BVDV nucleic acid TaqMan-MGB RT-PCR detection system with RPL4 gene as endogenous internal control

Abstract

The invention discloses a BVDV nucleic acid TaqMan-MGB RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection system taking an RPL4 gene as endogenous internal control, which comprises an upstream primer BVDV-F and a downstream primer BVDV-R for amplifying a BVDV 5-UTR, a TaqMan-MGB probe BVDV-P for detecting an amplification product of the BVDV 5-UTR, an upstream primer RPL4-F and a downstream primer RPL4-R for amplifying a pig reference gene RPL4, and a TaqMan probe RPL4-P for detecting an amplification product of the pig reference gene RPL4, and the sequences are as shown in SEQ ID NO.1-6. According to the invention, a housekeeping gene with relatively stable expression is introduced as a reference gene to correct and standardize target gene detection, so that the technical defects of false negative and false positive possibly occurring in an existing kit are avoided, the accuracy, sensitivity and repeatability of BVDV nucleic acid detection are improved, and BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples can be detected at the same time.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a BVDV nucleic acid TaqMan-MGB RT-PCR detection system using an RPL4 gene as an endogenous internal control. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is distributed globally and has two genotypes, namely BVDV-1 and BVDV-2. It belongs to the genus Pestivirus of the Flaviviridae family, along with swine fever virus (CSFV) and sheep border virus. In recent years, new BVDV strains different from BVDV-1 and BVDV-2 have been discovered and classified as BVDV-3 by researchers. Due to the extensive cross-antigen and serological cross-reactions between BVDV and CSFV, it is difficult to differentiate them clinically using serological methods.

[0003] Fluorescence quantitative RT-PCR technology has the advantages of strong specificity, high sensitivity and wide detection range, and is an important detection method. The existing fluorescence quantitative RT-PCR method for detecting BVDV nucleic acid is mainly used to detect BVDV-1 and BVDV-2 nucleic acids. A very small number of fluorescence quantitative RT-PCR kits for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3 nucleic acids are also unable to identify CSFV and are only used for bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for porcine samples. In addition, the existing fluorescence quantitative RT-PCR kits for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3 nucleic acids lack endogenous internal control design, and cannot monitor the effects of samples in the collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction links, cannot avoid the occurrence of "false negatives", and cannot monitor whether the entire reaction process is proceeding smoothly.

[0004] Therefore, it is necessary to establish a BVDV nucleic acid TaqMan-MGB RT-PCR detection system with the ribosomal protein L4 (RPL4) gene as an endogenous internal control to avoid the occurrence of "false negatives" and "false positives" and detect more BVDV genotypes. This is not only conducive to accurate and efficient BVDV monitoring, but also has important significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products. Summary of the invention

[0005] The purpose of the present invention is to provide a BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control, introducing a housekeeping gene with relatively stable expression as an internal reference gene to correct and standardize the detection of the target gene, avoiding the technical disadvantages of "false negative" and "false positive" that may occur in existing test kits, so as to improve the accuracy, sensitivity and repeatability of BVDV nucleic acid detection, and can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] A BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control, comprising:

[0008] 1) Primer pair for amplifying BVDV 5′-UTR, the sequence is as follows:

[0009] Upstream primer BVDV-F: 5′-AGTACRGGGDAGTCGTCARTGG-3′ (genomic position: 181-202 nt);

[0010] Downstream primer BVDV-R: 5′-CWRCAYCCTATCAGRCTGT-3′ (genomic position: 320-338 nt);

[0011] 2) A TaqMan-MGB probe for detecting the amplified product of BVDV 5′-UTR, the sequence is as follows:

[0012] BVDV-P: 5′-FAM-CCCTCGTCCACRTGGCAT-MGB-3′ (genomic position: 231-248 nt);

[0013] In 1) and 2) above, the genomic positions of primers and probes refer to the BVDV-1 Oregon C24V strain (GenBank accession number: AF091605);

[0014] 3) Primer pair for amplifying the porcine internal reference gene RPL4, the sequence is as follows:

[0015] Upstream primer RPL4-F: 5′-AACCTGAGAATCATGTTGAAGCTAAA-3′ (genomic position: 522-547 nt);

[0016] Downstream primer RPL4-R: 5′-GGCCTGGCGAAGAATGG-3′ (genomic position: 577-593 nt);

[0017] 4) A TaqMan probe for detecting the amplified product of the porcine internal reference gene RPL4, the sequence of which is as follows:

[0018] RPL4-P: 5′-VIC-CGTATGCAAAGACAATGCGCCGAAACT-BHQ1 -3′ (genomic position: 550-575 nt);

[0019] In the above 3) and 4), the genomic positions of primers and probes refer to the internal reference gene RPL4 (GenBank accession number: DQ845176.1).

[0020] Furthermore, the BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control can be used in a variety of fluorescent quantitative RT-PCR kits, such as a one-step BVDV nucleic acid TaqMan-MGB probe method detection kit, a two-step BVDV nucleic acid TaqMan-MGB probe method detection kit, and the like.

[0021] The one-step BVDV nucleic acid TaqMan-MGB probe method detection kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, and enzyme-free water.

[0022] Furthermore, the two-step BVDV nucleic acid TaqMan-MGB probe method detection kit at least includes:

[0023] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control;

[0024] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0025] TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, ROX, enzyme-free water.

[0026] Further, in the BVDV nucleic acid TaqMan-MGB probe method detection kit,

[0027] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use.

[0028] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5ˊ-UTR gene [genomic location (1-385nt)].

[0029] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the internal reference gene RPL4 [genomic location (251-635nt)]. After adding the RPL4 recombinant plasmid to non-porcine samples, nucleic acid extraction is performed; for porcine samples, nucleic acid extraction can be performed directly without adding the RPL4 recombinant plasmid.

[0030] Negative control: enzyme-free water, cell culture medium known to be BVDV-negative and RPL4-negative, or animal tissue suspension known to be BVDV-negative and RPL4-negative.

[0031] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize under high pressure at 121°C ± 2°C for 30 minutes, cool and refrigerate for later use.

[0032] Furthermore, in the BVDV nucleic acid TaqMan-MGB probe detection kit,

[0033] BVDV virus liquid positive control: BVDV-1AV69 strain MDBK cell passage product, with a virus titer of 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0034] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5ˊ-UTR gene [genomic location (1-385nt)], 10,000 copies / uL to 500,000 copies / uL.

