Kit for combined detection of HIV-1 type and 2 type antibodies and nucleic acids, full-automatic detection and analysis system and application thereof

Abstract

The invention discloses a kit for combined detection of HIV-1 type and HIV-2 type nucleic acids and antibodies, a full-automatic detection and analysis system and application thereof, and belongs to the technical field of biomedical detection. According to the present invention, the real-time fluorescent nucleic acid isothermal amplification detection method principle and the magnetic particle chemiluminescence method principle are combined so as to achieve the joint detection of the HIV-1 type nucleic acid and the HIV-2 type nucleic acid and the antibody, and the high detection sensitivity is provided when the joint detection is performed on the HIV-1 type nucleic acid and the HIV-2 type nucleic acid and the antibody. And a full-automatic detection and analysis system is carried, so that full-automatic detection and analysis of HIV-1 type and HIV-2 type nucleic acids and antibodies can be realized.

Description

Technical Field

[0001] The present invention belongs to the field of biochemical detection technology, in particular to the field of immunodiagnosis and molecular diagnosis technology, and specifically relates to a kit for jointly detecting human immunodeficiency virus type 1 and type 2 (HIV-1 / 2) antibodies and nucleic acids, a fully automatic detection and analysis system and applications thereof. Background Art

[0002] Acquired immunodeficiency syndrome (AIDS), also known as AIDS, is a serious infectious disease caused by infection with the human immunodeficiency virus (HIV). The virus mainly attacks the human body's CD4+T cells. In the later stages of infection, due to the body's low immune function, various secondary opportunistic infections occur, leading to death. According to statistics, there were about 39 million people infected with AIDS in the world in 2022, and about 29.8 million people were receiving antiretroviral treatment. Every year, there are about 1.3 million new people infected with AIDS, of which about 630,000 die from AIDS-related diseases. In recent years, more than 100,000 new infections and patients have been reported each year, and about 30,000 deaths. Therefore, early diagnosis and intervention of HIV are particularly important.

[0003] HIV can be divided into two types based on serology and viral nucleic acid sequences: HIV-1 and HIV-2. HIV-1 is prevalent in most parts of the world, while HIV-2 is only prevalent in parts of Africa. The period from when HIV infects a person to when HIV antibodies, antigens or nucleic acids in the infected person's serum can be detected is called the AIDS window period.

[0004] At present, HIV clinical diagnosis technologies include HIV virus isolation, viral load measurement, HIV nucleic acid detection, HIV antibody detection or HIV antigen-antibody combined detection, among which antibody detection is a more commonly used method in clinical practice. Generally, HIV positive initial screening requires confirmation by western blot or viral nucleic acid detection.

[0005] HIV antibody detection mainly includes enzyme-linked immunosorbent assay (ELISA), colloidal gold and chemiluminescence detection. ELISA is the earliest and fastest-growing method, and is still used in current clinical tests. However, this method has the following shortcomings: (1) It can only use specified reaction containers, cannot be tested independently, and has poor flexibility; (2) There are many types of reagents used in the test, and the operation of adding reagents is cumbersome; (3) The accuracy and precision of the test results are poor; (4) The detection time is long, generally more than 1 hour. The advantages of the colloidal gold method are simple and fast operation and fast detection time, but the sensitivity is low, so its clinical application range is limited.

[0006] Since the first HIV test reagent entered the market in 1985, chemiluminescence has gradually replaced ELSIA and become the mainstream choice in the market due to its advantages such as high sensitivity, good stability, and non-toxicity. Chemiluminescence is divided into direct chemiluminescence, enzymatic chemiluminescence, and electrochemiluminescence according to the principle. Electrochemiluminescence is easy to pollute and the development platform technology is difficult, so it is rarely popular in China. The principle of enzymatic luminescence is an indirect chemical reaction catalyzed by horseradish peroxidase. The disadvantage of this method is that the molecular configuration space of the enzyme protein is large, the labeling difficulty is high, and the reaction time is long. Direct chemiluminescence with acridinium ester as a marker has detailed advantages over enzymatic chemiluminescence, mainly manifested in: 1. Small molecular weight and easy to label. 2. Glow type, fast reaction speed. 3. The luminescence system is relatively simple, does not require a catalyst, and only an alkaline environment is required. In order to meet the clinical needs of high sensitivity and rapid diagnosis of HIV, direct chemiluminescence has gradually become the first choice of detection technology. For example, patent documents CN106501519A (hereinafter referred to as document 1) and CN104237510A (hereinafter referred to as document 2) both disclose a human immunodeficiency virus antibody detection kit, which utilizes acridinium ester-labeled antigens in combination with a magnetic separation system to achieve universal detection of both HIV-1 and HIV-2 antibodies.

[0007] However, both the above-mentioned documents 1 and 2 can only detect HIV antibodies (combined antigens). Although the detection of antibodies is fast and convenient, the product quality varies greatly, is not suitable for quality control, and can only be qualitative but not quantitative. And because antibody detection has a long detection window period. During the HIV window period, patients are still highly contagious, which is bound to result in the failure to make an early diagnosis and intervention in the early stages of HIV infection, and there is a risk of missing the best treatment period.

[0008] HIV nucleic acid detection can be used for HIV infection diagnosis, blood screening, disease course assessment and antiviral treatment effect monitoring. After a patient is infected with HIV, the virus replicates rapidly in his body. When the viral RNA in the blood is higher than the lower limit of detection of the nucleic acid detection reagent, the HIV nucleic acid test result is positive. At this time, a judgment can be made based on epidemiological history, clinical symptoms and HIV antibody initial screening results. It is currently believed that the window period for HIV nucleic acid detection can be shortened to about 1 week. Nucleic acid detection has a high sensitivity and is very important for disease progression detection, observation of treatment effects and drug resistance monitoring. Further shortening the detection window period can intervene in treatment one step earlier. For example, patent document CN105567867A (hereinafter referred to as document 3) discloses a human immunodeficiency virus type 1 real-time fluorescent nucleic acid isothermal amplification detection kit, which can detect HIV nucleic acid based on a nucleic acid isothermal amplification method with HIV-1RNA as an amplification target, and can quickly obtain test results. For example, patent document CN112795699A (hereinafter referred to as document 4) discloses a universal primer, probe and detection method for detecting different subtypes of HIV-1 virus by RT-RAA fluorescence method, which can complete the detection within 30 minutes, and the detection sensitivity can reach 20 copies / reaction. For example, patent document CN117106976A (hereinafter referred to as document 5) discloses a human immunodeficiency virus type 2 (HIV-2) nucleic acid quantitative detection method, which can realize quantitative detection of HIV-2 based on the PCR amplification detection principle, and the sensitivity can reach 20 copies / mL. However, the above documents 3-5 can only detect one of HIV-1 and HIV-2, but cannot detect HIV-1 and HIV-2 at the same time, which may cause missed detection. Although the human immunodeficiency virus nucleic acid detection method disclosed in patent document CN116904659A (hereinafter referred to as document 6) can detect HIV-1 and HIV-2 at the same time, its verified detection sensitivity is only 100 copies / reaction, and the detection sensitivity is low. This method is based on the PCR detection principle, the detection time is long, and the amplified product is DNA, which is easy to cause aerosol pollution. In addition, the above documents 3-6 can only detect HIV nucleic acid, but cannot detect HIV antibodies simultaneously. And because there is no commercial HIV-1 / 2 nucleic acid constant temperature amplification kit on the market, the detection method is not standardized, the reproducibility of the test results between laboratories is poor, the cost is high, and the operator requirements are high. It is difficult to promote in general laboratories and is not suitable for rapid detection and widespread clinical application.

[0009] Therefore, how to achieve rapid detection, efficient detection and standardization or further realize operation automation while ensuring detection sensitivity and specificity is a key link in my country's current AIDS prevention and control work. Summary of the invention

[0010] In view of one or more of the problems existing in traditional detection, the purpose of the present invention is to provide a fully automatic analysis system and a detection kit that can simultaneously detect HIV-1 / 2 antibodies and nucleic acids. It can be flexibly changed according to the detection requirements to achieve multifunctional detection of the equipment, thereby saving labor costs and improving the efficiency of detection.

[0011] The technical solution of the present invention is as follows.

[0012] In a first aspect, the present invention provides a kit for the combined detection of HIV-1 and HIV-2 antibodies and nucleic acids, comprising:

[0013] (1) Amplification detection solution: comprising a first primer, a second primer and a target detection probe for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the first primer cooperates with the second primer to amplify the target sequence, and the target detection probe specifically binds to the RNA copy of the amplified product of the target;

[0014] The nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-1 nucleic acid are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-2 nucleic acid are shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively;

[0015] (2) SAT enzyme solution: comprising at least one RNA polymerase and M-MLV reverse transcriptase;

[0016] (3) Extraction reagent R1: used to specifically capture HIV antibodies in the sample and purify and separate the target antibodies in the sample;

[0017] (4) Luminescent reagent R2: a luminescent marker that immunologically binds to HIV antibodies in the sample;

[0018] (5) Excitation solution R3: It is the key substrate required for the luminescent marker to carry out chemical reactions;

[0019] (6) Excitation liquid R4: It provides the conditions required for chemiluminescence or assists in the chemical reaction of the excitation liquid R3.

[0020] In some embodiments, a fluorescent reporter group and a quencher group are respectively carried at both ends of the nucleotide sequence of the target detection probe.

[0021] In some embodiments, the fluorescent reporter group can be selected from FAM, HEX, JOE, TET, CY3, CY5, ROX, Texas, and the quencher group can be selected from TAMRA, BHQ (BHQ1, BHQ2, BHQ3), MGB, DABCYL.

[0022] In some embodiments, the kit provided in the first aspect further comprises:

[0023] (7) HIV nucleic acid extract: comprising a solid support containing capture probes for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the capture probes are used to capture the detection sequence; optionally, the HIV nucleic acid extract further comprises the second primers for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively; further optionally, the components of the HIV nucleic acid extract include: HEPES 250-800mM, LLS 4-10%, 1-50μΜ of each capture probe for HIV-1 nucleic acid and HIV-2 nucleic acid, 50-500mg / L of magnetic beads, and 200-800pmol / mL of the second primer;

[0024] The nucleotide sequence of the capture probe for HIV-1 nucleic acid is shown in SEQ ID NO:13, and the nucleotide sequence of the capture probe for HIV-2 nucleic acid is shown in SEQ ID NO:15.

