Aspergillus niger, microbial inoculant, solid fermentation liquor, preparation method and application thereof
By optimizing the solid-state fermentation culture of Aspergillus niger strain AGM01 and using small molecule inducers to enhance β-glucosidase activity, the problem of insufficient enzyme activity in existing technologies was solved, and the efficient use of agricultural waste to prepare lignocellulose hydrolysate was achieved.
Patent Information
- Application Number
- CN202411183576.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-27
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-08-27
AI Technical Summary
In existing technologies, the semi-solid fermentation method that uses corn cobs as the main carbon source to induce strains to produce β-glucosidase results in low enzyme activity, which is difficult to meet the needs of industrial production.
The activity of β-glucosidase was improved by using Aspergillus niger AGM01 strain and adding small molecule inducers such as xylose and kaempferol-3-O-β-D-sophoroside to the solid-state fermentation medium to optimize fermentation conditions.
The enzyme activity of β-glucosidase in Aspergillus niger solid-state fermentation broth was increased to 110-170 U/mL, meeting the needs of industrial production, and effectively utilizing agricultural and forestry waste to prepare lignocellulose hydrolysate.
Smart Images

Figure CN119220409B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of microorganisms, and particularly relates to a black aspergillus, a microbial agent, a solid-state fermentation liquid, and a preparation method and application thereof. BACKGROUND
[0002] With the continuous development of the biological industry, more and more products are prepared by microbial fermentation methods. The carbon source, especially glucose, in the microbial fermentation process is an important energy source for the growth and metabolism of microorganisms, which also means that a large amount of glucose needs to be consumed in the microbial fermentation process. At present, the glucose used in microbial fermentation is mainly derived from starch hydrolysis sugar liquid, which indicates that with the continuous development of the biological industry, the demand for glucose will also increase, which may lead to an increase in the demand for starch crops, and thus may cause an increase in food prices or a shortage of food supply.
[0003] Agricultural waste and forestry waste, including sugarcane residue, straw, rice straw, fruit shells, and the like, and forestry waste, including tree tops, branches, tree crowns, wood chips, and the like, are potential sources of glucose. By hydrolyzing the lignocellulose in agricultural waste and forestry waste into glucose, xylose, and the like, not only can the dependence on starch crops be reduced, but also the resource utilization of waste can be realized, which is environmentally friendly and economically sustainable. Therefore, efficient production of lignocellulose hydrolysis sugar liquid is an engineering problem that needs to be solved in the field of biological industry.
[0004] After nearly 20 years of research and development of key enzymes, cellulase and beta-glucosidase, in the process of lignocellulose hydrolysis in China, the enzyme activity of cellulase has met the industrial demand to some extent, but so far the enzyme activity of beta-glucosidase has not met the industrial demand. No important breakthrough has been made in screening and cultivating high-yield beta-glucosidase strains. The reported beta-glucosidase enzyme activity is not high, mostly below 20 U / mL, especially the cellobiase activity is lower. SUMMARY
[0005] The existing problem in the prior art is that in the prior art, corn cob is usually used as the main carbon source to induce the production of beta-glucosidase by the strain, and the semi-solid fermentation method is used for cultivation, but this method in the prior art often leads to low enzyme activity of the produced beta-glucosidase, which is difficult to meet the needs of industrial production.
[0006] In view of the above problems in the prior art, the present application provides a black aspergillus, a microbial agent, a solid-state fermentation liquid, and a preparation method and application thereof.
[0007] Specifically, the present application provides the following technical solutions:
[0008] In a first aspect, the present application provides an Aspergillus niger, which is Aspergillus niger AGM01, deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 2024768. Aspergillus niger ) AGM01, deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 2024768.
[0009] Preferably, the ITS gene sequence of the Aspergillus niger AGM01 is shown in SEQ ID NO. 3.
[0010] Preferably, the Aspergillus niger AGM01 has the property of producing β-glucosidase.
[0011] Preferably, the enzyme activity of the β-glucosidase of the Aspergillus niger AGM01 is 20-30 U, wherein the U refers to one enzyme activity unit of β-glucosidase, wherein 1 μmol of glucose produced per min of cellobiose enzymolysis requires the enzyme amount of one enzyme activity unit of β-glucosidase defined as the enzyme activity unit of β-glucosidase per mL of the crude enzyme solution of the Aspergillus niger AGM01.