[0035] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the internal reference gene RPL4 [genomic position (251-635nt)], 10,000 copies / uL to 500,000 copies / uL.

[0036] Furthermore, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5'-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5'-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5'-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0037] The present invention has the following beneficial effects:

[0038] 1. The present invention establishes a TaqMan-MGB RT-PCR detection system that uses the RPL4 gene as an endogenous internal control and can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples. The existing technology is mainly used to detect BVDV-1 and BVDV-2 nucleic acids. Very few fluorescent quantitative RT-PCR kits for simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids are also unable to identify CSFV and are only used for bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for porcine sample detection, see Application Example 2. The present invention can detect more BVDV genotypes, see Application Example 1.

[0039] 2. The present invention introduces a relatively stably expressed housekeeping gene RPL4 as an internal reference gene to calibrate and standardize the detection of the target gene. The entire process of sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction can be monitored. If there is no amplification curve for the internal reference gene control, it indicates that there are problems in the sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction, and the sample test result is invalid, avoiding the occurrence of "false negative" samples. See Application Example 2-3.

[0040] The present invention fills the technical gap in the BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control, and is of great significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products.

[0041] 3. The present invention has high sensitivity, and the minimum detection limits for BVDV-1AV69 strain, BVDV-1 recombinant plasmid template, BVDV-2 recombinant plasmid template, and BVDV-3 recombinant plasmid template are 10 -1.5 FAID 50 / 0.1mL, 1 copy number / uL, 1 copy number / uL, 1 copy number / uL. The minimum detection limit of the present invention for detecting BVDV nucleic acid is lower than that of the existing patent, and the sensitivity is higher than that of the existing patent, see Application Examples 1-3. In addition, the TaqMan-MGB RT-PCR detection system of the present invention has a good linear relationship and a high amplification efficiency, which is conducive to accurate and efficient BVDV monitoring.

[0042] 4. The BVDV nucleic acid TaqMan-MGB RT-PCR detection system of the present invention, which uses the RPL4 gene as an endogenous internal control, can be used for a variety of fluorescent quantitative RT-PCR kits, including but not limited to: a one-step BVDV nucleic acid TaqMan-MGB probe method detection kit; a two-step BVDV nucleic acid TaqMan-MGB probe method detection kit. The kit can be selected according to actual detection needs, and has the advantages of low detection cost, high practical value, and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the BVDV-1 gene in a series of standard samples (a to f);

[0044] 1. BVDV-1 recombinant plasmid (100,000 copies / uL); 2. BVDV-1 recombinant plasmid (10,000 copies / uL); 3. BVDV-1 recombinant plasmid (1000 copies / uL); 4. BVDV-1 recombinant plasmid (100 copies / uL); 5. BVDV-1 recombinant plasmid (10 copies / uL); 6. BVDV-1 recombinant plasmid (1 copy / uL).

[0045] Figure 2 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the RPL4 gene in a series of standard samples (a to f);

[0046] 1. RPL4 recombinant plasmid (100,000 copies / uL); 2. RPL4 recombinant plasmid (10,000 copies / uL); 3. RPL4 recombinant plasmid (1,000 copies / uL); 4. RPL4 recombinant plasmid (100 copies / uL); 5. RPL4 recombinant plasmid (10 copies / uL); 6. RPL4 recombinant plasmid (1 copy / uL).

[0047] Figure 3 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the BVDV-1 gene in a series of standard samples (s to y);

[0048] 1. BVDV-1 virus liquid (10 3.5 FAID 50 / 0.1mL); 2. BVDV-1 virus solution (10 2.5 FAID 50 / 0.1mL); 3. BVDV-1 virus solution (10 1.5 FAID 50 / 0.1mL); 4. BVDV-1 virus solution (10 0.5 FAID 50 / 0.1mL); 5. BVDV-1 virus solution (10 -0.5 FAID 50 / 0.1mL); 6. BVDV-1 virus solution (10 -1.5 FAID 50 / 0.1mL); 7. BVDV-1 virus solution (10 - 2.5 FAID 50 / 0.1mL).

[0049] Figure 4 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the RPL4 gene in a series of standard samples (s to y);

[0050] 1. RPL4 recombinant plasmid (100,000 copies / uL); 2. RPL4 recombinant plasmid (10,000 copies / uL); 3. RPL4 recombinant plasmid (1,000 copies / uL); 4. RPL4 recombinant plasmid (100 copies / uL); 5. RPL4 recombinant plasmid (10 copies / uL); 6. RPL4 recombinant plasmid (1 copy / uL); 7. RPL4 recombinant plasmid (0.1 copy / uL).

[0051] Figure 5 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the BVDV-2 gene in a series of standard samples (g to l);

[0052] 1. BVDV-2 recombinant plasmid (100 000 copies / uL); 2. BVDV-2 recombinant plasmid (10 000 copies / uL); 3. BVDV-2 recombinant plasmid (1 000 copies / uL); 4. BVDV-2 recombinant plasmid (100 copies / uL); 5. BVDV-2 recombinant plasmid (10 copies / uL); 6. BVDV-2 recombinant plasmid (1 copy / uL)

[0053] Figure 6It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the RPL4 gene in a series of standard samples (g to l);

[0054] 1. RPL4 recombinant plasmid (100 000 copies / uL); 2. RPL4 recombinant plasmid (10 000 copies / uL); 3. RPL4 recombinant plasmid (1 000 copies / uL); 4. RPL4 recombinant plasmid (100 copies / uL); 5. RPL4 recombinant plasmid (10 copies / uL); 6. RPL4 recombinant plasmid (1 copy / uL)

[0055] Figure 7 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the BVDV-3 gene in a series of standard samples (m to r);

[0056] 1. BVDV-3 recombinant plasmid (100 000 copies / uL); 2. BVDV-3 recombinant plasmid (10 000 copies / uL); 3. BVDV-3 recombinant plasmid (1 000 copies / uL); 4. BVDV-3 recombinant plasmid (100 copies / uL); 5. BVDV-3 recombinant plasmid (10 copies / uL); 6. BVDV-3 recombinant plasmid (1 copy / uL)

[0057] Figure 8 It is the sensitivity result of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting the RPL4 gene of a series of standard samples (m to r);

[0058] 1. RPL4 recombinant plasmid (100,000 copies / uL); 2. RPL4 recombinant plasmid (10,000 copies / uL); 3. RPL4 recombinant plasmid (1,000 copies / uL); 4. RPL4 recombinant plasmid (100 copies / uL); 5. RPL4 recombinant plasmid (10 copies / uL); 6. RPL4 recombinant plasmid (1 copy / uL).