[0025] In some embodiments, the kit provided in the first aspect further comprises a washing solution, which is used to wash the magnetic beads in the process of antibody or nucleic acid capture, purification and extraction; further optionally, the washing solution comprises washing solutions 1-3,

[0026] The components of the washing solution 1 include: 5-50 mM HEPES, 50-500 mM NaCl, 0.5-2% SDS, 1-10 mM EDTA;

[0027] The components of the washing liquid 2 include: mineral oil;

[0028] And / or the components of the washing solution 3 include: 0.01-0.1% (v / v) Tween20, 1-10mM Na2HPO4, 1-5mM KH2PO4.

[0029] In some embodiments, the kit provided in the first aspect further comprises one or more of the following:

[0030] (8) Positive control A1: It contains the HIV-1 pol gene nucleic acid fragment;

[0031] (9) Positive control A2: It contains the HIV-2 LTR gene nucleic acid fragment;

[0032] (10) Positive control B1: contains HIV-1 antibodies;

[0033] (11) Positive control B2: contains HIV-2 antibodies;

[0034] (12) Negative control A3: It does not contain HIV-1 and HIV-2 nucleic acid; and

[0035] (13) Negative control B3: It does not contain HIV-1 and HIV-2 antibodies.

[0036] In some embodiments, the principle of chemiluminescence is direct chemiluminescence technology based on acridinium ester.

[0037] In some embodiments, the components of the amplification detection solution include: 10-50mM Tris, 10-40mM MgCl2, 0.1-10mM dNTP, 1-20mM NTP, 1-10% PVP40, 5-40mM KCl, 200-800pmol / mL of the second primer, 200-800pmol / mL of the first primer and 200-900pmol / mL of the target detection probe.

[0038] In some embodiments, the components of the SAT enzyme solution include: 16000-160000 U / mL of M-MLV reverse transcriptase, 8000-80000 U / mL of RNA polymerase, 2-10 mM HEPES pH7.5, 10-100 mM N-acetyl-L-cysteine, 0.04-0.4 mM zinc acetate, 10-100 mM trehalose, 40-200 mM Tris-HCl pH 8.0, 40-200 mM KCl, 0.01-0.5 mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol.

[0039] In some embodiments, the components of the extraction reagent R1 include: pH 9.0-9.5 phosphate buffer, 0.5-1.5 mg / mL immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen (particle size 0.9-1.8 μm, iron content 36-50%), preservatives (0.1-0.5%) ), optionally on the immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen, the coating amount ratio of HIV-1 antigen and HIV-2 antigen is 1:075-1.5, and the concentration ratio of the total coating amount of HIV-1 antigen and HIV-2 antigen to the immunomagnetic beads is 1:75-125 (μg / mL:mg / mL).

[0040] In some embodiments, the components of the luminescent reagent R2 include: pH 9.0-9.5 phosphate buffer, 10-100 μg / mL acridinium ester, 1-10 μg / mL HIV-1 and 1-10 μg / mL HIV-2 antigens, preservatives (0.1-0.5% ).

[0041] In some embodiments, the components of the excitation solution R3 include: pH 9.0-9.5 phosphate buffer, 0.01-1M H2O2 (or 1,2-dioxetane derivatives, luminol, etc.), preservatives (0.1-0.5% ).

[0042] In some embodiments, the components of the stimulating solution R4 include: pH 9.0-9.5 phosphate buffer, 0.1-0.5M NaOH, preservative (0.1-0.5% ).

[0043] In some embodiments, using the kit provided in the first aspect to detect HIV-1 / 2 nucleic acid (the minimum sample volume for detecting nucleic acid in a single sample is 450 μL) comprises the following steps:

[0044] 1) Optionally, adding a nucleic acid extraction solution to the sample to extract nucleic acid to obtain an analytical test sample;

[0045] 2) adding an amplification detection solution to the analysis and detection sample obtained in step 1) or directly to the nucleic acid sample to be detected to perform a first step reaction to obtain a first step reaction solution;

[0046] 3) adding SAT enzyme solution to the first step reaction solution to carry out the second step reaction to obtain the second step reaction solution; and simultaneously carrying out real-time fluorescence detection to obtain the dt value of the real-time fluorescence detection;

[0047] 4) Determine the result based on the dt value obtained in step 3):

[0048] If the dt of the fluorescence channel corresponding to HIV-1 is ≤ 38, the sample is positive, that is, the sample contains HIV-1 nucleic acid;

[0049] If the dt of the fluorescence channel corresponding to HIV-2 is ≤ 38, the sample is positive, that is, the sample contains HIV-2 nucleic acid;

[0050] If the dt of the fluorescence channel corresponding to HIV-1 or HIV-2 is greater than 38, the sample is negative, that is, the sample does not contain HIV-1 / 2 nucleic acid.

[0051] In some embodiments, the detection of HIV-1 / 2 antibodies (the minimum sample volume for detecting only antibodies in a single sample is 300 μL) using the kit provided in the first aspect comprises the following steps:

[0052] 1') adding extraction reagent R1 to the sample for antibody capture, and obtaining an analysis and detection sample after washing;

[0053] 2') adding the luminescent reagent R2 to the analysis and detection sample obtained in step 1') to carry out the first step reaction to obtain the first step reaction solution;

[0054] 3') adding the excitation solutions R3 and R4 to the first step reaction solution to carry out the second step reaction to obtain the second step reaction solution; and simultaneously carrying out chemical signal detection to obtain the relative luminescence signal value;

[0055] 4') determining the result according to the S / CO value obtained in step 3');

[0056] If S / CO is less than 1, the sample does not contain HIV antibodies; if S / CO is greater than or equal to 1, the sample contains HIV antibodies.

[0057] In some embodiments, the minimum sample volume for combined antibody and nucleic acid detection of a single sample is 550 μL.

[0058] In some embodiments, the sample source includes serum or plasma.

[0059] In a second aspect, the present invention provides a real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting HIV-1 and HIV-2 nucleic acids, comprising:

[0060] (1') an amplification detection solution: comprising a first primer, a second primer and a target detection probe for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the first primer cooperates with the second primer to amplify the target sequence, and the target detection probe specifically binds to the RNA copy of the amplified product of the target;

[0061] The nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-1 nucleic acid are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-2 nucleic acid are shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively;

[0062] (2') SAT enzyme solution: comprising at least one RNA polymerase and M-MLV reverse transcriptase;

[0063] Optionally, the real-time fluorescent nucleic acid isothermal amplification detection kit further comprises:

[0064] (3') HIV nucleic acid extract: comprising a solid support containing capture probes for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the capture probes are used to capture the detection sequence; optionally, the HIV nucleic acid extract further comprises the second primers for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively;

[0065] The nucleotide sequence of the capture probe for HIV-1 nucleic acid is shown in SEQ ID NO:13, and the nucleotide sequence of the capture probe for HIV-2 nucleic acid is shown in SEQ ID NO:15.

[0066] In a third aspect, the present invention provides a kit for detecting HIV-1 and HIV-2 antibodies, comprising:

[0067] (1”) Extraction reagent R1: It is used to specifically capture HIV antibodies in the sample and purify the target antibodies in the sample; its components include: pH 9.0-9.5 phosphate buffer, 0.5-1.5 mg / mL immunomagnetic beads (particle size 0.9-1.8 μm) coated with HIV-1 antigen and HIV-2 antigen, preservative (0.1-0.5%) ), optionally, on the immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen, the coating amount ratio of HIV-1 antigen and HIV-2 antigen is 1:075-1.5, and the concentration ratio of the total coating amount of HIV-1 antigen and HIV-2 antigen to the amount of immunomagnetic beads is 1:75-125 (μg / mL:mg / mL);

[0068] (2”) Luminescent reagent R2: It is a luminescent marker that immunologically binds to HIV antibodies in the sample; its components include: pH 9.0-9.5 phosphate buffer, 10-100 μg / mL acridinium ester, 1-10 μg / mL HIV-1 and 1-10 μg / mL HIV-2 antigens, preservative (0.1-0.5% );

[0069] (3”) Excitation solution R3: It is the key substrate required for the chemical reaction of the marker; its components include: pH 9.0-9.5 phosphate buffer, 0.01-1M H2O2, preservative (0.1-0.5%) );

[0070] (4") Excitation solution R4: It provides the conditions required for chemiluminescence or assists in the chemical reaction of the excitation solution R3; its components include: pH 9.0-9.5 phosphate buffer, 0.1-0.5M NaOH, preservative (0.1-0.5% ).

[0071] In a fourth aspect, the present invention provides a fully automatic detection and analysis system for the combined detection of HIV-1 / 2 antibodies and nucleic acids, wherein the fully automatic detection and analysis system is obtained by modifying the automated nucleic acid sample preparation, detection and analysis system disclosed in patent document CN111699242A as follows: a. Figure 1 One of the two sample processing cooling racks (118) between the sample processing tube rack (106) and the incubator (114) is converted into an incubator (114), and the sample processing cooling rack (118) close to the incubator (114) is optionally converted into an incubator (114); b. The sample processing cooling rack (118) of the patent document CN111699242A is converted into an incubator (114); Figure 1 The three pipette tip containers (130) near the fluorometer (120) are transformed into an antibody detection module, which is used for generating and collecting signals in antibody detection and is mainly composed of a photomultiplier tube (PMT) photon signal collection device.

[0072] In some embodiments, the fully automatic detection and analysis system for the joint detection of HIV-1 / 2 antibodies and nucleic acids provided in the fourth aspect includes: a mechanical pipette, a mechanical arm, a reagent rack, a sample source tube rack, a pipette tip container, a sample processing cooling rack, two incubators for heating, a container for heating, a vibrator, a nucleic acid separation system, an antibody detection module, a fluorometer, a solid waste management system, and a computer system, etc. Among them: the computer system is mainly used for the setting of reagents, consumables, samples, etc. and the viewing of results, the sample processing cooling rack is mainly used for the placement of sample processing tubes and the corresponding liquid addition operations, the incubator for heating is mainly used for incubation under different temperature conditions during the reaction process, the vibrator is mainly used for mixing reagents and samples during the detection process, the nucleic acid separation system is mainly used for adsorbing and fixing magnetic particles from the solution during the extraction stage, and the antibody detection module and the fluorometer are mainly used for capturing reaction signals.