[0012] Preferably, the crude enzyme solution of the Aspergillus niger AGM01 is prepared by the following method: the Aspergillus niger is amplified and cultured to obtain an Aspergillus niger spore suspension, the Aspergillus niger spore suspension is fermented and cultured to obtain a fermentation broth, and then solid-liquid separation is performed to obtain the supernatant, i.e. the crude enzyme solution of the Aspergillus niger AGM01.
[0013] Preferably, the fermentation culture time is 5-7 days.
[0014] In a second aspect, the present application provides a fermentation preparation method of an Aspergillus niger agent, which comprises the following steps:
[0015] (a) amplifying and culturing the Aspergillus niger according to any one of claims 1-5 to obtain an Aspergillus niger spore suspension;
[0016] (b) fermenting and culturing the Aspergillus niger spore suspension obtained in step (a).
[0017] Preferably, in step (a), 10 6 -10 7 spores of the Aspergillus niger according to any one of claims 1-5 are contained per mL of the Aspergillus niger spore suspension.
[0018] Preferably, the culture temperature in step (a) is 26-30℃, and / or the culture temperature in step (b) is 26-32℃.
[0019] Preferably, the culture time in step (a) is 24-48h.
[0020] In a third aspect, the present application provides an Aspergillus niger agent, comprising the Aspergillus niger according to any one of claims 1-5.
[0021] In a fourth aspect, the present application provides an Aspergillus niger agent, which is prepared by the fermentation preparation method according to any one of claims 6-9.
[0022] In a fifth aspect, the present application provides an Aspergillus niger solid-state fermentation liquid, comprising the Aspergillus niger according to any one of claims 1-5, wherein the enzyme activity of β-glucosidase in the Aspergillus niger solid-state fermentation liquid is 110-170 U, wherein the U refers to an enzyme activity unit of β-glucosidase, and wherein 1 μmol of glucose produced per min of enzymatic hydrolysis of cellobiose per mL of the Aspergillus niger solid-state fermentation liquid is defined as an enzyme activity unit of β-glucosidase.
[0023] Preferably, the seed culture medium comprises, in parts by weight, 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of ferric sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate, and 0.001-0.01 parts of cobalt chloride.
[0024] More preferably, the seed culture medium comprises 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of ferric sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.
[0025] Most preferably, the yeast extract powder is yeast extract powder F902.
[0026] Preferably, the seed culture medium further comprises water.
[0027] Preferably, the seed culture medium comprises glucose at a concentration of 1-30 g / L, yeast extract powder at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, ferric sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L, and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water.
[0028] More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or ferric sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.
[0029] Preferably, the solid-state fermentation medium comprises 1-20 parts of a small molecule inducer by weight, wherein the small molecule inducer is one or more of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose, and a substance containing sophoroside.
[0030] More preferably, the small molecule inducer is xylose.
[0031] More preferably, the substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.
[0032] Preferably, the solid-state fermentation medium further comprises: a substance containing lignocellulose, ammonium sulfate, urea, and calcium chloride.
[0033] Preferably, the solid-state fermentation medium comprises: 30-90 parts of a substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride, and 1-20 parts of a small molecule inducer by weight.
[0034] More preferably, the solid-state fermentation medium comprises: 30-75 parts of a substance containing lignocellulose, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of a small molecule inducer by weight.
[0035] Preferably, the substance containing lignocellulose comprises one or more of bran, straw, and corncob.
[0036] Preferably, the substance containing lignocellulose is a combination of bran, straw, and corncob.
[0037] Preferably, the substance containing lignocellulose is 10-30 parts of bran, 10-30 parts of straw, and 10-30 parts of corncob by weight.
[0038] Preferably, the substance containing lignocellulose is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corncob by weight.
[0039] Preferably, the solid state fermentation medium further comprises water.
[0040] Preferably, the solid state fermentation medium comprises lignocellulose-containing material at a concentration of 30-90 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, and a small molecule inducer at a concentration of 1-20 g / L, with the remainder being water.
[0041] Preferably, the solid state fermentation medium comprises lignocellulose-containing material at a concentration of 30-75 g / L, and / or ammonium sulfate at a concentration of 6-20 g / L, and / or urea at a concentration of 2-12 g / L, and / or calcium chloride at a concentration of 0.5-2 g / L, and / or a small molecule inducer at a concentration of 1-18 g / L, with the remainder being water.
[0042] Preferably, the solid state fermentation medium further comprises water.
[0043] Preferably, the solid state fermentation medium comprises bran at a concentration of 10-30 g / L, straw at a concentration of 10-30 g / L, corncob at a concentration of 10-30 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, and a small molecule inducer at a concentration of 1-20 g / L, with the remainder being water.