[0059] Fig. 9 These are typical BVDV amplification curves for negative and positive controls in the FAM channel (BVDV detection); (a) one-step method; (b) two-step method.

[0060] Fig.10 These are typical RPL4 amplification curves for negative and positive VIC channels (RPL4 detection); (a) one-step method; (b) two-step method. DETAILED DESCRIPTION

[0061] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0062] According to the published genome sequences of BVDV-1 (AF091605, AF220247, AF526381, JN400273, KC695814, KJ541471, M31182, MN188074), BVDV-2 (AF502399, FJ527854, HQ258810, JF714967, KJ000672, MN527354, OP7920 28, NC_039237), BVDV-3 (KY762287, KY767958, MH410814, NC_012812, OP210314, HQ231763, JX469119, JX985409) and CSFV (AF091507, AF531433, AY568569, DQ127910, EU490425) gene sequences were analyzed using DNAStar 7.1 software was used to compare and analyze the sequences, and the conservative segment of the 5-UTR gene was selected as the target gene for detection. According to the TaqMan-MGB probe design principles, BioEdit7.2.6.1 and Primer Express 3.0.1 software were used to design a pair of BVDV 5-UTR primers and a specific TaqMan-MGB probe, which were named upstream primer BVDV-F, downstream primer BVDV-R, and probe BVDV-P, respectively, and their specificity was identified by BLAST. In addition, according to the internal reference gene sequence of pig RPL4 (DQ845176.1) in GenBank, according to the TaqMan probe design principles, Primer Express 3.0.1 software was used to design a pair of internal reference gene RPL4 primers and a specific TaqMan probe, which were named upstream primer RPL4-F, downstream primer RPL4-R, and probe RPL4-P, respectively, and their specificity was identified by BLAST. Furthermore, a BVDV nucleic acid TaqMan-MGB RT-PCR detection system was created using the RPL4 gene as an endogenous internal control, specifically including:

[0063] 1) Primer pair sequence for amplifying BVDV 5′-UTR:

[0064] Upstream primer BVDV-F: 5′-AGTACRGGGDAGTCGTCARTGG-3′ (genomic position: 181-202 nt);

[0065] Downstream primer BVDV-R: 5′-CWRCAYCCTATCAGRCTGT-3′ (genomic position: 320-338 nt).

[0066] 2) A TaqMan-MGB probe sequence for detecting the amplified product of BVDV 5′-UTR:

[0067] BVDV-P: 5′-FAM-CCCTCGTCCACRTGGCAT-MGB-3′ (genomic position: 231-248 nt).

[0068] In the above 1) and 2), the genomic positions of the primers and probes were referenced to the BVDV-1 Oregon C24V strain (GenBank Accession No.: AF091605).

[0069] 3) Primer pair sequence for amplifying the porcine internal reference gene RPL4:

[0070] Upstream primer RPL4-F: 5′-AACCTGAGAATCATGTTGAAGCTAAA-3′ (genomic position: 522-547 nt);

[0071] Downstream primer RPL4-R: 5′-GGCCTGGCGAAGAATGG-3′ (genomic position: 577-593 nt).

[0072] 4) A TaqMan probe sequence for detecting the amplified product of the porcine internal reference gene RPL4:

[0073] RPL4-P: 5′-VIC-CGTATGCAAAGACAATGCGCCGAAACT-BHQ1 -3′ (genomic position: 550-575 nt).

[0074] In the above 3) and 4), the genomic positions of primers and probes refer to the internal reference gene RPL4 (GenBank accession number: DQ845176.1).

[0075] Furthermore, the BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control can be used in a one-step BVDV nucleic acid TaqMan-MGB probe method detection kit, a two-step BVDV nucleic acid TaqMan-MGB probe method detection kit, and the like.

[0076] The one-step BVDV nucleic acid TaqMan-MGB probe method detection kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, and enzyme-free water.

[0077] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (200-400uL), 5-20uL RPL4 recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add RPL4 recombinant plasmid and nucleic acid extraction can be performed directly.

[0078] The reaction system was prepared according to Table 1. The optimized reaction conditions were: 52°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), and 45 cycles.

[0079] Table 1 Reaction system of one-step BVDV nucleic acid TaqMan-MGB probe detection kit

[0080] Components Volume (μL) RT-qPCR Mix 10 Upstream primer BVDV-F (10 μM) 0.4 to 1.6 Downstream primer BVDV-R (10 μM) 0.4 to 1.6 TaqMan-MGB probe BVDV-P (10 μM) 0.4 to 0.8 Upstream primer RPL4-F (10 μM) 0.4 to 1.6 Downstream primer RPL4-R (10 μM) 0.4 to 1.6 TaqMan probe RPL4-P (10 μM) 0.2 to 0.8 ROX 0.05 to 0.4 DNA / RNA ≤2 Enzyme-free water Fill up to 20

[0081] Result judgment:

[0082] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0083] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0084] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0085] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0086] ③The negative control of the VIC channel (RPL4 detection) should have no Ct value and no RPL4 amplification curve (see Appendix B).

[0087] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (RPL4 detection). The judgment was divided into:

[0088] (3-1) When the VIC channel (RPL4 detection) sample has no Ct value and no RPL4 amplification curve, or when the VIC channel (RPL4 detection) sample Ct value is >35 and a typical RPL4 amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0089] (3-2) When the Ct value of the VIC channel (RPL4 detection) sample is ≤35 and a typical RPL4 amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV detection):

[0090] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0091] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0092] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0093] Furthermore, the two-step BVDV nucleic acid TaqMan-MGB probe method detection kit at least includes:

[0094] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control;

[0095] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0096] TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, ROX, enzyme-free water.

[0097] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (200-400uL), 5-20uL RPL4 recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add RPL4 recombinant plasmid and nucleic acid extraction can be performed directly.

[0098] The cDNA synthesis reaction system was prepared according to Table 2. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0099] Table 2 Two-step BVDV nucleic acid TaqMan-MGB probe detection kit cDNA synthesis reaction system

[0100] Components Volume (μL) RT Master Mix 2 DNA / RNA ≤6 Enzyme-free water Fill up to 10

[0101] The TaqMan fluorescent PCR reaction system was prepared according to Table 3. The optimized reaction conditions were: 95°C for 30 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescent signals), and 45 cycles.