[0073] In some embodiments, the fully automatic detection and analysis system also includes a reagent rack and a pipette tip rack; wherein the reagent rack is mainly used for placing detection-related reagents and reference substances, and the pipette tip rack is mainly used for placing corresponding consumables during the detection process.

[0074] In some embodiments, the fully automatic detection and analysis system includes two incubators, one of which is used to produce a heating temperature of 37±1°C (e.g., 36°C, 36.5°C, 37°C, 37.5°C, or 38°C), and the other incubator is used to produce a heating temperature of 60±1°C (e.g., 59°C, 59.5°C, 60°C, 60.5°C, or 61°C).

[0075] In some embodiments, in the fully automatic detection and analysis system, signal collection for antibody detection is completed by the antibody detection module, wherein the antibody detection module is used to generate and receive chemiluminescent signals; signal collection for nucleic acid detection is completed by the fluorometer, wherein the fluorometer is used to collect fluorescent signals generated by nucleic acid amplification in real time; optionally, the temperature of the fluorometer is set to 42±1°C (e.g., 41°C, 41.5°C, 42°C, 42.5°C or 43°C).

[0076] In some embodiments, the fully automatic detection and analysis system can fully automatically implement one or both of the antibody and nucleic acid detection processes, as well as data analysis, and provide the detection results of the samples.

[0077] The use of the kit provided in the first to third aspects of the present invention or the fully automatic detection and analysis system provided in the fourth aspect of the present invention in the combined detection of HIV-1 and HIV-2 antibodies and nucleic acids also belongs to the content of the present invention.

[0078] The fully automatic detection system proposed by the present invention can detect nucleic acids and antibodies at the same time, and adopts magnetic particle separation and analysis technology to achieve high-throughput automated detection. Compared with traditional laboratory antibody detection and nucleic acid detection systems, this system is highly centralized and can be adjusted according to actual detection requirements, greatly saving equipment detection and labor costs, and is suitable for clinical HIV auxiliary diagnosis.

[0079] Compared with the existing detection methods, the present invention also has the following advantages:

[0080] (1) The primers and probe sets in the kit of the present invention are optimized and designed based on HIV-1 pol gene RNA and HIV-2 LTR gene RNA, and different components are added step by step during the detection process to achieve higher sensitivity detection. The results of the examples show that the sensitivity of the kit and method provided by the present invention for HIV nucleic acid detection can reach 20 copies / mL (or 5 copies / reaction), which is significantly higher than the sensitivity of the two methods for isothermal amplification detection of HIV-1 disclosed in the above-mentioned documents 3 and 4. Therefore, the kit and method provided by the present invention can meet the requirements of higher sensitivity.

[0081] (2) The present invention uses real-time fluorescent nucleic acid isothermal amplification detection technology to detect HIV-1 / 2 nucleic acid, and can provide typing information for nucleic acid positive results to clearly identify whether it is HIV-1 or HIV-2 type.

[0082] (3) The present invention adopts the double antigen sandwich method to detect HIV 1 / 2 antibodies. By optimizing the reaction conditions and system, the detection sensitivity of HIV-1 and HIV-2 antibodies can reach 0.25 NCU / mL, which is higher than the sensitivity of the HIV-1 / 2 antibody detection method disclosed in Document 2. Therefore, the kit and method provided by the present invention can meet the requirements of higher sensitivity.

[0083] (4) The present invention simultaneously performs antibody capture and detection, and nucleic acid amplification and detection in the same closed system, thereby greatly shortening the time required and reducing the design and production costs of the instruments used. A single instrument can complete the detection of antibodies and / or nucleic acids in a sample.

[0084] (5) The present invention uses a fully automatic antibody and nucleic acid detection instrument to avoid the risks brought by multiple transfers of samples and reduce the number of operations by test personnel. A single sample processing can complete the antibody and / or nucleic acid detection as required.

[0085] (6) The amplified product of the nucleic acid of the present invention is RNA, which is very easy to degrade in nature. Compared with the DNA products of the above-mentioned References 5 and 6, the contamination is easy to control, the cross-effect is small, and it will not cause cross-contamination of samples and environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 This is the screening and optimization of the antibody detection reagent conditions in Example 1; Panel A shows different volumes of the extraction reagent R1; Panel B shows different volumes of the washing solution 3; Panel C shows different incubation times after the addition of the luminescent reagent; and Panel D shows different volumes of the excitation solution.

[0087] Figure 2 The data for quantifying HIV antibodies based on the standard in Example 1 (A) and the standard curves for quantifying HIV-1 (B) and HIV-2 (C) antibodies, respectively.

[0088] Figure 3 The sensitivity of the antibody detection reagent used in Example 1 to detect HIV-1 and HIV-2 antibodies was confirmed.

[0089] Figure 4 The amplification curves for the screening of HIV-1 and HIV-2 type primer and probe combinations in Example 3; AB is group 1, CD is group 2, and EF is group 3.

[0090] Figure 5This is the screening of HIV-specific target capture probes in Example 4. The AB frame is capture probe combination 4, and the CD frame is capture probe combination 5.

[0091] Figure 6 The amplification curve (A) and standard curve (B) for quantifying HIV-1 nucleic acid based on the standard in Example 4.

[0092] Figure 7 The amplification curve (A) and standard curve (B) for quantifying HIV-2 nucleic acid based on the standard in Example 4.

[0093] Figure 8 These are the nucleic acid test results of 6 samples based on the method of the present invention in Example 5. FAM is HIV-1 type, and Cy5 is HIV-2 type. DETAILED DESCRIPTION

[0094] In view of the defects of HIV detection methods in the prior art, the present invention can jointly utilize the nucleic acid constant temperature synchronous amplification detection method and the magnetic particle chemiluminescence method to detect HIV-1 / 2 viral nucleic acid and antibodies in serum, and provide a kit for combined detection and a fully automatic detection and analysis system.

[0095] The content of the present invention is described in detail below with reference to specific embodiments and drawings.

[0096] In the following, only some exemplary embodiments are briefly described. As those skilled in the art will appreciate, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and descriptions are considered to be exemplary and non-restrictive in nature.

[0097] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0098] The methods for obtaining various biological materials described in the examples are only provided as a way of obtaining them in an experiment to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0099] All antigens, primers, probes and in vitro transcribed RNA products mentioned in the present invention are synthesized or produced using existing technologies.

[0100] Example 1: Development of HIV-1 / 2 virus antibody detection reagent and kit based on magnetic microparticle chemiluminescence

[0101] The following is a complete and detailed description of the technical route for the development of HIV-1 / 2 virus antibody detection reagents and kits based on magnetic particle chemiluminescence:

[0102] S1. Activation modification of immunomagnetic beads: Take the suspension of carboxylated magnetic microparticles, remove the supernatant by magnetic separation, and resuspend in MES (2-(N-morpholine) ethanesulfonic acid) buffer. Then add EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) aqueous solution to activate the surface carboxyl groups of the carboxylated magnetic microparticles, and repeat 3 times. Then add human immunodeficiency virus type 1 and type 2 antigens (HIV-1 and HIV-2 antigens) (HIV-1 antigen and HIV-2 antigen were purchased from Beijing Keyue Zhongkai Biotechnology Co., Ltd., with article numbers: A101C041 and A201C023, respectively). React at room temperature for 3 to 4 hours. After magnetic separation, remove the supernatant and resuspend in Tris buffer to obtain carboxylated magnetic microparticles (hereinafter also referred to as magnetic beads) coated with human immunodeficiency virus antigens.

[0103] The concentration of the MES buffer can be 0.01-0.05 M, and the pH is 5-6. The concentration of the MES buffer used in the embodiment is specifically 0.25 M, and the pH is 5.5;

[0104] The concentration of the EDC aqueous solution may be 20 mg / mL to 50 mg / mL, and the concentration used in the embodiment is specifically 25 mg / mL. The ratio of EDC to the carboxylated magnetic beads may be 1:5 to 20, and the ratio of EDC to the carboxylated magnetic beads in the embodiment is 1:10;

[0105] The concentration of Tris buffer is 0.2 M and contains 1-5% BSA, with a pH of 7.5-9. In the embodiment, the Tris buffer contains 2.5% BSA, with a pH of 9.0.

[0106] S2. Confirmation of antigen concentration in combination with immunomagnetic beads: Since this kit adopts the double antigen sandwich method, the number of antigens bound to the magnetic beads is particularly critical. An overdose will result in too much antigen being free, which will combine with the antibodies in the sample to be tested, thereby reducing the signal-to-noise ratio of the reaction system and causing false negatives. Too little will reduce the capture efficiency of the magnetic beads, thereby reducing sensitivity. Therefore, the appropriate ratio of magnetic beads to antigens needs to be confirmed. In this embodiment, the addition ratio between HIV-1 and HIV-2 antigens (1:0.5-2, which is the ratio of concentration (μg / mL) after addition) was screened, and the different ratios between the total amount of coated antigen (concentration μg / mL) and magnetic beads (concentration mg / mL) (1:50-150μg / mL: mg / mL) were verified, and the results are shown in Table 1 below:

[0107] Table 1: Screening of the ratio of HIV-1 and HIV-2 antigens added and the concentration of antigens bound to magnetic beads

[0108] As can be seen from Table 1 above, when the ratio of HIV-1 antigen to HIV-2 antigen is 1:0.5-2 (at this time, the ratio of HIV antigen (total amount of HIV-1 antigen and HIV-2 antigen) to magnetic beads is 1:100), the S / CO value (signal-to-noise ratio) can reach more than 9, but when the addition ratio is 1:1, the S / CO value (signal-to-noise ratio) can reach 14.81, which is significantly higher than the addition ratio of 1:0.5 and 1:2. When the ratio of HIV antigen to magnetic beads is 1:50-150 (at this time, the ratio of HIV-1 antigen to HIV-2 antigen is 1:1), the S / CO value (signal-to-noise ratio) can reach more than 18, but when the ratio of the two is 1:100, the S / CO value (signal-to-noise ratio) can reach 21.61, which is significantly higher than the ratio of 1:50 and 1:150. In summary, when the addition ratio of HIV-1 antigen and HIV-2 antigen is 1:1 (optionally 1:0.75-1.5), and the total amount of HIV antigen and magnetic beads ratio is 1:100 (optionally 1:75-125), the S / CO value (signal-to-noise ratio) reaches the highest, which is the best detection system. When the immunomagnetic beads are activated and modified in the above step S1, the addition ratio of HIV-1 antigen and HIV-2 antigen is controlled to be 1:1, and the total amount of HIV antigen and magnetic beads ratio is 1:100 to prepare immunomagnetic beads coated with HIV-1 and HIV-2 antigens.

