A molecular marker for detecting cap color in self-pollinated populations of *Flammulina velutipes* and its application
By using KASP technology to detect the cap color of enoki mushrooms, the problem of difficult identification in existing technologies has been solved, enabling rapid and accurate identification of cap color and improving breeding efficiency.
Patent Information
- Application Number
- CN202411710030.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-27
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-11-27
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the cap color of enoki mushrooms, which affects breeding progress and variety selection efficiency.
Using competitive allele-specific polymerase chain reaction (KASP) technology, the SNP site (A/G or C/T) at the end of chromosome 11 of the reference genome PRJNA820294 of *Flammulina velutipes* cha01 was detected, and PCR amplification was performed using a specific primer set to achieve rapid identification of brown and yellow caps.
It enables rapid and accurate identification of the cap color of enoki mushrooms, improving breeding efficiency and the accuracy of variety selection, and shortening the breeding cycle.
Smart Images

Figure CN119193915B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of edible fungi technology, specifically to a molecular marker for detecting the cap color of self-pollinated populations of *Flammulina velutipes* and its application. Background Technology
[0002] Enoki mushrooms Flammulina filiformis Enoki mushrooms (Flammulina velutipes) are among the most common edible fungi, prized for their unique flavor and rich content of beneficial amino acids, vitamins, minerals, and unsaturated fatty acids. They possess medicinal properties such as boosting immunity, anti-inflammation, anti-oxidation, and regulating gut microbiota, making them highly popular among consumers. Currently, white enoki mushrooms are the most prevalent in the market, with yellow and brown varieties being less common. Compared to white enoki mushrooms, yellow enoki mushrooms have a richer flavor, tender texture, and crisp taste, and are gradually regaining market share. However, the tendency of yellow enoki mushrooms to brown after harvest is a major factor limiting their market expansion. Therefore, there is an urgent need to breed enoki mushroom varieties that are flavorful and resistant to browning. Developing a molecular marker technology that can rapidly and accurately identify cap color can accelerate breeding progress and provide technical support and theoretical basis for enoki mushroom variety selection.
[0003] Single nucleotide polymorphisms (SNPs) are DNA polymorphisms arising from changes in a single nucleotide in the DNA sequence of a genome. They allow for the observation of differences between DNA sequences from different individuals, or differences between alleles in a single individual of diploid or polyploid organisms. SNP molecular markers have advantages such as wide distribution, high polymorphism, and high genetic stability, and are widely used in genetic diversity analysis of germplasm resources, marking and mapping of target trait genes, identification of crop variety purity, and quality assessment. Kompetitive allele-specific polymerase chain reaction (KASP) is a novel SNP-based genotyping technique that can accurately genotype SNPs and insertion / deletion polymorphisms (Indels) at the genomic level. This technique uses allele-specific oligomeric extension and fluorescence resonance to genotype at specific sites, offering advantages such as low cost and high throughput.
[0004] Currently, there is limited research on KASP-SNP molecular markers for the cap color of Flammulina velutipes. There is an urgent need for a rapid detection technology for Flammulina velutipes breeding to improve the accuracy of cap color identification in brown-brown Flammulina velutipes self-pollinated populations, shorten the breeding cycle, and increase breeding efficiency. Summary of the Invention
[0005] In view of this, the present invention provides a molecular marker for detecting the cap color of self-pollinated populations of *Flammulina velutipes* and its application, in order to overcome the deficiencies of the prior art.
[0006] This invention provides a KASP molecular marker for detecting the cap color of a self-pollinated population of *Flammulina velutipes*. The SNP site of the KASP molecular marker is located at 0.17 Mb from the end of chromosome 11 of the *Flammulina velutipes* cha01 reference genome PRJNA820294. The polymorphism of the SNP of the molecular marker is A / G and / or C / T.
[0007] The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO:1;
[0008] Preferably, the SNP site of the molecular marker includes the 203rd bp or the 404th bp of the nucleotide sequence.
[0009] In the self-pollinated population of *Enoki mushrooms*, brown color was relatively dominant over yellow.