[0102] Table 3 Two-step BVDV nucleic acid TaqMan-MGB probe detection kit fluorescence PCR reaction system

[0103]

[0104]

[0105] Result determination: The result determination method is the same as that of the one-step BVDV nucleic acid TaqMan-MGB probe detection kit.

[0106] Further, in the BVDV nucleic acid TaqMan-MGB probe method detection kit,

[0107] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use.

[0108] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)].

[0109] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the internal reference gene RPL4 [genomic location (251-635nt)]. After adding the RPL4 recombinant plasmid to non-porcine samples, nucleic acid extraction is performed; for porcine samples, nucleic acid extraction can be performed directly without adding the RPL4 recombinant plasmid.

[0110] Negative control: enzyme-free water, cell culture medium known to be BVDV-negative and RPL4-negative, or animal tissue suspension known to be BVDV-negative and RPL4-negative.

[0111] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize under high pressure at 121°C ± 2°C for 30 minutes, cool and refrigerate for later use.

[0112] RT-qPCR Mix, RT-PCR Buffer, TaqHS, RT enzyme Mix, ROX, RT Master Mix, ExTaq enzyme, and Ex TaqⅡ enzyme are all products of Dalian Baobio Biotechnology Co., Ltd.

[0113] Furthermore, in the BVDV nucleic acid TaqMan-MGB probe detection kit,

[0114] BVDV virus liquid positive control: BVDV-1AV69 strain MDBK cell passage product, with a virus titer of 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0115] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)], 10,000 copies / uL to 500,000 copies / uL.

[0116] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the internal reference gene RPL4 [genomic position (251-635nt)], 10,000 copies / uL to 500,000 copies / uL. Each non-porcine sample (200-400uL) needs to be added with 5-20uL of RPL4 recombinant plasmid during nucleic acid extraction, and then nucleic acid extraction is performed; pig-derived samples do not need to add RPL4 recombinant plasmid, and nucleic acid extraction can be performed directly.

[0117] Furthermore, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0118] Furthermore, the RPL4 recombinant plasmid is a recombinant plasmid containing the target fragment of the RPL4 internal reference gene (GenBank accession number: DQ845176.1).

[0119] Example 1

[0120] A one-step BVDV nucleic acid TaqMan-MGB probe method detection kit, comprising:

[0121] BVDV recombinant plasmid positive control: recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-3Th / 04_KhonKaen strain, 500,000 copies / uL.

[0122] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the RPL4 internal reference gene, 500,000 copies / uL.

[0123] Negative control: cell culture medium known to be BVDV negative and RPL4 negative.

[0124] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0125] RT-qPCR Mix: product of Dalian Baobiological Company.

[0126] ROX: Product of Dalian Bao Biotechnology Co., Ltd.

[0127] Upstream primer BVDV-F: 5′-AGTACRGGGDAGTCGTCARTGG-3′;

[0128] Downstream primer BVDV-R: 5′-CWRCAYCCTATCAGRCTGT-3′;

[0129] TaqMan-MGB probe BVDV-P: 5′-FAM-CCCTCGTCCACRTGGCAT-MGB-3′.

[0130] Upstream primer RPL4-F: 5′-AACCTGAGAATCATGTTGAAGCTAAA-3′;

[0131] Downstream primer RPL4-R: 5′-GGCCTGGCGAAGAATGG-3′;

[0132] TaqMan probe RPL4-P: 5′-VIC-CGTATGCAAAGACAATGCGCCGAAACT-BHQ1-3′.

[0133] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 20uL of RPL4 recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add RPL4 recombinant plasmid and nucleic acid extraction can be performed directly.

[0134] The reaction system was prepared according to Table 4. The optimized reaction conditions were: 52°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), and 45 cycles.

[0135] Table 4 Reaction system of one-step BVDV nucleic acid TaqMan-MGB probe detection kit

[0136]

[0137]

[0138] Result determination

[0139] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0140] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0141] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0142] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0143] ③The negative control of the VIC channel (RPL4 detection) should have no Ct value and no RPL4 amplification curve (see Appendix B).

[0144] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (RPL4 detection). The judgment was divided into:

[0145] (3-1) When the VIC channel (RPL4 detection) sample has no Ct value and no RPL4 amplification curve, or when the VIC channel (RPL4 detection) sample Ct value is >35 and a typical RPL4 amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0146] (3-2) When the Ct value of the VIC channel (RPL4 detection) sample is ≤35 and a typical RPL4 amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV detection):

[0147] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0148] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0149] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0150] Example 2

[0151] A two-step BVDV nucleic acid TaqMan-MGB probe method detection kit, comprising:

[0152] (1) Kit control

[0153] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-3Th / 04_KhonKaen strain, 500,000 copies / uL.

[0154] RPL4 recombinant plasmid: a recombinant plasmid containing the target fragment of the RPL4 internal reference gene, 500,000 copies / uL.

[0155] Negative control: spleen tissue suspension from an animal known to be BVDV negative and RPL4 negative.

[0156] (2) cDNA synthesis system

[0157] RT Master Mix: Product of Dalian Bao Biotechnology Co., Ltd.

[0158] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0159] (3) TaqMan fluorescent PCR reaction system

[0160] Ex Taq enzyme: product of Dalian Bao Biotechnology Co., Ltd.

[0161] ROX: Product of Dalian Bao Biotechnology Co., Ltd.

[0162] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0163] Upstream primer BVDV-F: 5′-AGTACRGGGDAGTCGTCARTGG-3′;

[0164] Downstream primer BVDV-R: 5′-CWRCAYCCTATCAGRCTGT-3′;

[0165] TaqMan-MGB probe BVDV-P: 5′-FAM-CCCTCGTCCACRTGGCAT-MGB-3′.

[0166] Upstream primer RPL4-F: 5′-AACCTGAGAATCATGTTGAAGCTAAA-3′;

[0167] Downstream primer RPL4-R: 5′-GGCCTGGCGAAGAATGG-3′;

[0168] TaqMan probe RPL4-P: 5′-VIC-CGTATGCAAAGACAATGCGCCGAAACT-BHQ1-3′.

[0169] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 5uL of RPL4 recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add RPL4 recombinant plasmid and nucleic acid extraction can be performed directly.

[0170] The cDNA synthesis reaction system was prepared according to Table 5. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0171] Table 5 Two-step BVDV nucleic acid TaqMan-MGB probe detection kit cDNA synthesis reaction system

[0172]

[0173]

[0174] The TaqMan fluorescent PCR reaction system was prepared according to Table 6. The optimized reaction conditions were: 95°C for 30 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescent signals), and 45 cycles.