[0109] S3. Debugging of positive and negative reference substances

[0110] Directly use clinical HIV negative serum or plasma for homogenization, and then package it into negative quality control products, and control the S / CO value (luminescence signal to background value ratio, signal-to-noise ratio) within the range of 0.1 to 0.5. HIV-1 type antibody (purchased from Beijing Keyue Zhongkai Biotechnology Co., Ltd., certificate number: GBW(E)090080) is diluted and packaged with HIV negative serum to form positive quality control product 1, and the S / CO value is controlled within the range of 5 to 20. HIV-2 type antibody (purchased from Beijing Keyue Zhongkai Biotechnology Co., Ltd., item number: A222QC23) is diluted and packaged with HIV negative serum to form positive quality control product 2, and the S / CO value is controlled within the range of 5 to 20.

[0111] S4, extraction reagent R1 (used to specifically capture HIV antibodies in the sample and purify and separate target antibodies in the sample)

[0112] The composition of R1 in this example is: pH 9.5 phosphate buffer, 1.2 mg / mL immunomagnetic beads coated with HIV-1 and HIV-2 antigens (particle size 0.9-1.8 μm) (immunomagnetic beads coated with HIV-1 and HIV-2 antigens obtained from S1), preservative (0.25% In order to achieve the best capture effect, different volumes of extraction reagent R1 (40-60 μL) were tested. The results are as follows: Figure 1 As shown in panel A, 50 μL was finally confirmed as the optimal amount of extraction reagent R1 added.

[0113] S5. Confirmation of volume and number of wash solutions 3

[0114] The composition of the washing solution 3 in this example is: 0.05% (v / v) Tween20, 5mM Na2HPO4, 2.5mM KH2PO4. In order to achieve the best detection effect, different volumes of washing solution 3 (200-400 μL) were tested and the washing was repeated twice. The results are as follows: Figure 1 As shown in panel B, 300 μL was finally confirmed as the optimal volume of washing solution to be added.

[0115] S6. Determination of temperature and time of immune binding reaction

[0116] In order to shorten the detection time and achieve the highest sensitivity, different immune binding times (5 to 15 minutes) were verified. The reaction temperature was 37°C. Figure 1 As shown in the middle panel C, 10 minutes was finally confirmed as the optimal duration for the immune binding reaction.

[0117] S7, excitation solution R3 and R4

[0118] The composition of the stimulating solution R3 in this embodiment is: pH 9.5 phosphate buffer, 0.15M H2O2, preservative (0.25% ), the composition of the stimulating solution R4 in this embodiment is: pH 9.5 phosphate buffer, 0.2M NaOH, preservative (0.25% In order to shorten the detection time and achieve the highest sensitivity, different volumes of immune stimulation solution (50-200 μL) were added to verify the results. Figure 1 As shown in the middle panel D, 100 μL was finally confirmed as the optimal amount of excitation solution R3 / R4 added.

[0119] The specific steps of using the human immunodeficiency virus 1 / 2 antibody chemiluminescent immunoassay assay reagent in this embodiment are as follows:

[0120] 1. Reagent preparation: Take out all reagent components, equilibrate to room temperature and shake to mix.

[0121] 2. Sample immunobinding: Take a 1.5mL clean EP tube, add 100μL of the sample to be tested, add 50μL of extraction reagent R1, shake and mix, and place at 37℃ for 10 minutes.

[0122] 3. Capture of antibodies in the sample to be tested: Place the EP tube on a magnetic bead separation device and magnetically absorb for 1 minute. The magnetic beads can be observed to be adsorbed to the tube wall. At this time, remove all the solution in the tube and retain the magnetic beads.

[0123] 4. First wash: Add 200 μL of washing solution 3 and shake to mix. Place the EP tube on the magnetic bead separation device for 1 min. After the magnetic beads are adsorbed to the tube wall, remove all the solution in the tube and retain the magnetic beads.

[0124] 5. Second wash: Repeat step 4 to remove all liquid in the tube as cleanly as possible.

[0125] 6. Luminescent marker immunoconjugation: Add HIV luminescent reagent R2 (composed of: pH 9.5 phosphate buffer, 50 μg / mL acridinium ester, 5 μg / mL HIV-1 antigen and 5 μg / mL HIV-2 antigen, preservative (0.25%) to the remaining tubes. ))50 μL was shaken to mix, and incubated at 37°C for 10 minutes.

[0126] 7. Purification of unbound markers: Place the EP tube on the magnetic bead separation device again for 1 minute. After the magnetic beads are adsorbed to the tube wall, remove all the solution in the tube and retain the magnetic beads, removing all the liquid in the tube as cleanly as possible.

[0127] 8. Reading: After adding 100 μL of excitation solution R3 to the centrifuge tube, immediately add 100 μL of excitation solution R4 and read the luminescent signal.

[0128] Reading results: In order to avoid the interference of reagents from different batches and human operation errors, the ratio of the luminescent signal of the sample to be tested to the background value (S / CO) is used as the threshold for positive and negative judgment. The details are as follows: if the S / CO result is ≥1, the result report is positive, indicating that the sample to be tested contains HIV antibodies (i.e., HIV-1 antibodies and / or HIV-2 antibodies); if the S / CO result is <1, the result report is negative, indicating that the sample to be tested does not contain HIV antibodies.

[0129] A series of positive standards (concentrations of 100 NCU / mL, 50 NCU / mL, 10 NCU / mL, 5 NCU / mL, 1 NCU / mL, and 0.5 NCU / mL, respectively) obtained by diluting the positive standard with negative serum and a negative control (e.g., negative serum) were subjected to antibody chemiluminescence detection (the specific detection method is as described in Example 1). The detection data and the standard curve were plotted as follows: Figure 2 As shown in the middle AC, it can be seen that the present invention has a good linear range between 0.5-100 NCU / mL when detecting HIV-1 and HIV-2 antibodies.

[0130] S8. Determination of minimum detection limit

[0131] After diluting the positive standard with different concentrations, the lowest detection limit of the kit was determined to be 0.25 NCU / mL. In order to evaluate the performance in real serum or plasma samples, this example also used negative serum to dilute HIV-1 and HIV-2 antibodies to 0.25 NCU / mL for verification. Figure 3 As shown, after adding 0.25 NCU / mL of the two antibodies, S / CO (signal value / background value (i.e., positive value / background value)) is greater than 1, and the report is positive. Therefore, this kit can detect 0.25 NCU / mL of antibodies for real samples, and the coefficient of variation of the signal value CV≤5%, with good precision, meeting market requirements, so this kit has excellent performance in detecting HIV-1 and 2 antibodies.

[0132] Example 2: Comparison of HIV-1 / 2 antibody detection methods

[0133] In order to further evaluate the HIV-1 / 2 antibody detection sensitivity of the kit developed in Example 1, a chemiluminescence-based antibody method reported in domestic patents or literature was selected for performance comparison.

[0134] 4 HIV antibody positive samples (samples 1 to 4) collected from clinics, 2 samples with simulated detection limit concentration (0.25 NCU / mL) (sample 5-HIV type 1 antibody; sample 6-HIV type 2 antibody) and two negative samples from healthy people (samples 7 and 8) were used, and 100 μL of each sample was taken for detection. The comparison method was carried out according to the operation disclosed in the above document 2, and the method of the present invention was carried out according to the operation of the above embodiment 1. The detection results are shown in Table 2 below (the original data is shown in Table 3 below).

[0135] Table 2: HIV antibody test results

[0136]

[0137]

[0138] (“+” indicates detected, “-” indicates not detected)

[0139] Table 3: Antibody test results of 8 samples

[0140]

[0141] From the results shown in Table 2 and Table 3 above, it can be seen that the detection results of positive samples 1-4 and negative samples 7 and 8 are consistent with those of Document 2. For positive samples 5-6, the method of Document 2 did not detect them, but the present invention detected them as positive, indicating that the method of the present invention has a higher sensitivity in detecting HIV 1 / 2 antibodies than the method disclosed in Document 2.

[0142] Example 3: Design of primers and probes for detecting human immunodeficiency virus type 1 and type 2 based on real-time fluorescent nucleic acid isothermal amplification

[0143] The inventors selected the highly conserved region of LTR as the detection segment to design the detection sequence based on the HIV-2 type genomic RNA sequence published in the Genbank database, and designed the primers and probes according to the principle of isothermal amplification.

[0144] The primers and probes specifically for HIV-1 amplification used in this example are described in the published document 3.

[0145] The 5' end of the HIV-1 target detection probe was fluorescently labeled with FAM, and the 3' end was fluorescently labeled with DABCYL.

[0146] The 5' end of the HIV-2 target detection probe was fluorescently labeled with Cy5, and the 3' end was fluorescently labeled with BHQ2.

[0147] In this embodiment, multiple groups of primers and probe cross-combinations were designed for HIV-2 to screen the best primer and probe combination, among which the following three groups of primers and probes with good detection effects on HIV-2 in vitro transcribed RNA and negative control (a system that does not contain HIV-1 / 2 nucleic acid, such as deionized water or sample preservation solution (commercially available)) were selected. These three groups of primers and probes were combined with primers and probes for detecting HIV-1 (see Group 1, Group 2 and Group 3 below) to screen out primer and probe groups with good specificity, sensitivity and repeatability for simultaneous detection of HIV-1 and HIV-2.

[0148] Group 1: HIV-1 detection system sequence is as follows:

[0149] First primer: ACAGTATTCATTCACAATTTTA (SEQ ID NO: 1);

[0150] Second primer:

[0151] AATTTAATACGACTCACTATAGGGAGATTTTGTAATTCTTTAGTTTGTATGTCTG (SEQ ID NO: 2);

[0152] Target detection probe: CCGACGCUCACCACGCUCCAGUCGG (SEQ ID NO: 3);

[0153] The sequence of the HIV-2 detection system is as follows:

[0154] First primer: GACTCTCACCAGCACTTGGC (SEQ ID NO: 4);

[0155] Second primer: AATTTTAATACGACTCACTATAGGGAGAAGGTGAACACCGAATGACCA (SEQ ID NO: 5);

[0156] Target detection probe: CCUGGCCAGCACUUGGCCGGUCCAGG (SEQ ID NO: 6);

[0157] The amplified regions of the first primer and the second primer in the HIV-2 gene RNA detection sequence serve as the HIV-2 LTR gene RNA target sequence, and the target detection probe specifically binds to the amplified product RNA copy of the target sequence (the following Group 2 and Group 3 have the same design).

