfalfa to be identified is a heterozygous drought-resistant alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Moreover, it can be seen from Table 2 that among the 214 alfalfa germplasms identified in this study, 163 alfalfa materials had a genotype of 0 / 0 and 51 alfalfa materials had a genotype of 0 / 1. After determination, the average drought resistance index of these 163 alfalfa materials under drought was 1.0723, which was drought-sensitive (drought-sensitive) alfalfa; 51 alfalfa materials had a genotype of 0 / 1, and the average drought resistance index of these 23 alfalfa materials was 1.6576, which was drought-resistant alfalfa, 0.5853 higher than the average value of 163 drought-sensitive types. Variance analysis showed that the drought resistance index of drought-sensitive and drought-resistant types was significantly different (P<0.0001). The PCR detection results of 19 randomly selected germplasms ('Suntory', 'CF040145', 'Apex', 'CF020824', 'Pioneer', 'Thunder', 'Longmu 806', 'Zhongmu No. 5', 'CF039769', 'Huaiyang No. 4', 'WL440HQ', 'CF039770', 'CF031930', 'CF050248', 'Ranger', 'CF039747', 'P610428008', 'Xinmu No. 2', 'CF050062') corresponded to the genotypes and the actual drought resistance index determination results. Therefore, the InDel molecular marker of the present invention can effectively identify the drought resistance of alfalfa and can be used for the prediction and screening of drought-resistant alfalfa varieties.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 4 and associated with drought resistance in alfalfa, the molecular marker being named Ms_Chr423084811, characterized in that: The primer pair sequence corresponding to the molecular marker Ms_Chr423084811 is: Ms_Chr4_23084811-F: CGATGTATTCACCACTGTTTAACATAA; Ms_Chr4_23084811-R:GCGAAGCTTTATTAATGCTATAAACAC.

2. The molecular marker according to claim 1, characterized in that The molecular marker is an InDel molecular marker.

3. Use of the molecular marker according to claim 1 in identifying or assisting in identifying the drought resistance trait of alfalfa.

4. The use according to claim 3, characterized in that: The method for identifying drought resistance traits of alfalfa comprises the following steps: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determination is made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are: PCR amplification was performed using primers Ms Chr423084811-F and Ms Chr423084811-R. If the PCR amplification product had only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, the alfalfa was a drought-sensitive type; if the PCR amplification product had only one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, or had both one characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 263 bp as shown in SEQ ID NO.5, the alfalfa was a drought-resistant type.

5. A kit for identifying drought resistance of alfalfa, characterized in that: Comprising the primer pair described in claim 1.

6. Use of the kit according to claim 5 in identifying drought-resistant genotypes of alfalfa.

7. The use according to claim 6, characterized in that: The method for identifying the drought-resistant genotype of alfalfa using the kit is as follows: (1) extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products are subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 300 bp as shown in SEQ ID NO.4, then the alfalfa is a homozygous drought-sensitive genotype; if the PCR amplification product has both a characteristic band with a length of 300 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 263 bp as shown in SEQ ID NO.5, then the alfalfa is a heterozygous drought-resistant genotype.

Images