[0175] Table 6 Fluorescence PCR reaction system of two-step BVDV nucleic acid TaqMan-MGB probe detection kit

[0176] Components Volume (μL) Ex Taq enzyme 10 Upstream primer BVDV-F (10 μM) 1.6 Downstream primer BVDV-R (10 μM) 1.6 TaqMan-MGB probe BVDV-P (10 μM) 0.8 Upstream primer RPL4-F (10 μM) 0.4 Downstream primer RPL4-R (10 μM) 0.4 TaqMan probe RPL4-P (10 μM) 0.2 ROX 0.2 cDNA 2 Enzyme-free water 2.8

[0177] Result determination: Same as Example 1.

[0178] Application Example 1

[0179] The sensitivity, linear relationship and amplification efficiency of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention for detecting "BVDV-1 and RPL4 gene", "BVDV-2 and RPL4 gene" and "BVDV-3 and RPL4 gene" were studied.

[0180] 1. Preparation of a series of standard samples

[0181] 1.1 A series of standard samples related to sensitivity, linear relationship and amplification efficiency of “BVDV-1 and RPL4 gene”

[0182] 1.1.1 “BVDV-1 recombinant plasmid and RPL4 gene” series of standard samples

[0183] The BVDV-1Oregon C24V strain recombinant plasmid and the RPL4 recombinant plasmid were mixed to prepare a series of standard samples (a to f), as shown in Table 7.

[0184] Table 7 Series of standard samples (BVDV-1 recombinant plasmid and RPL4 gene)

[0185]

[0186] 1.1.2 “BVDV-1 virus fluid and RPL4 gene” series of standard samples

[0187] The BVDV-1AV69 strain MDBK cell passage product was inactivated with formaldehyde at 37°C and then mixed with the RPL4 recombinant plasmid to prepare a series of standard samples (s to y), as shown in Table 8.

[0188] Table 8 Series of standard samples (BVDV-1 virus liquid and RPL4 gene)

[0189]

[0190] 1.2 A series of standard samples related to sensitivity, linear relationship and amplification efficiency of “BVDV-2 and RPL4 gene”

[0191] The recombinant plasmid of BVDV-2SH-28 strain and the recombinant plasmid of RPL4 were mixed to prepare a series of standard samples (g to l), as shown in Table 9.

[0192] Table 9 Series of standard samples (BVDV-2 and RPL4 genes)

[0193]

[0194] 1.3 A series of standard samples related to sensitivity, linear relationship and amplification efficiency of “BVDV-3 and RPL4 gene”

[0195] The recombinant plasmid of BVDV-3Th / 04_KhonKaen strain and the recombinant plasmid of RPL4 were mixed to prepare a series of standard samples (m to r), as shown in Table 10.

[0196] Table 10 Series of standard samples (BVDV-3 and RPL4 genes)

[0197]

[0198] 2. Viral nucleic acid extraction

[0199] Take 400 μL of the positive control and 400 μL of the negative control in Example 1;

[0200] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as virus control (RPL4 recombinant plasmid was added during nucleic acid extraction);

[0201] And take standard samples (a to y);

[0202] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0203] 3RT-PCR amplification

[0204] 3.1 Sensitivity, linear relationship and amplification efficiency of “BVDV-1 and RPL4 gene”

[0205] The obtained nucleic acids of the series of standard samples (a to f) and the series of standard samples (s to y) were amplified by RT-PCR according to the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit in Example 1, and positive controls, negative controls and virus controls were set up respectively.

[0206] 3.2 Sensitivity, linear relationship and amplification efficiency of “BVDV-2 and RPL4 gene”

[0207] The nucleic acids of the obtained series of standard samples (g to l) were amplified by RT-PCR according to the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit in Example 1, and positive controls, negative controls and virus controls were set up.

[0208] 3.3 Sensitivity, linear relationship and amplification efficiency of “BVDV-3 and RPL4 gene”

[0209] The nucleic acids of the obtained series of standard samples (m to r) were amplified by RT-PCR according to the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit in Example 1, and positive controls, negative controls and virus controls were set up.

[0210] 4 Results

[0211] The quality control standard test of the kit in Example 1 of the present invention also meets the conditions described in Example 1, so the tests are all valid.

[0212] The virus control test results showed that the Ct value of the virus control in the VIC channel (RPL4 detection) was ≤35 and a typical RPL4 amplification curve appeared, indicating that the virus control nucleic acid extraction, reverse transcription and amplification effects were good; the FAM channel (BVDV detection) virus control had no Ct value and no BVDV amplification curve, indicating that the BVDV nucleic acid TaqMan-MGB RT-PCR detection system of the present invention using the RPL4 gene as an endogenous internal control can distinguish between BVDV nucleic acid and CSFV nucleic acid, with strong specificity.

[0213] 4.1 Results of sensitivity, linear relationship and amplification efficiency of “BVDV-1 and RPL4 gene”

[0214] 4.1.1 Results of sensitivity, linearity and amplification efficiency of “BVDV-1 recombinant plasmid and RPL4 gene”

[0215] The detection was performed on the serially diluted BVDV-1 recombinant plasmid and RPL4 recombinant plasmid templates (a to f). The sensitivity results showed that the minimum detection limit of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention for the BVDV-1 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the RPL4 recombinant plasmid template was 1 copy number / uL, see Figure 1 and Figure 2 The results of linear relationship and amplification efficiency showed that the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention showed a good linear relationship in the range of 1 copy number / uL to 100000 copies / uL BVDV-1 template copy number, and its correlation coefficient (R 2 ) was 0.997, the amplification efficiency was 100.256, and the standard curve was: y = -3.316x + 39.704; the RPL4 template copy number showed a good linear relationship in the range of 1 copy number / uL to 100000 copy number / uL, and its correlation coefficient (R 2 ) is 0.997, the amplification efficiency is 98.997, and the standard curve is: y=-3.346x+40.827. These indicate that the standard curve of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting "BVDV-1 and RPL4 gene" has good linearity and high credibility.