[0158] Group 2:

[0159] HIV-1 first primer, second primer and target detection probe are the same as group 1 (SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3);

[0160] The sequence of the HIV-2 detection system is as follows:

[0161] First primer: GCCGGTGCTGGGCAGACGGC (SEQ ID NO: 7);

[0162] Second primer: AATTTTAATACGACTCACTATAGGGAGAGTCTTGTTACTCAGGTGAACA

[0163] (SEQ ID NO: 8);

[0164] Target detection probe: CCGACCAGCACUUGGCCGGUCUCGG (SEQ ID NO: 9);

[0165] Group 3:

[0166] HIV-1 first primer, second primer and target detection probe are the same as group 1 (SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3);

[0167] The sequence of the HIV-2 detection system is as follows:

[0168] First primer: CGGTGCTGGGCAGACGGC (SEQ ID NO: 10);

[0169] Second primer: AATTTTAATACGACTCACTATAGGGAGATTGTTACTCAGGTGAACA

[0170] (SEQ ID NO: 11);

[0171] Target detection probe: CCUGGACGCUUGCUUGCUUAACCAGG (SEQ ID NO: 12);

[0172] The positive standard used in this example was prepared as follows:

[0173] 1. The positive standard is HIV-1 and HIV-2 in vitro transcribed template RNA, which can be prepared by a variety of methods, one of which is as follows:

[0174] (a) Gene fragments of HIV-1 (GenBank: NC_001802.1) and HIV-2 (GenBank: X05291.1) were synthesized by chemical synthesis;

[0175] (b) Each gene fragment synthesized in step (a) is cloned into In the vector, construct the respective positive plasmid;

[0176] (c) Each positive plasmid was transformed into Escherichia coli DH5α and named and strains, stored at -70°C;

[0177] (d) From and Plasmids were extracted from the strains, and the extracted plasmids were subjected to RNA purification to remove DNA, and the in vitro transcribed RNA was quantified and identified. The RNA concentration was analyzed using a NanoDrop 2000 spectrophotometer, and an OD260 value between 1.8 and 2.0 indicated good RNA purity;

[0178] (e) High concentration standards of HIV-1 and HIV-2 gene transcript RNA were quantified by UV spectrophotometer and used as positive standards.

[0179] The three sets of primers and probes (set 1, set 2, and set 3) were used to dilute the positive standard with DEPC-treated water to obtain a series of positive standards (the concentrations of HIV-1 and HIV-2 were 2.5×10 4 copies / μL, 2.5×10 3 copies / μL, 2.5×10 2 The real-time fluorescent nucleic acid isothermal amplification detection was performed with 200 μL of diluted RNA (copies / μL, 25 copies / μL, 2.5 copies / μL) and diluent (DEPC-treated water) (the specific detection method is as described in the "SAT amplification detection procedure" in Example 4 below, that is, 2 μL of the diluted RNA was directly added to 40 μL of amplification detection solution, and the subsequent operation was performed after mixing). The results are shown in Figure 2. Figure 4 As shown, AB is the real-time fluorescence nucleic acid isothermal amplification detection curve of primers and probes of group 1 for HIV-1 and HIV-2, CD is the real-time fluorescence nucleic acid isothermal amplification detection curve of primers and probes of group 2 for HIV-1 and HIV-2, and EF is the real-time fluorescence nucleic acid isothermal amplification detection curve of primers and probes of group 3 for HIV-1 and HIV-2. Figure 4As shown in the amplification detection curve, the primer and probe combination of group 2 can at least detect HIV-1 and HIV-2 positive standards with a concentration of 2.5 copies / μL, and has a higher relative fluorescence intensity; while the primer and probe combination of group 1 can only detect HIV-2 positive standards with a concentration of 25 copies / μL and HIV-1 positive standards with a concentration of 2.5 copies / μL. Although the primer and probe combination of group 3 can also detect HIV-1 positive standards and HIV-2 positive standards with a concentration of 2.5 copies / μL, the relative fluorescence intensity of its detection is low, the starting point is significantly late, and it is easily interfered by the negative control background signal, resulting in misjudgment.

[0180] In order to further evaluate the sensitivity of the above three sets of primers and probes for nucleic acid detection of HIV1 / 2, the above three sets of primers and probes were used to detect the same 10 HIV-1 and HIV-2 samples (positive standard with a concentration of 2.5 copies / μL), and the detection rate results are shown in Table 4. It can be seen that the detection rates of HIV-1 and HIV-2 of the primer and probe combination of group 2 are both 100%, and at least 2.5 copies / μL of HIV-1 or HIV-2 positive specimens can be stably detected, while the detection rates of HIV-1 and HIV-2 of the primer and probe combination of group 1 are 90% and 30%, respectively, and the detection rates of HIV-1 and HIV-2 of the primer and probe combination of group 3 are 90% and 80%, respectively, and neither can stably detect the positive standard with a concentration of 2.5 copies / μL.

[0181] Note: The system in Example 2 does not involve sample extraction, and the sample template usage is 2 μL, which can be detected to 2.5 copies / μL, so the non-final detection limit is 5 copies / reaction; the volume in Example 4 is all extracted, and the sample usage is 250 μL, which can be detected to at least 20 copies / mL. The converted detection limit is 5 copies / reaction, which is consistent.

[0182] Table 4: Detection rate results of three sets of primers and probe combinations for HIV positive standards with a concentration of 2.5 copies / μL

[0183]

[0184] Note: "+" in the table indicates detection, "-" indicates non-detection;

[0185] The above results indicate that only the specific primer-probe combination in Group 2 enables stable and highly sensitive detection of HIV-1 and HIV-2 nucleic acids, and can detect at least a positive standard with a concentration of 2.5 copies / μL. Therefore, the primers and probes shown in Group 2 are determined for real-time fluorescent nucleic acid isothermal amplification detection of HIV-1 / 2.

[0186] Example 4: Design of HIV-1 and HIV-2 specific capture probe combinations

[0187] Furthermore, this embodiment designs multiple groups of target-specific capture probes for specifically capturing target fragments from samples, selects the following two groups of capture probe combinations for HIV-1 and HIV-2 for further detection verification, and screens out capture probe groups with good sensitivity and specificity for specific extraction of HIV-1 and HIV-2 nucleic acids, and combines them with the primers and detection probes of group 2 determined in Example 3 for detection.

[0188] Group 4:

[0189] HIV-1 Capture Probe:

[0190] CTGGCCATCTTCCTGCTAATTTTAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA(SEQ ID NO:13)

[0191] HIV-2 Capture Probe:

[0192] ACCCTCCAAGAGAGGTCGTGATCGTCCATCAAAAAAAAAAAAAAAAAAAAAAAA A(SEQ ID NO:14)

[0193] Group 5:

[0194] HIV-1 Capture Probe:

[0195] Capture probe of group 4 (SEQ ID NO: 13)

[0196] HIV-2 Capture Probe:

[0197] TCTCCGACCGTCTAACTCGGGACCCTCCAAGAGAAAAAAAAAAAAAAAAAAAAAAAAA(SEQ IDNO:15)

[0198] The positive standard used in this example is described in Example 3.

[0199] The operating steps of the detection method in this embodiment are as follows:

[0200] Preparation of reference substances:

[0201] Take 250 μL of positive control, 250 μL of negative control and 250 μL of the sample to be tested and place them in sample processing tubes for later use;

[0202] Nucleic acid extraction:

[0203] (1) Add 200 μL of nucleic acid extraction solution to the sample processing tube: HEPES 500 mM, LLS 8%, 25 μM of the specific capture probe corresponding to the detection gene (SEQ ID NO: 13; SEQ ID NO: 15 (Group 5) or SEQ ID NO: 13; SEQ ID NO: 14 (Group 4)), 150 mg / L of magnetic beads, and 10 μM of the second primer corresponding to the detection gene (SEQ ID NO: 2; SEQ ID NO: 8), and mix well. Incubate at 60°C for 10 minutes and place at room temperature for 5 to 10 minutes;

[0204] (2) Place the sample processing tube on the magnetic bead separation device and let it stand for 2-5 minutes. After the magnetic beads are adsorbed to the tube wall, keep the sample processing tube on the magnetic bead separation device, discard the liquid, and retain the magnetic beads. Add 1mL of washing solution (HEPES25mM, NaCl150mM, 1% SDS, EDTA 2.5mM), shake evenly, let it stand for 2-5 minutes, discard the liquid, retain the magnetic beads, then add 600μL of washing solution and 150μL of mineral oil, shake evenly, let it stand for 2-5 minutes, discard the liquid, and retain the magnetic beads;

[0205] (3) The sample processing tube is removed from the magnetic bead separation device, and the magnetic bead-nucleic acid complex in the tube is set aside.

[0206] SAT amplification test:

[0207] (1) Add 40 μL of amplification detection solution (Tris 15 mM, MgCl2 15 mM, dNTP 2.5 mM, NTP 3 mM, PVP40 1%, KCl 10 mM, 300 pmol / mL of the first primer (SEQ ID NO: 1; SEQ ID NO: 7), 200 pmol / mL of the second primer (SEQ ID NO: 2; SEQ ID NO: 8), and 200 pmol / mL of the target detection probe (SEQ ID NO: 3; SEQ ID NO: 9) to each sample processing tube, and oscillate to resuspend the magnetic beads;

[0208] (2) Add 50 μL of mineral oil to each reaction tube and incubate at 42°C for 5-10 min.

[0209] (3) Add 10 μL of SAT enzyme solution (preheated at 42°C, containing 60,000 U / mL M-MLV reverse transcriptase, 40,000 U / mL T7 RNA polymerase, 10 mM HEPES pH 7.5, 15 mM N-acetyl-L-cysteine, 0.15 mM zinc acetate, 20 mM trehalose, 100 mM Tris-HCl pH 8.0, 80 mM KCl, 0.25 mM EDTA, 0.5% (v / v) Triton X-100 and 30% (v / v) glycerol) to a micro reaction tube and incubate at 42°C for 5-10 min.

[0210] (4) The reaction tube was quickly transferred to a constant temperature fluorescence detection instrument and reacted at 42°C for 40 minutes. The fluorescence was detected once every 1 minute for a total of 40 times. The FAM and Cy5 channels were selected as the fluorescence channels.