[0010] The genotype of the *Flammulina velutipes* strain is Aa or AA, and the strain has a brown cap.
[0011] The genotype of the *Flammulina velutipes* strain is aa, and the strain has a yellow cap.
[0012] The present invention also provides a primer set for detecting the cap color of self-pollinated populations of *Flammulina velutipes*, including the aforementioned KASP molecular marker.
[0013] The primer set includes forward primer F1, forward primer F2, and reverse primer R; the KASP molecular marker includes either the KASP1 molecular marker or the KASP2 molecular marker;
[0014] The primer set satisfies at least one of (1)-(2):
[0015] (1) The primer sequence corresponding to the KASP1 molecular marker is as follows:
[0016] Forward primer F1:
[0017] GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA;
[0018] Forward primer F2:
[0019] GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG;
[0020] Reverse primer R:
[0021] GCCTTCTCTCCAAATGACACCTAA;
[0022] (2) The primer sequence corresponding to the KASP2 molecular marker is as follows:
[0023] Forward primer F1:
[0024] GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG;
[0025] Forward primer F2:
[0026] GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA;
[0027] Reverse primer R:
[0028] CTTGGTGATTAATTGGGGGCTTTG.
[0029] This invention provides a kit for detecting the cap color of self-pollinated populations of Flammulina velutipes, comprising the above-mentioned KASP molecular marker or the above-mentioned primer set.
[0030] The kit also includes a PCR amplification reaction system; the PCR amplification reaction system:
[0031] Template DNA, total amount 100 ng, 2 μL;
[0032] Forward primer F1, (10 μM) 0.1 μL
[0033] Forward primer F2, (10 μM) 0.1 μL
[0034] Reverse primer R, (10 μM) 0.3 μL
[0035] FLu-Arms 2× PCR Mix, 5 μL
[0036] Water, 4.5 μL.
[0037] This invention provides a method for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, using the aforementioned molecular markers, primer sets, or kits, and comprising the following steps:
[0038] (1) Extracting genomic DNA from Flammulina velutipes;
[0039] (2) Using the genomic DNA of the enoki mushroom as a template, PCR amplification reaction was performed using the molecular markers described in any one of claims 1-3, the primer set described in any one of claims 4-5, or the kit described in any one of claims 6-7;
[0040] (3) The PCR amplification products are detected to detect the brown and yellow caps of enoki mushrooms.
[0041] The PCR amplification reaction procedure was as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing at 61℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 15 s, annealing at 55℃ for 60 s, for 30 cycles; plate reading at 30℃ for 30 s.
[0042] Compared with the prior art, the technical solution of the present invention has the following advantages:
[0043] 1. The molecular marker for detecting the cap color of self-pollinated populations of *Flammulina velutipes* provided by this invention can quickly and accurately identify the cap color of brownish-red self-pollinated populations of *Flammulina velutipes*. It has advantages such as accuracy, high efficiency, and good typing effect, which can accelerate the screening of target varieties, assist in the breeding of *Flammulina velutipes* varieties, provide technical support for *Flammulina velutipes* breeding work, and lay a theoretical foundation. Attached Figure Description
[0044] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0045] Figure 1 This is Example 1 of the present invention, in which the KASP1 primer set is used to perform KASP genotyping on the cap color of the brownish-brown enoki mushroom self-pollinated population;
[0046] Figure 2 This is Example 2 of the present invention, in which the KASP2 primer set is used to perform KASP genotyping on the cap color of the brownish-brown enoki mushroom self-pollinated population. Detailed Implementation
[0047] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0048] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0049] Existing technologies make it difficult to quickly identify the color of the cap of enoki mushrooms. Therefore, the present invention provides the following technical solution.
[0050] In a first aspect, the present invention provides a KASP molecular marker for detecting the cap color of a self-pollinated population of Flammulina velutipes, wherein the SNP site of the KASP molecular marker is located at 0.17 Mb from the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294.
[0051] Optionally, the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO:1;
[0052] Preferably, the SNP polymorphism of the molecular marker is A / G and / or C / T.
[0053] The SNP site of the molecular marker includes the 203rd bp or the 404th bp of the nucleotide sequence.