[0044] Preferably, the solid state fermentation medium comprises bran at a concentration of 10-25 g / L, and / or straw at a concentration of 10-25 g / L, and / or corncob at a concentration of 10-25 g / L, and / or ammonium sulfate at a concentration of 5-25 g / L, and / or urea at a concentration of 1-15 g / L, and / or calcium chloride at a concentration of 0.5-3 g / L, and / or a small molecule inducer at a concentration of 1-20 g / L, with the remainder being water.
[0045] In a sixth aspect, the present application provides a preparation method of a solid state fermentation liquid of Aspergillus niger, comprising the following steps: amplifying culture of the Aspergillus niger to obtain a spore suspension of Aspergillus niger; inoculating the spore suspension of Aspergillus niger into a seed culture medium to culture, to obtain a seed liquid of Aspergillus niger; and inoculating the seed liquid of Aspergillus niger into a solid state fermentation medium to culture, to obtain the solid state fermentation liquid of Aspergillus niger.
[0046] Preferably, the preparation method comprises the following steps:
[0047] (a) amplifying culture of the Aspergillus niger of any one of claims 1-5 to obtain a spore suspension of Aspergillus niger;
[0048] (b) inoculating the Aspergillus niger spore suspension obtained in step (a) into a seed culture medium to culture, obtaining an Aspergillus niger seed liquid;
[0049] (c) inoculating the Aspergillus niger seed liquid obtained in step (b) into a solid-state fermentation culture medium to culture, obtaining an Aspergillus niger solid-state fermentation product;
[0050] (d) mixing, soaking, stirring and filtering the Aspergillus niger solid-state fermentation product obtained in step (c) with a buffer solution to obtain a crude enzyme liquid;
[0051] (e) concentrating the crude enzyme liquid obtained in step (d) to obtain a concentrated liquid, i.e., an Aspergillus niger solid-state fermentation liquid.
[0052] More preferably, in step (a), 10 6 -10 7 spores of the Aspergillus niger according to any one of claims 1-5.
[0053] More preferably, the culture temperature in step (a) is 26-30°C; and / or the culture temperature in step (b) is 26-30°C; and / or the culture temperature in step (c) is 27-29°C.
[0054] More preferably, the culture time in step (a) is 24-48h; and / or the culture time in step (b) is 24-48h; and / or the culture time in step (c) is 100-144h.
[0055] More preferably, the rotation speed in step (b) is 150-300rmp.
[0056] More preferably, the culture pH in step (c) is 4.5-5.5.
[0057] More preferably, the culture humidity in step (c) is 50-95%.
[0058] More preferably, in step (d), the volume ratio of the mixing of the Aspergillus niger solid-state fermentation product and the buffer solution is (0.8-1.2):(6-10).
[0059] More preferably, the soaking time in step (d) is 1-4h.
[0060] More preferably, the stirring speed in step (d) is 100-300rpm.
[0061] More preferably, the stirring time in step (d) is 20-50min.
[0062] More preferably, the filtration in step (d) is plate-and-frame filtration.
[0063] More preferably, in step (e), the concentration is ultrafiltration concentration.
[0064] Most preferably, the membrane for ultrafiltration concentration has a pore size of 10-60 kD.
[0065] Most preferably, the ultrafiltration concentration time is 1-5 h.
[0066] In a seventh aspect, the present application provides a solid-state fermentation liquid of Aspergillus niger prepared by the preparation method.
[0067] In an eighth aspect, the present application provides a lignocellulose hydrolysis sugar liquid prepared by hydrolysis in a system containing the Aspergillus niger, or the Aspergillus niger agent, or the solid-state fermentation liquid of Aspergillus niger.
[0068] Preferably, the lignocellulose is one or a combination of both of agricultural waste and forestry waste.
[0069] More preferably, the agricultural waste is one or a combination of both of sugarcane residue and straw.
[0070] Preferably, the lignocellulose hydrolysis sugar liquid contains a reduced sugar mass ratio of 90% or more, wherein the reduced sugar mass ratio refers to the percentage of the mass m2 of the reduced sugar converted from the lignocellulose raw material through enzymatic hydrolysis to the total mass m1 of the cellulose and hemicellulose contained in the lignocellulose raw material before hydrolysis.