[0216] 4.1.2 Results of sensitivity, linearity and amplification efficiency of “BVDV-1 virus fluid and RPL4 gene”

[0217] The detection was performed on serially diluted BVDV-1 virus liquid and RPL4 recombinant plasmid template (s to y). The sensitivity results showed that the minimum detection limit of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for BVDV-1AV69 strain virus liquid was 10-1.5 FAID 50 / 0.1mL, the minimum detection limit for RPL4 recombinant plasmid template is 1 copy number / uL, see Figure 3 and Figure 4 The linear relationship and amplification efficiency results show that the one-step BVDV nucleic acid TaqMan-MGB probe detection kit of the present invention is effective in 10 -1.5 FAID 50 / 0.1mL~10 3.5 FAID 50 / 0.1mL virus titer showed a good linear relationship, and its correlation coefficient (R 2 ) was 0.999, the amplification efficiency was 100.265, and the standard curve was: y = -3.316x + 39.755; the RPL4 template copy number showed a good linear relationship in the range of 1 copy number / uL to 100000 copy number / uL, and its correlation coefficient (R 2 ) is 1, the amplification efficiency is 96.308, and the standard curve is: y=-3.414x+41.757. These indicate that the standard curve of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit for detecting "BVDV-1 and RPL4 gene" has good linearity and high credibility.

[0218] 4.2 Results of sensitivity, linear relationship and amplification efficiency of “BVDV-2 and RPL4 gene”

[0219] The detection was performed on serially diluted BVDV-2 and RPL4 recombinant plasmid templates (g to l). The sensitivity results showed that the minimum detection limit of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention for the BVDV-2 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the RPL4 recombinant plasmid template was 1 copy number / uL, see Figure 5 and Figure 6 The results of linear relationship and amplification efficiency showed that the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention showed a good linear relationship in the range of 1 copy number / uL to 100,000 copies / uL BVDV-2 template copy number, and its correlation coefficient (R 2 ) was 0.999, the amplification efficiency was 93.438, and the standard curve was: y = -3.49x + 40.986; the RPL4 template copy number showed a good linear relationship in the range of 1 copy number / uL to 100000 copy number / uL, and its correlation coefficient (R 2 ) is 0.998, the amplification efficiency is 98.012, and the standard curve is: y=-3.37x+41.426. These indicate that the standard curve of the primer pair and probe set of the present invention for detecting "BVDV-2 and RPL4 gene" has good linearity and high credibility.

[0220] 4.3 Results of sensitivity, linear relationship and amplification efficiency of “BVDV-3 and RPL4 gene”

[0221] The detection was performed on serially diluted BVDV-3 and RPL4 recombinant plasmid templates (m to r). The sensitivity results showed that the minimum detection limit of the one-step BVDV nucleic acid TaqMan-MGB probe detection kit of the present invention for the BVDV-3 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the RPL4 recombinant plasmid template was 1 copy number / uL, see Figure 7 and Figure 8 The results of linear relationship and amplification efficiency showed that the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit of the present invention showed a good linear relationship in the range of 1 copy number / uL to 100000 copies / uL BVDV-3 template copy number, and its correlation coefficient (R 2 ) is 1, the amplification efficiency is 95.093, and the standard curve is: y = -3.445x + 40.892; the RPL4 template copy number shows a good linear relationship in the range of 1 copy number / uL to 100000 copy number / uL, and its correlation coefficient (R 2 ) is 0.998, the amplification efficiency is 105.044, and the standard curve is: y = -3.207x + 40.521. These indicate that the standard curve of the primer pair and probe set of the present invention for detecting "BVDV-3 and RPL4 gene" has good linearity and high credibility.

[0222] Application Example 2

[0223] The one-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 1 was compared with the existing fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid. Among them, the existing fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid is prepared according to the Chinese invention patent with patent number 202011330477.8 and patent name "Kit, Primers and Probes for Simultaneous Detection of BVDV-1, BVDV-2 and BVDV-3".

[0224] 1 Sample

[0225] 1.1 Porcine samples

[0226] 300 mg each of kidney (a1), spleen (b1), mesenteric lymph node (C1), inguinal lymph node (d1), and lung (e1) of suckling piglets were taken, and 300 mg each of kidney (a2), spleen (b2), mesenteric lymph node (C2), inguinal lymph node (d2), and lung (e2) of nursery pigs were taken, and 10% tissue homogenate was made respectively. After repeated freezing and thawing for 3 times, the supernatant was centrifuged and used for later use.

[0227] 1.2 Non-porcine samples

[0228] 300 mg of the feces sample (f1) of the growing cattle was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of peripheral blood leukocytes (g1) of the growing cattle were collected, and 2.0 mL of PBS was added to the nasal swab (h1) of the growing cattle, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0229] 300 mg of adult bovine feces sample (f2) was prepared into 10% homogenate, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use. 2.0 mL of adult bovine blood was collected to separate bovine peripheral blood leukocytes (g2), and 2.0 mL of adult bovine nasal swab (h2) was placed in 2.0 mL of PBS, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use.

[0230] 300 mg of the fecal sample (I1) of the growing sheep was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J1) was collected from the blood of the growing sheep, and 2.0 mL of PBS was added to the nasal swab (K1) of the growing sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0231] 300 mg of adult sheep feces sample (I2) was prepared into 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J2) was collected from adult sheep blood, and 2.0 mL of PBS was added to the nasal swab (K2) of adult sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0232] 2. Viral nucleic acid extraction

[0233] Take 400 μL of the positive control and 400 μL of the negative control in Example 1;

[0234] Take 400 μL of mixed plasmid positive control and 400 μL of negative control of the same concentration of BVDV-1, BVDV-2, and BVDV-3 in the existing patented kit;

[0235] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as a virus control (using the kit of Example 1 to add RPL4 recombinant plasmid during nucleic acid extraction);

[0236] Porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2;

[0237] Non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 (RPL4 recombinant plasmid needs to be added to non-porcine samples during nucleic acid extraction using the kit of Example 1);

[0238] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0239] 3RT-PCR amplification

[0240] The obtained nucleic acid was amplified by RT-PCR according to the method described in the kit of Example 1 and the existing patent kit, respectively. Among them, positive control and negative control were set up according to the method described in the kit of Example 1; mixed plasmid positive control and negative control of the same concentration of BVDV-1, BVDV-2, and BVDV-3 were set up according to the method described in the existing patent kit.

[0241] 4 Results

[0242] 4.1 Quality control standard test results

[0243] The quality control standards of the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 1 of the present invention simultaneously meet the three conditions described in Example 1, so the kit test in Example 1 is effective.

[0244] The quality control standard test results of the existing patented test kit show that the positive control amplification results of mixed plasmids of the same concentration of BVDV-1, BVDV-2, and BVDV-3 are all positive, and no amplification curve is observed in the negative control, so the existing patented test kit is valid.