[0054] SNP sites include SNP1 or SNP2.
[0055] It should be noted that in the sequence listing, r is defined as A / G, where [A / G] is the SNP1 site, corresponding to the KASP1 molecular marker; and y is defined as C / T, where [C / T] is the SNP2 site, corresponding to the KASP2 molecular marker.
[0056] In the self-pollinated population of *Flammulina velutipes*, brown color was relatively dominant over yellow, and were labeled A and a, respectively.
[0057] The genotype of the *Flammulina velutipes* strain is Aa or AA, and the strain has a brown cap.
[0058] The genotype of the *Flammulina velutipes* strain is aa, and the strain has a yellow cap.
[0059] Secondly, the present invention provides a primer set for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, including the aforementioned KASP molecular marker.
[0060] Optionally, the primer set includes forward primer F1, forward primer F2, and reverse primer R;
[0061] KASP molecular markers include KASP1 molecular markers or KASP2 molecular markers;
[0062] Optionally, the primer set satisfies at least one of (1)-(2):
[0063] (1) The primer sequence corresponding to the KASP1 molecular marker is as follows:
[0064] Forward primer F1:
[0065] GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA;
[0066] Forward primer F2:
[0067] GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG;
[0068] Reverse primer R:
[0069] GCCTTCTCTCCAAATGACACCTAA;
[0070] (2) The primer sequence corresponding to the KASP2 molecular marker is as follows:
[0071] Forward primer F1:
[0072] GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG;
[0073] Forward primer F2:
[0074] GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA;
[0075] Reverse primer R:
[0076] CTTGGTGATTAATTGGGGGCTTTG.
[0077] The above primers are respectively recorded for: KASP1-F1, KASP1-F2, KASP1-R; KASP2-F1, KASP2-F2, KASP2-R.
[0078] Thirdly, the present invention provides a kit for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, comprising the above-mentioned KASP molecular marker or the above-mentioned primer set.
[0079] Optionally, it also includes a PCR amplification reaction system;
[0080] Specifically, the PCR amplification reaction system consists of 2 μL of 100 ng DNA, 0.1 μL of forward primer F1 (10 μM), 0.1 μL of forward primer F2 (10 μM), 0.3 μL of reverse primer R (10 μM), 5 μL of FLu-Arms 2×PCR Mix, and 4.5 μL of ddH2O.
[0081] Fourthly, the present invention provides a method for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, using the aforementioned molecular markers, primer sets, or kits, comprising the following steps:
[0082] (1) Extracting genomic DNA from Flammulina velutipes;
[0083] (2) Using the genomic DNA of the enoki mushroom as a template, perform PCR amplification reaction using the above molecular markers, the above primer set or the above kit;
[0084] (3) The PCR amplification products are detected to detect the brown and yellow caps of enoki mushrooms.
[0085] The PCR amplification reaction procedure was as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing at 61℃ for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; denaturation at 95℃ for 15 s, annealing at 55℃ for 60 s, for 30 cycles; plate reading at 30℃ for 30 s.
[0086] The present invention will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed by the present invention. Example
[0087] This embodiment provides a KASP1 molecular marker for detecting the cap color of self-pollinated Flammulina velutipes. SNP sites of the main controlling gene for cap color in brown Flammulina velutipes self-pollinated populations were screened to obtain the SNP1 site. The SNP1 site is located 0.17 Mb from the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1. The SNP1 site is located at 203 bp of the nucleotide sequence, with a polymorphism of A / G.
[0088] This embodiment also provides a primer set, including the above-mentioned KASP1 molecular marker, and the corresponding primer set includes forward primer KASP1-F1, forward primer KASP1-F2, and reverse primer KASP1-R.
[0089] The SNP1 site information and primer nucleotide sequences of the molecular markers are shown in Table 1.
[0090] Table 1. SNP1 site information and primer nucleotide sequences
[0091]
[0092] This embodiment provides a kit for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, including the primer set described above, and a PCR amplification reaction system constructed as follows:
[0093] 2 μL contains 100 ng of DNA.