[0071] Preferably, the Aspergillus niger, or the Aspergillus niger agent, or the solid-state fermentation liquid of Aspergillus niger is applied in the preparation of a lignocellulose hydrolysis sugar liquid. BRIEF DESCRIPTION OF DRAWINGS
[0072] Figure 1 The figure shows the colony morphology of Aspergillus niger AGM01;
[0073] Figure 2 The figure shows the phylogenetic tree result of Aspergillus niger AGM01 based on ITS gene sequence.
[0074] Strain preservation information
[0075] The Aspergillus niger (Aspergillus niger) AGM01 provided by the present application is preserved in the China Center for Type Culture Collection on April 24, 2024, and the preservation number is CCTCC NO: M 2024768, and the preservation address is Wuhan, China, Wuhan University, the postal code is 430072, and the telephone number is 027-68754052. Aspergillus niger
[0076] Advantages of the present application:
[0077] (1) The Aspergillus niger AGM01 provided by the present application has a high enzyme activity of beta-glucosidase.
[0078] (2) The Aspergillus niger AGM01 is fermented by a solid-state fermentation medium containing a small molecule inducer, and the obtained solid-state fermentation liquid of the Aspergillus niger can improve the enzyme activity of beta-glucosidase in the solid-state fermentation liquid. DETAILED DESCRIPTION
[0079] In order to better understand the above technical solutions, the technical solutions of the present application will be clearly and completely explained and described in combination with specific embodiments. It should be noted that the contents in the specific embodiments are only the specific implementation and explanation of the technical solutions of the present application, and should not be understood as a limitation on the protection scope of the present application.
[0080] In the prior art, corn cob is usually used as a main carbon source to induce strains to produce beta-glucosidase, and a semi-solid fermentation method is used for cultivation, but this method in the prior art often leads to a low enzyme activity of the produced beta-glucosidase, which is difficult to meet the needs of industrial production.
[0081] In order to solve the problems in the prior art, the present application provides the following technical solutions:
[0082] (1) An Aspergillus niger, characterized in that the Aspergillus niger is Aspergillus niger (AGM01) and is preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO: M 2024768. Aspergillus niger
[0083] (2) The Aspergillus niger according to the technical solution (1), characterized in that the ITS gene sequence of the Aspergillus niger AGM01 is shown in SEQ ID NO. 3.
[0084] (3) The Aspergillus niger according to the technical solution (1) or (2), characterized in that the Aspergillus niger AGM01 has the property of producing beta-glucosidase; preferably, the enzyme activity of beta-glucosidase of the Aspergillus niger AGM01 is 20-30 U, wherein the U refers to one enzyme activity unit of beta-glucosidase, and wherein 1 μmol of glucose produced per min of enzyme hydrolysis of cellobiose is defined as one enzyme activity unit of beta-glucosidase per mL of crude enzyme solution of the Aspergillus niger AGM01.
[0085] The crude enzyme solution of Aspergillus niger AGM01 is prepared by the following method: Aspergillus niger is amplified and cultured to obtain an Aspergillus niger spore suspension, the Aspergillus niger spore suspension is fermented and cultured, preferably for 5-7 days to obtain a fermentation broth, and then solid-liquid separation is performed to obtain a supernatant, i.e., the crude enzyme solution of Aspergillus niger AGM01.
[0086] (4) A fermentation preparation method of an Aspergillus niger agent, characterized in that the fermentation preparation method comprises the following steps:
[0087] (a) amplifying and culturing the Aspergillus niger according to any one of technical solutions (1)-(3) to obtain an Aspergillus niger spore suspension;
[0088] (b) fermenting and culturing the Aspergillus niger spore suspension obtained in step (a).
[0089] (5) The fermentation preparation method according to technical solution (4), characterized in that in step (a), 10 6 -10 7 spores of the Aspergillus niger according to any one of technical solutions (1)-(3) are contained in each mL of the Aspergillus niger spore suspension.
[0090] Preferably, the culture temperature in step (a) is 26-30°C, and / or the culture time is 24-48 h; and / or in step (b), the fermentation culture temperature is 26-32°C.
[0091] (6) An Aspergillus niger agent, characterized in that it contains the Aspergillus niger according to any one of technical solutions (1)-(3).
[0092] (7) The Aspergillus niger agent according to technical solution (6), characterized in that it is obtained by the fermentation preparation method according to technical solution (4) or (5).
[0093] (8) An Aspergillus niger solid-state fermentation broth, characterized in that it contains the Aspergillus niger according to any one of technical solutions (1)-(3), wherein the enzyme activity of β-glucosidase in the Aspergillus niger solid-state fermentation broth is 110-170 U, wherein the U refers to one enzyme activity unit of β-glucosidase, and wherein 1 μmol of glucose produced per min of enzymatic hydrolysis of cellobiose is defined as one enzyme activity unit of β-glucosidase.