[0245] 4.2 Sample test results

[0246] The results of the sample detection by the one-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 1 of the present invention showed that (1) the Ct values ​​of the porcine samples a1, b1, C1, d1, and e1 in the VIC channel (RPL4 detection) were ≤35, and a typical RPL4 amplification curve appeared, indicating that the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription, and amplification effects of the porcine samples a1, b1, C1, d1, and e1 were good; the VIC channel (RPL4 detection) of non-porcine samples (f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2) had a Ct value ≤ 35 and a typical RPL4 amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of non-porcine samples were good; FAM channel (BVDV detection) samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 had no Ct value and no BVDV amplification curve, indicating that samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 did not contain BVDV nucleic acid and were judged to be negative. (2) In the VIC channel (RPL4 detection), there are no Ct values ​​and no RPL4 amplification curves for the porcine samples a2, b2, C2, d2, and e2, indicating that there are inhibitory components or nucleic acid loss in the reaction system for the porcine samples a2, b2, C2, d2, and e2, and there is a risk of "false negative". At this time, in the FAM channel (BVDV detection), there are no Ct values ​​and no BVDV amplification curves for the porcine samples a2, b2, C2, d2, and e2. However, because there are no Ct values ​​and no RPL4 amplification curves for the VIC channel (RPL4 detection), the porcine samples a2, b2, C2, d2, and e2 need to be resampled, extracted, or the nucleic acid further purified before retesting. (3) The Ct value of the virus control in the VIC channel (RPL4 detection) was ≤35 and a typical RPL4 amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of the virus control were good; the virus control in the FAM channel (BVDV detection) had no Ct value and no BVDV amplification curve, indicating that there was no BVDV nucleic acid in the virus control, and it was judged to be BVDV nucleic acid negative.

[0247] The results of the samples tested by the existing patented kit showed that (1) no amplification curves were observed for porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2 and non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2, and they were judged as negative. (2) The virus control in the ROX channel (BVDV-3 test) produced an amplification curve, and the amplification result was positive, indicating that the existing patented kit would misdetect CSFV and may produce "false positives" when testing porcine samples.

[0248] 5 Discussions

[0249] Because there is a possibility of "false negative" in the process of sample collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction, etc., in order to avoid the occurrence of "false negative", the kit of Example 1 of the present invention has a primer pair for amplifying the internal reference gene RPL4, a TaqMan probe sequence for detecting the amplified product of RPL4, and an RPL4 recombinant plasmid. Therefore, (1) when detecting porcine samples, the kit of Example 1 of the present invention can monitor the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription and amplification effects, such as: monitoring whether epithelial cells are collected, monitoring whether a sufficient amount of sample cells are collected, and monitoring the accuracy of the entire experimental operation process such as sampling, extraction, amplification detection. In the experiment of Example 1 of the present invention, the VIC channel (RPL4 detection) porcine samples a2, b2, C2, d2, and e2 have no Ct value and no RPL4 amplification curve, indicating that the porcine samples a2, b2, C2, d2, and e2 have the risk of causing "false negative" and need to be re-sampled, extracted, or further purified nucleic acid before re-testing, while the existing patented kit cannot monitor the sampling, transportation, and sample processing process. (2) When testing non-porcine samples, Example 1 of the present invention can monitor the nucleic acid extraction, reverse transcription and amplification effects of each sample, while the existing patented kit cannot perform such monitoring.

[0250] In addition, the samples to be tested by the existing patented kit are bovine nasal swabs and fecal samples. If the samples of pig origin are tested, the CSFV that may exist in the pig origin samples may cause the existing patented kit to misdetect, and a "false positive" may occur. The one-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 1 of the present invention detects the virus control CSFV nucleic acid as negative, and has better specificity.

[0251] Application Example 3

[0252] The two-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 2 was compared with the existing PCR kit for detecting BVDV nucleic acid. Among them, the existing patented kit was prepared according to the Chinese invention patent with patent number 201310516849.X and patent name "A bovine viral diarrhea virus internal standard typing fluorescent PCR detection kit and its preparation".

[0253] 1 sample

[0254] Take 300 mg each of the kidney (A1), spleen (B1), mesenteric lymph node (C1), inguinal lymph node (D1), and lung (E1) of a suckling pig, and take 300 mg each of the kidney (A2), spleen (B2), mesenteric lymph node (C2), inguinal lymph node (D2), and lung (E2) of a nursery pig, make them into 10% tissue homogenate, freeze-thaw repeatedly for 3 times, and then centrifuge to obtain the supernatant for later use.

[0255] 2. Viral nucleic acid extraction

[0256] Take 400 μL of the negative control in Example 2;

[0257] Samples A1, B1, C1, D1, E1, A2, B2, C2, D2, E2;

[0258] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0259] 3cDNA synthesis

[0260] The extracted nucleic acid was reverse transcribed according to the cDNA synthesis system described in the kit of Example 2 and the prior patented kit.

[0261] 4. Fluorescence PCR reaction

[0262] PCR was performed according to the method described in the kit of Example 2 and the existing patented kit, respectively. Among them, positive control and negative control were set up according to the method described in the kit of Example 2; BVDVI positive plasmid, BVDVII positive plasmid, GAPDH positive plasmid and negative control were set up according to the method described in the existing patented kit.

[0263] 5 Results

[0264] 5.1 Quality control standard test results

[0265] The quality control standard of the two-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 2 of the present invention meets the three conditions described in Example 2 at the same time, so the kit test in Example 2 is effective.

[0266] The quality control standard test results of the existing patented kit show that the BVDVI-positive plasmid, BVDVII-positive plasmid and GAPDH-positive plasmid can all obtain the target dissolution curve, and the negative control has no amplified dissolution curve, so the existing patented kit test is effective.

[0267] 5.2 Sample test results

[0268] The results of the sample detection by the two-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 2 of the present invention showed that (1) the Ct values ​​of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 in the VIC channel (RPL4 detection) were ≤35, and a typical RPL4 amplification curve appeared, indicating that the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription, and amplification effects of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 were good; (2) the FAM channel (BVDV detection) samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 had no Ct value and no BVDV amplification curve, indicating that there was no BVDV nucleic acid in samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2, and they were judged to be negative.

[0269] The results of sample testing with the existing patented kit showed that there was no amplification melting curve for the target template and internal standard template detection of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2.