[0211] Result judgment:

[0212] According to the curve obtained by SAT amplification results, read the dt value (indicating the horizontal axis reading (cycle number) corresponding to the intersection of the amplification curve of the sample to be tested and the threshold line, which is automatically read and determined by the software) to determine the result.

[0213] The result judgment criteria are:

[0214] If dt≤38 in the FAM channel, the sample is positive, which means that the sample contains HIV-1 nucleic acid;

[0215] If dt≤38 in the Cy5 channel, the sample is positive, which means that the sample contains HIV-2 nucleic acid;

[0216] If dt>38 in FAM channel or Cy5 channel, the sample is negative, that is, the sample does not contain HIV-1 / 2 nucleic acid.

[0217] The above-mentioned group 4 + group 2 and group 5 + group 2 were used to dilute the positive standard with DEPC-treated water to obtain a series of positive standards (the concentrations of HIV-1 and HIV-2 were 2×10 5 copies / mL, 2×10 4 copies / mL, 2×10 3 copies / mL, 2×10 2 The real-time fluorescence nucleic acid isothermal amplification detection was performed on 200 μl of 100 μl of water (copies / mL, 20 copies / mL) and negative control (DEPC treated water) (the specific detection method is as described in this example). The results are as follows Figure 5As shown, AB is the real-time fluorescence nucleic acid constant temperature amplification detection curve of group 4 + group 2 for HIV-1 and HIV-2, and CD is the real-time fluorescence nucleic acid constant temperature amplification detection curve of group 5 + group 2 for HIV-1 and HIV-2. Figure 5 As far as we know, the capture probes of group 4 have a significant effect on HIV-1 capture, and its combination with group 2 can only detect a concentration of 2×10 2 The capture probes of group 5 have good capture effects, and the combination of group 5 and group 2 can detect HIV-1 positive standards and HIV-2 positive standards with a concentration of 20 copies / mL;

[0218] The above results indicate that only the specific target capture probes in Group 5 combined with the specific primers and detection probes in Group 2 can simultaneously detect HIV-1 and HIV-2 nucleic acids with high sensitivity, and can detect at least a positive standard with a concentration of 20 copies / mL. Therefore, the capture probes shown in Group 5 are determined to be used for the extraction and capture of specific target nucleic acids for HIV-1 / 2.

[0219] The positive control A1 and positive control A2 were diluted in series with DEPC-treated water to obtain a series of positive standards (concentrations of 5×10 7 copies / mL, 5×10 6 copies / mL, 5×10 5 copies / mL, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 The relationship between the standard test result dt value and the standard concentration is shown in Table 3. The standard nucleic acid test result dt value is X value, and the standard concentration is Y value. A linear regression is performed to obtain the following result: Figure 6 and Figure 7 The amplification curves (A) and standard curves (B) for HIV-1 and HIV-2 are shown, respectively, and the viral nucleic acid concentration of the sample to be tested is determined based on them.

[0220] Table 5: Standard curve concentration and test result dt value

[0221]

[0222]

[0223] Example 5: Comparison of HIV-1 / 2 Nucleic Acid Constant Temperature Amplification Detection Methods

[0224] In order to further evaluate the HIV-1 / 2 nucleic acid detection sensitivity of the kit developed in Example 4 above, a nucleic acid isothermal amplification method reported in domestic patents or literature was selected for performance comparison:

[0225] The sequence of the RT-RAA detection system disclosed in patent document CN112795699A (Document 4) is as follows:

[0226] Upstream primer: 5'-TACAAATGGCAGTATTYATYCACAATTTTAA-3' (SEQ ID NO: 16)

[0227] Downstream primer: 5'-TCTCTGCTGTCYCTGTAATAAACCCGRAAAT-3' (SEQ ID NO: 17)

[0228] Probe sequence:

[0229] 5'-GATTGGGGGGTACAGTGCAGGGGAAAGAATARTAGAYATAATAGCAAC-3'(SEQ ID NO:18)

[0230] Patent document CN117701769A (also referred to as document 7 herein) discloses RPA-CRISPER / cas12a method detection, the sequence is as follows:

[0231] LTR-Primer 1: CATATAAGCAGCTGCTTTTTGCCTGTACTGGGT' (SEQ ID NO: 19)

[0232] LTR-Primer 2: CCCTGTTCGGGCGCCACTGCTAGAGATTTT' (SEQ ID NO: 20)

[0233] crRNA:UAAUUUCUACUAAGUGUAGAUUUGAGGCUUAAGCAGUGGGU'(SEQ ID NO:21)

[0234] ssDNA reporter:FAM-TTTTTTT-BHQ'(SEQ ID NO:22)

[0235] Using three HIV-1 positive samples (samples 1, 2, and 3) collected clinically, one HIV-2 whole genome simulation sample (sample 4), and two samples from healthy people (samples 5 and 6), 250 μL of the sample to be tested was extracted for nucleic acid, and the primer probe combination shown in Group 2 of Example 3 and the capture probe of Group 5 of Example 4 (as the method of the present invention) were used for detection, and the detection amplification curve was shown in the figure below. Figure 8 As shown in the middle AB, it can be seen that the FAM channel can detect samples 1-3 (all HIV-1 positive samples), the Cy5 channel can detect sample 4 (HIV-2 positive sample), and the RT-RAA and RPA-CRISPER / cas12a methods are performed according to the operations disclosed in the above-mentioned documents 4 and 7. The results are shown in Table 6 below.

[0236] Table 6: HIV nucleic acid test results

[0237]

[0238] (“+” indicates detected, “-” indicates not detected)

[0239] From the results shown in Table 6 above, it can be seen that the detection results of the method of the present invention for 4 positive specimens and 2 negative specimens are 100% consistent with the clinical results. The RT-RAA and RPA-CRISPER / cas12a methods disclosed in Documents 4 and 7 can only detect positive samples 1 and 2, and samples 3 and 4 are both negative, and both healthy samples are negative. Among them, positive sample 3 is a clinically low-concentration HIV-1 sample, and positive sample 4 is an HIV-2 simulation sample. It shows that compared with the RT-RAA and RPA-CRISPER / cas12a methods for isothermal amplification detection of HIV disclosed in Documents 4 and 7, the method of the present invention can simultaneously detect and distinguish HIV-1 and HIV-2 samples, and has a higher detection sensitivity.

[0240] Example 6: Combined detection of HIV-1 / 2 antibodies and nucleic acids based on fully automatic detection and analysis instrument

[0241] The fully automatic detection and analysis instrument or analysis system for combined detection of HIV-1 / 2 antibodies and nucleic acids provided in this embodiment is obtained by the following modifications based on the automated nucleic acid sample preparation, detection and analysis system disclosed in the patent application of the applicant (CN111699242A, also referred to as Document 8 herein, the entire contents of which are incorporated herein):

[0242] 1. The modified fully automatic detection system includes two incubators for heating. In this embodiment, the incubator 114 in the system of document 8 is not modified. The specific modification is to modify the incubator 114 in the system of document 8. Figure 1 In the middle 118, i.e., the "sample processing tube cooling rack", one of the sample processing tube cooling racks (in this embodiment, Figure 1 The sample processing tube cooling rack near the position of 114 "incubator" in the reference is changed to an incubator. The newly added incubator is the same as that in reference 8. Figure 1The structure and composition of 114 are the same. In this embodiment, this module can provide a temperature condition of 37° C., which is used to provide an adaptive temperature environment during the antibody detection process.

[0243] 2. In the modified fully automatic detection system, the signal detection for antibodies and nucleic acids is composed of an antibody detection module and a fluorometer, respectively. Figure 1 The antibody detection module is mainly composed of a photomultiplier tube (PMT) photon signal acquisition device. In this embodiment, the specific changes are to the reference 8. Figure 1 In the middle 130, i.e. the "pipette tip container" position, the three pipette tip containers on the right side close to the fluorometer are removed and transformed into an antibody detection module, which is used for generating and collecting signals in antibody detection.

[0244] The modified fully automatic detection and analysis system includes two incubators, one of which is used to generate a heating temperature of 37±1°C (e.g., 36°C, 36.5°C, 37°C, 37.5°C, or 38°C), and the other is used to generate a heating temperature of 60±1°C (e.g., 59°C, 59.5°C, 60°C, 60.5°C, or 61°C). In the modified fully automatic detection and analysis system, signal collection for antibody detection is completed by an antibody detection module, wherein the antibody detection module is used to generate and receive chemiluminescent signals; signal collection for nucleic acid detection is completed by a fluorometer, wherein the fluorometer is used to collect the fluorescent signal generated by nucleic acid amplification in real time; optionally, the temperature of the fluorometer is set to 42±1°C (e.g., 41°C, 41.5°C, 42°C, 42.5°C, or 43°C), and different fluorescent signals can be collected in real time, including FAM, HEX, ROX, Cy5, etc.

[0245] Using the fully automatic detection and analysis instrument or analysis system provided by the present invention, the antibody and nucleic acid detection process for a single specimen is as follows:

[0246] 1. Pipette 50 μL of antibody capture reagent (extraction reagent R1) and add it to sample processing tube 1;

[0247] 2. Pipette 100 μL of the sample to be tested, positive control and negative control respectively and add them into sample processing tube 1;

[0248] 3. Move the sample processing tube 1 to the vibrator (used to shake and mix the sample processing tube), and shake and mix;

[0249] 4. Move the sample processing tube 1 to a 37°C incubator (for incubating the sample processing tube) and react for 10 minutes;

[0250] 5. Pipette 200 μL of nucleic acid extraction reagent (HIV nucleic acid extraction solution) and add it to sample processing tube 2;

[0251] 6. Pipette 250 μL of the sample to be tested, positive control and negative control respectively and add them into sample processing tube 2;

[0252] 7. Move the sample processing tube 2 to the vibrator and shake to mix;

[0253] 8. Move the sample processing tube 2 to a 60°C incubator and react for 10 minutes;

[0254] 9. Place the sample processing tube 1 in the nucleic acid separation system (for adsorption and cleaning of magnetic particles), absorb the magnet for 1 minute, and remove all the solution in the tube;

[0255] 10. Move sample processing tube 1 to the cooling rack and add 200 μL of washing solution 3;

[0256] 11. Move sample processing tube 1 to the vibrator and shake to mix;

[0257] 12. Place the sample processing tube 1 in the nucleic acid separation system, and absorb the magnet for 1 minute to remove all the solution in the tube;

[0258] 13. Move sample processing tube 1 to the cooling rack and add 200 μL of washing solution 3;

[0259] 14. Move sample processing tube 1 to the vibrator and shake to mix;

[0260] 15. Place the sample processing tube 1 in the nucleic acid separation system, and absorb the magnet for 1 minute to remove all the solution in the tube;

[0261] 16. Move sample processing tube 1 to the cooling rack and add 50 μL of luminescent reagent R2;

[0262] 17. Move sample processing tube 1 to the vibrator and shake to mix;

[0263] 18. Move the sample processing tube 1 to a 37°C incubator and react for 10 minutes;

[0264] 19. Move sample processing tube 2 to a cooling rack and keep it there for 10 minutes;

[0265] 20. Place the sample processing tube 1 in the nucleic acid separation system, and absorb the magnet for 1 minute to remove all the solution in the tube;

[0266] 21. Move the sample processing tube 1 to the cooling rack and add 100 μL of excitation solution 3;

[0267] 22. Move sample processing tube 1 to the vibrator and shake to mix;

[0268] 23. Move the sample processing tube 1 to the antibody detection module and add 100 μL of the excitation solution 4;

[0269] 24. Collect the luminescent signal. The software calculates the positive and negative judgment threshold based on the ratio of the luminescent signal to the background value (S / CO), and automatically determines whether the antibody is negative or positive.