[0094] (9) The Aspergillus niger solid-state fermentation liquor according to technical solution (8), characterized in that the Aspergillus niger solid-state fermentation liquor is prepared by a method comprising the following steps: culturing the Aspergillus niger according to any one of technical solutions (1) to (3) to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium to culture to obtain an Aspergillus niger seed liquor; and inoculating the Aspergillus niger seed liquor into a solid-state fermentation culture medium to culture to obtain the Aspergillus niger solid-state fermentation liquor.
[0095] (10) The Aspergillus niger solid-state fermentation liquor according to technical solution (8) or (9), characterized in that, by weight, the seed culture medium comprises 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of ferric sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate, and 0.001-0.01 parts of cobalt chloride.
[0096] Preferably, the seed culture medium comprises 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of ferric sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.
[0097] (11) The Aspergillus niger solid-state fermentation liquor according to any one of technical solutions (8) to (10), characterized in that the seed culture medium further comprises water,
[0098] Preferably, the seed culture medium comprises glucose at a concentration of 1-30 g / L, yeast extract powder at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, ferric sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L, and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water.
[0099] More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or ferric sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.
[0100] (12) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8) to (11), characterized in that the yeast extract is yeast extract F902.
[0101] (13) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8) to (12), characterized in that the solid-state fermentation medium comprises 1-20 parts of small molecule inducers in terms of weight, wherein the small molecule inducers are one or more than one of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and a substance containing sophoroside.
[0102] Preferably, the small molecule inducers are xylose.
[0103] Preferably, the substance containing sophoroside is kaempferol-3-O-beta-D-sophoroside.
[0104] (14) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8) to (13), characterized in that the solid-state fermentation medium further comprises: a substance containing lignocellulose, ammonium sulfate, urea and calcium chloride.
[0105] Preferably, the solid-state fermentation medium comprises: 30-90 parts of the substance containing lignocellulose, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of small molecule inducers in terms of weight.
[0106] More preferably, the solid-state fermentation medium comprises: 30-75 parts of the substance containing lignocellulose, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of small molecule inducers in terms of weight.
[0107] (15) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8) to (14), characterized in that the substance containing lignocellulose comprises: one or more than one of bran, straw and corncob.
[0108] Preferably, the substance containing lignocellulose is a combination of bran, straw and corncob.
[0109] More preferably, the lignocellulose-containing substance is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corn cob by weight;
[0110] Most preferably, the lignocellulose-containing substance is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corn cob by weight.
[0111] (16) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8)-(15), characterized in that the solid-state fermentation culture medium further comprises: water,
[0112] Preferably, the solid-state fermentation culture medium comprises: lignocellulose-containing substance at a concentration of 30-90 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L and small molecule inducer at a concentration of 1-20 g / L, and the rest is water;
[0113] More preferably, the solid-state fermentation culture medium comprises: lignocellulose-containing substance at a concentration of 30-75 g / L, ammonium sulfate at a concentration of 6-20 g / L, urea at a concentration of 2-12 g / L, calcium chloride at a concentration of 0.5-2 g / L and small molecule inducer at a concentration of 1-18 g / L, and the rest is water.
[0114] (17) The solid-state fermentation liquor of Aspergillus niger according to any one of technical solutions (8)-(16), characterized in that the solid-state fermentation culture medium further comprises: water,
[0115] Preferably, the solid-state fermentation culture medium comprises: bran at a concentration of 10-30 g / L, straw at a concentration of 10-30 g / L and corn cob at a concentration of 10-30 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L and small molecule inducer at a concentration of 1-20 g / L, and the rest is water;
[0116] More preferably, the solid-state fermentation culture medium comprises: bran at a concentration of 10-25 g / L, and / or straw at a concentration of 10-25 g / L, and / or corn cob at a concentration of 10-25 g / L, and / or ammonium sulfate at a concentration of 5-25 g / L, and / or urea at a concentration of 1-15 g / L, and / or calcium chloride at a concentration of 0.5-3 g / L, and / or small molecule inducer at a concentration of 1-20 g / L, and the rest is water.