[0094] Forward primer F1 (10 μM) 0.1 μL,
[0095] Forward primer F2 (10 μM) 0.1 μL,
[0096] 0.3 μL of reverse primer R (10 μM),
[0097] 5 μL of FLu-Arms 2× PCR Mix
[0098] 4.5 μL ddH2O.
[0099] This embodiment also provides a method for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, including the following steps:
[0100] S1. Collect brown enoki mushroom spores and perform multi-spore self-pollination or single-spore hybridization to obtain a self-pollinated population.
[0101] S2. Extract genomic DNA from the self-pollinated population of brown enoki mushrooms to obtain the genomic DNA of each enoki mushroom to be tested;
[0102] S3. Using the genomic DNA to be tested obtained in S1 as a template, PCR amplification was performed on the genomic DNA to be tested using molecular markers to obtain amplification products. The above-mentioned PCR amplification reaction system was used. PCR amplification was performed using a Quantstudio 5 real-time fluorescence quantitative PCR instrument. The reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing for 60 s, decreasing by 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 15 s, 55℃ annealing for 60 s, for 30 cycles; 30℃ plate reading for 30 s.
[0103] S4. After the program finishes running, use QuantStudio™ Design & Analysis Software v1.5.3 to perform genotyping analysis.
[0104] S5. Compare the KASP genotyping results obtained in step S3 with the fruiting experiment phenotypes. The results are shown below. Figure 1 This allows for the genetic identification of the brown cap and yellow cap of the brown enoki mushroom self-pollinated population.
[0105] Thirteen *Flammulina velutipes* strains, including the brown-colored parent strain and its progeny self-pollination population, were used in the experiment. Three progeny strains had yellow caps, and ten strains had brown caps. Figure 1 As shown in the diagram, the genotyping of the self-pollinated population based on the KASP primer set of the SNP site is illustrated. Red represents yellow caps, blue represents brown caps, and black represents negative controls. The genotyping results are consistent with the cap color of *Flammulina velutipes*, indicating that the KASP molecular marker using the KASP1 primer set can be used to rapidly and accurately identify the cap color of brown *Flammulina velutipes* self-pollinated populations. Example
[0106] This embodiment provides a KASP2 molecular marker for detecting the cap color of self-pollinated Flammulina velutipes. SNP sites of the main controlling gene for cap color in brown Flammulina velutipes self-pollinated populations were screened to obtain the SNP2 site. The SNP2 site is located 0.17 Mb from the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, with the SNP site located at 404 bp, C / T.
[0107] This embodiment also provides a primer set including the above-mentioned KASP2 molecular marker, and the corresponding primer set includes forward primer KASP2-F1, forward primer KASP2-F2, and reverse primer KASP2-R.
[0108] The SNP2 site information and primer nucleotide sequences of the molecular marker are shown in Table 2.
[0109] Table 2 SNP2 site information and primer nucleotide sequences
[0110]
[0111] This embodiment provides a kit for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, including the primer set described above, and a PCR amplification reaction system constructed as follows:
[0112] 2 μL contains 100 ng of DNA.
[0113] Forward primer F1 (10 μM) 0.1 μL,
[0114] Forward primer F2 (10 μM) 0.1 μL,
[0115] 0.3 μL of reverse primer R (10 μM),
[0116] 5 μL of FLu-Arms 2× PCR Mix
[0117] 4.5 μL ddH2O.
[0118] This embodiment also provides a method for detecting the cap color of a self-pollinated population of *Flammulina velutipes*, including the following steps:
[0119] S1. Collect brown enoki mushroom spores and perform multi-spore self-pollination or single-spore hybridization to obtain a self-pollinated population.
[0120] S2. Extract genomic DNA from the self-pollinated population of brown enoki mushrooms to obtain the genomic DNA of each enoki mushroom to be tested;
[0121] S3. Using the genomic DNA to be tested obtained in S1 as a template, PCR amplification was performed on the genomic DNA to be tested using molecular markers to obtain amplification products. The above PCR amplification reaction system was used. PCR amplification was performed using a Quantstudio 5 real-time fluorescence quantitative PCR instrument. The reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing for 60 s, decreasing by 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 15 s, 55℃ annealing for 60 s, for 30 cycles; 30℃ plate reading for 30 s.