[0270] 25. Place the sample processing tube 2 in the nucleic acid separation system, and absorb the magnet for 3 minutes to remove all the solution in the tube;

[0271] 26. Move sample processing tube 2 to the cooling rack and add 600 μL of washing solution 1;

[0272] 27. Move sample processing tube 2 to the vibrator and shake to mix;

[0273] 28. Place the sample processing tube 2 in the nucleic acid separation system and absorb the magnet for 3 minutes to remove all the solution in the tube;

[0274] 29. Move sample processing tube 2 to the cooling rack and add 600 μL of washing solution 1 and 150 μL of washing solution 2;

[0275] 30. Move sample processing tube 2 to the vibrator and shake to mix;

[0276] 31. Place the sample processing tube 2 in the nucleic acid separation system and absorb the magnet for 3 minutes to remove all the solution in the tube;

[0277] 32. Move sample processing tube 2 to the cooling rack and add 40 μL amplification detection solution;

[0278] 33. Move sample processing tube 2 to the vibrator and shake to mix;

[0279] 34. Move the sample processing tube 2 to a 60°C incubator and react for 10 minutes;

[0280] 35. Move sample processing tube 2 to the fluorometer and keep it there for 5 minutes;

[0281] 36. Add 10 μL SAT enzyme solution;

[0282] 37. Maintain for 40 minutes, collecting fluorescence signals once every minute;

[0283] 38. The software automatically determines whether the nucleic acid of the sample is negative or positive based on the dt value of the positive control, negative control and the amplification curve of the sample.

[0284] 39. Check the antibody and nucleic acid test results of the sample to be tested on the software result display interface.

[0285] It should be noted that the detection system can flexibly combine the detection modes of antibodies or nucleic acids of samples, that is, it can be set to detect only antibodies of samples, or only nucleic acids of samples, or both antibodies and nucleic acids of samples.

[0286] The HIV1 / 2 antibody and nucleic acid detection kit established and verified in Examples 1-2 and Examples 3-5 was further used. Based on the fully automatic detection and analysis instrument of this embodiment, 50 clinically derived or simulated samples with antibody and nucleic acid test results were subjected to combined antibody and nucleic acid detection using the kit of the present invention. The results are shown in Table 7 below.

[0287] Table 7: Statistics of antibody and nucleic acid combined test results for 50 samples

[0288]

[0289] (“+” indicates detected, “-” indicates not detected)

[0290] Explanation of the test results in this example: Sample No. 1 is HIV-1 infected (both antibodies and nucleic acids are positive), Sample No. 2 is HIV-1 infected (nucleic acid is positive), and Samples No. 3 to No. 47 and No. 50 are all negative for HIV antibodies and nucleic acids. Sample No. 48 is HIV-2 infected (both antibodies and nucleic acids are positive), and Sample No. 49 is HIV-2 infected (nucleic acid positive). All samples with positive nucleic acid test results were compared and confirmed by Sanger sequencing, and all were HIV-1 or HIV-2 after sequence alignment.

[0291] In summary, the detection results of this detection system for 50 samples were consistent with the clinical diagnosis results, with a positive consistency rate of 100% and a negative consistency rate of 100%, which proves that the detection results of this kit and detection system have good specificity and accuracy, and can timely and efficiently jointly detect HIV antibody and nucleic acid levels in a single sample.

[0292] Example 7: Preparation of a kit for combined detection of HIV-1 / 2 antibodies and nucleic acids

[0293] The kits for HIV-1 / 2 antibody and nucleic acid detection provided in this embodiment are respectively based on the RNA nucleic acid constant temperature synchronous amplification detection principle to detect HIV-1pol gene RNA and HIV-2LTR gene RNA, and the kits for detecting HIV-1 / 2 antibodies using the double antigen sandwich chemiluminescence principle, and specifically include the following components:

[0294] (1) Viral nucleic acid extract: containing 250-800 mM HEPES, 4-10% LLS, 1-50 μM capture probe (SEQ ID NO: 13, SEQ ID NO: 15), 50-500 mg / L magnetic beads, and 200-800 pmol / mL of the second primer corresponding to the detection gene (SEQ ID NO: 2; SEQ ID NO: 8);

[0295] (2) Washing solution 1: an aqueous solution containing 5-50 mM HEPES, 50-500 mM NaCl, 0.5-2% SDS, and 1-10 mM EDTA;

[0296] (3) Washing liquid 2: mineral oil;

[0297] (4) Amplification detection solution: containing 10-50 mM Tris, 10-40 mM MgCl2, 0.1-10 mM dNTP, 1-20 mM NTP, 1-10% PVP40, 5-40 mM KCl, 200-800 pmol / mL of the first primer (SEQ ID NO: 1; SEQ ID NO: 7), 200-800 pmol / mL of the second primer (SEQ ID NO: 2; SEQ ID NO: 8), and 200-900 pmol / mL of the target detection probe (SEQ ID NO: 3; SEQ ID NO: 9);

[0298] (5) SAT enzyme solution: a multi-enzyme reaction system required for SAT amplification, mainly containing 16000-160000 U / mL of M-MLV reverse transcriptase and 8000-80000 U / mL of RNA polymerase, specifically including: 16000-160000 U / mL of M-MLV reverse transcriptase, 8000-80000 U / mL of RNA polymerase, 2-10 mM HEPES pH7.5, 10-100 mM N-acetyl-L-cysteine, 0.04-0.4 mM zinc acetate, 10-100 mM trehalose, 40-200 mM Tris-HCl pH 8.0, 40-200 mM KCl, 0.01-0.5 mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol;

[0299] (6) Extraction reagent R1: It is used to specifically capture HIV antibodies in the sample and purify the target antibodies in the sample; its components include: pH 9.0-9.5 phosphate buffer, 0.5-1.5 mg / mL immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen (particle size 0.9-1.8 μm), preservatives (0.1-0.5%) ), optionally, on the immunomagnetic beads coated with HIV-1 and HIV-2 antigens, the coating amount ratio of HIV-1 and HIV-2 antigens is 1:0.75-1.5, and the concentration ratio of the total coating amount of HIV-1 and HIV-2 antigens to the amount of immunomagnetic beads is 1:75-125;

[0300] (7) Washing solution 3: phosphate buffer containing 0.01-0.1% (v / v) Tween20, specifically: 0.01-0.1% (v / v) Tween20, 1-10 mM Na2HPO4, 1-5 mM KH2PO4;

[0301] (8) Luminescent reagent R2: It is a luminescent marker that immunologically binds to HIV antibodies in the sample; its components include: pH 9.0-9.5 phosphate buffer, 10-100 μg / mL acridinium ester, 1-10 μg / mL HIV-1 and 1-10 μg / mL HIV-2 antigens, preservative (0.1-0.5% );

[0302] (9) Excitation solution R3: It is the key substrate required for the chemical reaction of the marker; its components include: pH 9.0-9.5 phosphate buffer, 0.01-1M H2O2, preservative (0.1-0.5%) );

[0303] (10) Excitation solution R4: It provides the conditions required for chemiluminescence or assists in the chemical reaction of the excitation solution R3; its components include: pH 9.0-9.5 phosphate buffer, 0.1-0.5M NaOH, preservative (0.1-0.5% );

[0304] In order to facilitate detection, the kit provided in this embodiment also includes the following components:

[0305] (11) Positive control A1: containing a dilution of HIV-1 pol gene RNA fragment;

[0306] (12) Positive control A2: dilution of HIV-2 LTR gene RNA fragment;

[0307] (13) Positive control B1: serum or plasma solution containing HIV-1 antibodies;

[0308] (14) Positive control B2: serum or plasma solution containing HIV-2 type antibodies;

[0309] (15) Negative control A3: a system without HIV-1 and HIV-2 target nucleic acid sequences or without HIV-1 and HIV-2 nucleic acids;

[0310] (16) Negative control B3: human serum or plasma solution that does not contain any HIV-specific antibodies or is not infected with HIV virus.

[0311] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall belong to the content of the present invention.

Claims

1. A kit for the combined detection of HIV-1 and HIV-2 antibodies and nucleic acids, characterized in that: The kit comprises: (1) Amplification detection solution: comprising a first primer, a second primer and a target detection probe for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the first primer cooperates with the second primer to amplify the target sequence, and the target detection probe specifically binds to the RNA copy of the amplified product of the target; The nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-1 nucleic acid are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-2 nucleic acid are shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively; (2) SAT enzyme solution: comprising at least one RNA polymerase and M-MLV reverse transcriptase; (3) Extraction reagent R1: used to specifically capture HIV antibodies in the sample and purify and separate the target antibodies in the sample; (4) Luminescent reagent R2: a luminescent marker that immunologically binds to HIV antibodies in the sample; (5) Excitation solution R3: It is the key substrate required for the luminescent marker to carry out chemical reactions; (6) Excitation liquid R4: It provides the conditions required for chemiluminescence or assists in the chemical reaction of the excitation liquid R3.