[0270] 6 Discussions

[0271] The existing patented test kit has developed bovine GAPDH internal standard detection primers according to the bovine GAPDH mRNA-specific nucleotide sequence. The tissue samples to be tested are derived from cattle, and the porcine GAPDH gene cannot be amplified. Therefore, there is no amplification melting curve for the internal standard template test of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2, and it is impossible to understand whether there is a "false negative" in the collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction and other processes of porcine tissue samples. The existing patented test kit is not suitable for the detection of porcine tissue samples, and cannot detect BVDV-3. The two-step BVDV nucleic acid TaqMan-MGB probe method detection kit prepared in Example 2 of the present invention is not only suitable for the detection of porcine tissue samples, avoiding the occurrence of "false negatives" and "false positives", but also can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in the sample. Appendix A typical amplification curves of BVDV nucleic acid negative and positive

[0272] Typical BVDV amplification curves for negative and positive controls in the FAM channel (BVDV detection) are shown in Fig. 9 : (a) is a one-step method; (b) is a two-step method.

[0273] Appendix B Typical amplification curves of RPL4 nucleic acid negative and positive

[0274] VIC channel (RPL4 detection) negative and positive typical RPL4 amplification curves are shown in Fig.10 : (a) is a one-step method; (b) is a two-step method.

Claims

1. A BVDV nucleic acid TaqMan-MGB RT-PCR detection system using the RPL4 gene as an endogenous internal control, characterized in that: It includes: 1) Primer pair for amplifying BVDV 5´-UTR, the sequence is as follows: Upstream primer BVDV-F: 5´- AGTACRGGGDAGTCGTCARTGG -3´; Downstream primer BVDV-R: 5´- CWRCAYCCTATCAGRCTGT -3´; 2) A TaqMan-MGB probe for detecting the amplified product of BVDV 5´-UTR, the sequence is as follows: BVDV-P: 5´-FAM-CCCTCGTCCACRTGGCAT-MGB-3´; 3) Primer pair for amplifying the porcine internal reference gene RPL4, the sequence is as follows: Upstream primer RPL4-F: 5´- AACCTGAGAATCATGTTGAAGCTAAA -3´; Downstream primer RPL4-R: 5´- GGCCTGGCGAAGAATGG -3´; 4) A TaqMan probe for detecting the amplified product of the porcine internal reference gene RPL4, the sequence is as follows: RPL4-P: 5´- VIC-CGTATGCAAAGACAATGCGCCGAAACT-BHQ1-3´.

2. A BVDV nucleic acid TaqMan-MGB RT-PCR detection kit using the RPL4 gene as an endogenous internal control, characterized in that: It includes: upstream primer BVDV-F and downstream primer BVDV-R for amplifying BVDV 5'-UTR, TaqMan-MGB probe BVDV-P for detecting the amplified product of BVDV 5'-UTR, upstream primer RPL4-F and downstream primer RPL4-R for amplifying the porcine internal reference gene RPL4, TaqMan probe RPL4-P for detecting the amplified product of the porcine internal reference gene RPL4, and the sequence is as follows: Upstream primer BVDV-F: 5´- AGTACRGGGDAGTCGTCARTGG -3´; Downstream primer BVDV-R: 5´- CWRCAYCCTATCAGRCTGT -3´; TaqMan-MGB probe BVDV-P: 5´- FAM- CCCTCGTCCACRTGGCAT -MGB-3´; Upstream primer RPL4-F: 5´- AACCTGAGAATCATGTTGAAGCTAAA -3´; Downstream primer RPL4-R: 5´- GGCCTGGCGAAGAATGG -3´; TaqMan probe RPL4-P: 5´- VIC- CGTATGCAAAGACAATGCGCCGAAACT -BHQ1 -3´.

3. A BVDV nucleic acid TaqMan-MGB RT-PCR detection kit using the RPL4 gene as an endogenous internal control according to claim 2, characterized in that: The kit is a one-step BVDV nucleic acid TaqMan-MGB probe method detection kit or a two-step BVDV nucleic acid TaqMan-MGB probe method detection kit.

4. A BVDV nucleic acid TaqMan-MGB RT-PCR detection kit using the RPL4 gene as an endogenous internal control according to claim 3, characterized in that: The one-step BVDV nucleic acid TaqMan-MGB probe method detection kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, and enzyme-free water.

5. The BVDV nucleic acid TaqMan-MGBRT-PCR detection kit using the RPL4 gene as an endogenous internal control according to claim 3, characterized in that: The two-step BVDV nucleic acid TaqMan-MGB probe method detection kit at least includes: Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, RPL4 recombinant plasmid, negative control; cDNA synthesis system: RT Master Mix and enzyme-free water; TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan-MGB probe BVDV-P, upstream primer RPL4-F, downstream primer RPL4-R, TaqMan probe RPL4-P, ROX, enzyme-free water.

6. A TaqMan-MGB RT-PCR detection kit for BVDV nucleic acid using the RPL4 gene as an endogenous internal control according to claim 4 or 5, characterized in that: The BVDV virus liquid positive control is a BVDV virus liquid that is inactivated by formaldehyde at 37°C and then aliquoted for use; The BVDV recombinant plasmid positive control is a recombinant plasmid containing the BVDV 5´-UTR gene target fragment; The RPL4 recombinant plasmid is a recombinant plasmid containing the target fragment of the internal reference gene RPL4; The negative control is any one of enzyme-free water, a cell culture fluid known to be BVDV negative and RPL4 negative, and an animal tissue suspension known to be BVDV negative and RPL4 negative.

7. The BVDV nucleic acid TaqMan-MGBRT-PCR detection kit using the RPL4 gene as an endogenous internal control according to claim 6, characterized in that: The BVDV virus liquid positive control is a BVDV-1 AV69 strain MDBK cell passage product, and its virus titer is 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL; The concentration of the BVDV recombinant plasmid positive control is 10,000 copies / uL to 500,000 copies / uL; The concentration of the RPL4 recombinant plasmid is 10,000 copies / uL to 500,000 copies / uL.

8. The BVDV nucleic acid TaqMan-MGBRT-PCR detection kit using the RPL4 gene as an endogenous internal control according to claim 6, characterized in that: The BVDV recombinant plasmid positive control is any one of a recombinant plasmid containing a target gene fragment of the 5'-UTR gene of the BVDV-1 OregonC24V strain, a recombinant plasmid containing a target gene fragment of the 5'-UTR gene of the BVDV-2 SH-28 strain, and a recombinant plasmid containing a target gene fragment of the 5'-UTR gene of the BVDV-3 Th / 04_KhonKaen strain.

Images