[0122] S4. After the program finishes running, use QuantStudio™ Design & Analysis Software v1.5.3 to perform genotyping analysis.
[0123] S5. Compare the KASP genotyping results obtained in step S3 with the fruiting experiment phenotypes. The results are shown below. Figure 2 This allows for the genetic identification of the brown cap and yellow cap of the brown enoki mushroom self-pollinated population.
[0124] Thirteen *Flammulina velutipes* strains, including the brown-colored parent strain and its progeny self-pollination population, were used in the experiment. Three progeny strains had yellow caps, and ten strains had brown caps. Figure 2 As shown in the diagram, the genotyping of the self-pollinated population based on the KASP primer set of the SNP site is illustrated. Red represents yellow caps, blue represents brown caps, and black represents negative controls. The genotyping results are consistent with the cap color of *Flammulina velutipes*, indicating that the KASP molecular marker using the KASP2 primer set can be used to rapidly and accurately identify the cap color of brown *Flammulina velutipes* self-pollinated populations.
Claims
1. A KASP molecular marker for detecting the cap color of brownish-red enoki mushroom self-pollination colonies, characterized in that, The nucleotide sequence of the SNP molecular marker of the KASP molecular marker is shown in SEQ ID NO:1; The nucleotide sequence shown in SEQ ID NO:1 contains an A / G mutation at 203 bp; or, the nucleotide sequence shown in SEQ ID NO:1 contains a C / T mutation at 404 bp.
2. A primer set for detecting the cap color of a brownish-red enoki mushroom self-pollination colony, characterized in that, Including the KASP molecular marker as described in claim 1; The primer set includes forward primer F1, forward primer F2, and reverse primer R; the KASP molecular marker includes either the KASP1 molecular marker or the KASP2 molecular marker; The primer set satisfies at least one of (1)-(2): (1) The primer sequence corresponding to the KASP1 molecular marker is as follows: Forward primer F1: GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA; Forward primer F2: GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG; Reverse primer R: GCCTTCTCTCCAAATGACACCTAA; (2) The primer sequence corresponding to the KASP2 molecular marker is as follows: Forward primer F1: GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG; Forward primer F2: GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA; Reverse primer R: CTTGGTGATTAATTGGGGGCTTTG.
3. A kit for detecting the cap color of a brownish-red enoki mushroom self-pollination colony, characterized in that, Includes the primer set as described in claim 2.
4. The reagent kit according to claim 3, characterized in that, It also includes a PCR amplification reaction system; the PCR amplification reaction system: Template DNA, total amount 100 ng, 2 μL; Forward primer F1, concentration 10 μM, 0.1 μL; Forward primer F2, concentration 10 μM, 0.1 μL; Reverse primer R, concentration 10 μM, 0.3 μL; FLu-Arms 2× PCR Mix, 5 μL; Water, 4.5 μL.
5. A method for detecting the cap color of a brownish-red enoki mushroom self-pollination colony, characterized in that, Using the primer set of claim 2 or the kit of any one of claims 3-4, the method includes the following steps: (1) Extracting genomic DNA from Flammulina velutipes; (2) Using the genomic DNA of the enoki mushroom as a template, perform PCR amplification reaction using the primer set described in claim 2 or the kit described in any one of claims 3-4; (3) The PCR amplification products are detected to detect the brown and yellow caps of enoki mushrooms.
6. The method according to claim 5, characterized in that, The PCR amplification reaction procedure was as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing at 61℃ for 60 s, decreasing the temperature by 0.6℃ for each cycle, for 10 cycles; denaturation at 95℃ for 15 s, annealing at 55℃ for 60 s, for 30 cycles; and plate reading at 30℃ for 30 s.
Citation Information
Patent Citations
Brown flammulina velutipes and application thereof
CN118064283A
Primer set for Composition for classifying color of pileus button mushroom and uses thereof
KR1020180092751A