2. The kit according to claim 1, characterized in that The kit also includes: (7) HIV nucleic acid extract: comprising a solid support containing capture probes for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the capture probes are used to capture the detection sequence; optionally, the HIV nucleic acid extract further comprises the second primers for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively; further optionally, the components of the HIV nucleic acid extract include: HEPES 250-800mM, LLS 4-10%, 1-50μΜ of each capture probe for HIV-1 nucleic acid and HIV-2 nucleic acid, 50-500mg / L of magnetic beads, and 200-800pmol / mL of the second primer; The nucleotide sequence of the capture probe for HIV-1 nucleic acid is shown in SEQ ID NO: 13, and the nucleotide sequence of the capture probe for HIV-2 nucleic acid is shown in SEQ ID NO: 15; Optionally, the kit further comprises a washing solution, which is used to wash the magnetic beads in the process of antibody or nucleic acid capture, purification and extraction; further optionally, the washing solution comprises washing solutions 1-3, The components of the washing solution 1 include: 5-50 mM HEPES, 50-500 mM NaCl, 0.5-2% SDS, 1-10 mM EDTA; The components of the washing liquid 2 include: mineral oil; and / or the components of the washing solution 3 include: 0.01-0.1% (v / v) Tween20, 1-10mM Na2HPO4, 1-5mM KH2PO4; Further optionally, the kit further comprises one or more of the following: (8) Positive control A1: It contains the HIV-1 pol gene nucleic acid fragment; (9) Positive control A2: It contains the HIV-2 LTR gene nucleic acid fragment; (10) Positive control B1: contains HIV-1 antibodies; (11) Positive control B2: contains HIV-2 antibodies; (12) Negative control A3: It does not contain HIV-1 and HIV-2 nucleic acid; and (13) Negative control B3: It does not contain HIV-1 and HIV-2 antibodies.

3. The kit according to claim 1 or 2, characterized in that The principle of the chemiluminescence is a direct chemiluminescence technique based on acridinium ester.

4. The kit according to any one of claims 1 to 3, characterized in that The components of the amplification detection solution include: 10-50mM Tris, 10-40mM MgCl2, 0.1-10mM dNTP, 1-20mM NTP, 1-10% PVP40, 5-40mM KCl, 200-800pmol / mL of the second primer, 200-800pmol / mL of the first primer and 200-900pmol / mL of the target detection probe; The components of the SAT enzyme solution include: 16000-160000U / mL of M-MLV reverse transcriptase, 8000-80000U / mL of RNA polymerase, 2-10mM HEPES pH7.5, 10-100mM N-acetyl-L-cysteine, 0.04-0.4mM zinc acetate, 10-100mM trehalose, 40-200mM Tris-HCl pH 8.0, 40-200mM KCl, 0.01-0.5mM EDTA, 0.1-1% (v / v) Triton X-100 and 20-50% (v / v) glycerol; The components of the extraction reagent R1 include: pH 9.0-9.5 phosphate buffer, 0.5-1.5 mg / mL immunomagnetic beads (particle size 0.9-1.8 μm) coated with HIV-1 antigen and HIV-2 antigen, and a preservative (0.1-0.5% ), optionally, on the immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen, the coating amount ratio of HIV-1 antigen and HIV-2 antigen is 1:075-1.5, and the concentration ratio of the total coating amount of HIV-1 antigen and HIV-2 antigen to the amount of immunomagnetic beads is 1:75-125 (μg / mL:mg / mL); The components of the luminescent reagent R2 include: pH 9.0-9.5 phosphate buffer, 10-100 μg / mL acridinium ester, 1-10 μg / mL HIV-1 and 1-10 μg / mL HIV-2 antigens, preservatives (0.1-0.5% ); The components of the stimulating solution R3 include: pH 9.0-9.5 phosphate buffer, 0.01-1M H2O2, preservative (0.1-0.5% ); The components of the stimulating solution R4 include: pH 9.0-9.5 phosphate buffer, 0.1-0.5M NaOH, preservative (0.1-0.5% ).

5. The kit according to any one of claims 1 to 4, characterized in that Using the kit to detect HIV-1 / 2 nucleic acid includes the following steps: 1) Optionally, adding a nucleic acid extraction solution to the sample to extract nucleic acid to obtain an analytical test sample; 2) adding an amplification detection solution to the analysis and detection sample obtained in step 1) or directly to the nucleic acid sample to be detected to perform a first step reaction to obtain a first step reaction solution; 3) adding SAT enzyme solution to the first step reaction solution to carry out the second step reaction to obtain the second step reaction solution; and simultaneously carrying out real-time fluorescence detection to obtain the dt value of the real-time fluorescence detection; 4) Determine the result based on the dt value obtained in step 3): If the dt of the fluorescence channel corresponding to HIV-1 is ≤ 38, the sample is positive, that is, the sample contains HIV-1 nucleic acid; If the dt of the fluorescence channel corresponding to HIV-2 is ≤ 38, the sample is positive, that is, the sample contains HIV-2 nucleic acid; If the dt of the fluorescence channel corresponding to HIV-1 or HIV-2 is > 38, the sample is negative, i.e., the sample does not contain HIV-1 / 2 nucleic acid; and / or Using the kit to detect HIV-1 / 2 antibodies includes the following steps: 1') adding extraction reagent R1 to the sample for antibody capture, and obtaining an analysis and detection sample after washing; 2') adding the luminescent reagent R2 to the analysis and detection sample obtained in step 1') to carry out the first step reaction to obtain the first step reaction solution; 3') adding the excitation solutions R3 and R4 to the first step reaction solution to carry out the second step reaction to obtain the second step reaction solution; and simultaneously carrying out chemical signal detection to obtain the relative luminescence signal value; 4') determining the result according to the S / CO value obtained in step 3'); If S / CO is less than 1, the sample does not contain HIV antibodies; if S / CO is greater than or equal to 1, the sample contains HIV antibodies.

6. A real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneous detection of HIV-1 and HIV-2 nucleic acids, characterized in that: include: (1') an amplification detection solution: comprising a first primer, a second primer and a target detection probe for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the first primer cooperates with the second primer to amplify the target sequence, and the target detection probe specifically binds to the RNA copy of the amplified product of the target; The nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-1 nucleic acid are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the nucleotide sequences of the first primer, the second primer and the target detection probe for HIV-2 nucleic acid are shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively; (2') SAT enzyme solution: comprising at least one RNA polymerase and M-MLV reverse transcriptase; Optionally, the real-time fluorescent nucleic acid isothermal amplification detection kit further comprises: (3') HIV nucleic acid extract: comprising a solid support containing capture probes for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively, wherein the capture probes are used to capture the detection sequence; optionally, the HIV nucleic acid extract further comprises the second primers for HIV-1 nucleic acid and HIV-2 nucleic acid, respectively; The nucleotide sequence of the capture probe for HIV-1 nucleic acid is shown in SEQ ID NO:13, and the nucleotide sequence of the capture probe for HIV-2 nucleic acid is shown in SEQ ID NO:

15.

7. A kit for detecting HIV-1 and HIV-2 antibodies, characterized in that: include: (1”) Extraction reagent R1: used to specifically capture HIV antibodies in the sample and purify and separate the target antibodies in the sample; Its components include: pH 9.0-9.5 phosphate buffer, 0.5-1.5 mg / mL immunomagnetic beads (particle size 0.9-1.8 μm) coated with HIV-1 antigen and HIV-2 antigen, preservative (0.1-0.5% ), optionally, on the immunomagnetic beads coated with HIV-1 antigen and HIV-2 antigen, the coating amount ratio of HIV-1 antigen and HIV-2 antigen is 1:075-1.5, and the concentration ratio of the total coating amount of HIV-1 antigen and HIV-2 antigen to the amount of immunomagnetic beads is 1:75-125 (μg / mL:mg / mL); (2”) Luminescent reagent R2: It is a luminescent marker that immunologically binds to HIV antibodies in the sample; its components include: pH 9.0-9.5 phosphate buffer, 10-100 μg / mL acridinium ester, 1-10 μg / mL HIV-1 and 1-10 μg / mL HIV-2 antigens, preservative (0.1-0.5% 300); (3”) Excitation solution R3: It is the key substrate required for the chemical reaction of the marker; its components include: pH 9.0-9.5 phosphate buffer, 0.01-1M H2O2, preservative (0.1-0.5%) 300); (4") Excitation solution R4: It provides the conditions required for chemiluminescence or assists in the chemical reaction of the excitation solution R3; its components include: pH 9.0-9.5 phosphate buffer, 0.1-0.5M NaOH, preservative (0.1-0.5% 300).

8. A fully automatic detection and analysis system for combined detection of HIV-1 / 2 antibodies and nucleic acids, characterized in that: The fully automatic detection and analysis system is obtained by performing the following modifications on the automated nucleic acid sample preparation, detection and analysis system disclosed in patent document CN111699242A: a. One of the two sample processing cooling racks (118) between the sample processing tube rack (106) and the incubator (114) in FIG. 1 of patent document CN111699242A is converted into an incubator (114), and the sample processing cooling rack (118) close to the incubator (114) can be optionally converted into an incubator (114); b. Three pipette tip containers (130) close to the fluorometer (120) in FIG. 1 of patent document CN111699242A are converted into an antibody detection module, which is used for generating and collecting signals in antibody detection and is mainly composed of a photomultiplier tube (PMT) photon signal collection device.

9. The fully automatic detection and analysis system according to claim 8, characterized in that: The fully automatic detection and analysis system comprises two incubators, wherein one incubator is used to generate a heating temperature of 37±1°C (e.g., 36°C, 36.5°C, 37°C, 37.5°C or 38°C), and the other incubator is used to generate a heating temperature of 60±1°C (e.g., 59°C, 59.5°C, 60°C, 60.5°C or 61°C); and / or In the fully automatic detection and analysis system, signal collection for antibody detection is completed by the antibody detection module, wherein the antibody detection module is used to generate and receive chemiluminescent signals; signal collection for nucleic acid detection is completed by the fluorometer, wherein the fluorometer is used to collect fluorescent signals generated by nucleic acid amplification in real time; optionally, the temperature of the fluorometer is set to 42±1°C (for example, 41°C, 41.5°C, 42°C, 42.5°C or 43°C).

10. Use of the kit according to any one of claims 1 to 7, or the fully automatic detection and analysis system according to claim 8 or 9 in the combined detection of HIV-1 and HIV-2 antibodies and nucleic acids.

Images