[0117] (18) The preparation method of the Aspergillus niger solid-state fermentation broth according to any one of technical solutions (8)-(17), characterized in that it comprises the following steps: culturing the Aspergillus niger according to any one of technical solutions (1)-(3) to obtain an Aspergillus niger spore suspension; inoculating the Aspergillus niger spore suspension into a seed culture medium to obtain an Aspergillus niger seed broth; and inoculating the Aspergillus niger seed broth into a solid-state fermentation culture medium to obtain the Aspergillus niger solid-state fermentation broth.
[0118] (19) The preparation method according to technical solution (18), characterized in that it comprises the following steps:
[0119] (a) culturing the Aspergillus niger according to any one of technical solutions (1)-(3) to obtain an Aspergillus niger spore suspension, preferably, 10 6 -10 7 spores of the Aspergillus niger according to any one of technical solutions (1)-(3) per mL of the Aspergillus niger spore suspension,
[0120] (b) inoculating the Aspergillus niger spore suspension obtained in step (a) into a seed culture medium to obtain an Aspergillus niger seed broth;
[0121] (c) inoculating the Aspergillus niger seed broth obtained in step (b) into a solid-state fermentation culture medium to obtain an Aspergillus niger solid-state fermentation broth;
[0122] (d) mixing, soaking, stirring and filtering the Aspergillus niger solid-state fermentation broth obtained in step (c) with a buffer solution to obtain a crude enzyme solution;
[0123] (e) concentrating the crude enzyme solution obtained in step (d) to obtain a concentrated solution, i.e., the Aspergillus niger solid-state fermentation broth.
[0124] (20) The preparation method according to technical solution (18) or (19), characterized in that, in step (a), the temperature for the amplification culture is 26-30°C, and / or the amplification culture time is 24-48h;
[0125] and / or in step (b), the culture temperature is 26-30°C, and / or the culture rotation speed is 150-300rmp, and / or the culture time is 24-48h;
[0126] and / or in step (c), the culture temperature is 27-29°C, and / or the culture pH is 4.5-5.5, and / or the culture humidity is 50-95%, and / or the culture time is 100-144h.
[0127] (21) The preparation method according to any one of the technical solutions (18) - (20), characterized in that, in step (d), the volume ratio of the mixture of the Aspergillus niger solid-state fermentation product and the buffer solution is (0.8-1.2):(6-10).
[0128] and / or the soaking time is 1-4h;
[0129] and / or the stirring speed is 100-300rpm; and / or the stirring time is 20-50min;
[0130] and / or the filtration is plate-and-frame filtration.
[0131] (22) The preparation method according to any one of the technical solutions (18) - (21), characterized in that, in step (e), the concentration is ultrafiltration concentration; preferably, the membrane for the ultrafiltration concentration has a pore size of 10-60kD, and / or the ultrafiltration concentration time is 1-5h.
[0132] (23) A lignocellulose hydrolysis sugar solution, characterized in that it is obtained by hydrolysis in a system of the Aspergillus niger solid-state fermentation liquid prepared by the Aspergillus niger or the Aspergillus niger inoculum according to any one of the technical solutions (1) - (3) or (6) or (7) or the preparation method according to any one of the technical solutions (8) - (17) or (18) - (22).
[0133] Preferably, the lignocellulose hydrolysis sugar solution contains a reduced sugar mass ratio of 90% or more, wherein the reduced sugar mass ratio refers to the percentage of the mass m2 of the reduced sugar converted from the lignocellulose raw material by enzymatic hydrolysis in the total mass m1 of the cellulose and hemicellulose contained in the lignocellulose raw material before hydrolysis.
[0134] (24) The use of the Aspergillus niger according to any one of the technical solutions (1) - (3) or the Aspergillus niger inoculum according to (6) or (7) or the Aspergillus niger solid-state fermentation liquid according to any one of the technical solutions (8) - (17) or the Aspergillus niger solid-state fermentation liquid prepared by the preparation method according to any one of the technical solutions (18) - (22) in the preparation of a lignocellulose hydrolysis sugar solution.
[0135] (25) The lignocellulose hydrolysis sugar solution according to the technical solution (23) or the use according to the technical solution (24), characterized in that the lignocellulose is one or a combination of both of agricultural waste and forestry waste; preferably, the agricultural waste is one or a combination of both of bagasse and straw.
[0136] (26) A seed culture medium, characterized in that the seed culture medium comprises, in parts by weight, 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of ferric sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate, and 0.001-0.01 parts of cobalt chloride.
[0137] (27) A solid-state fermentation culture medium, characterized in that the solid-state fermentation culture medium comprises, in parts by weight, 1-20 parts of a small molecule inducer, wherein the small molecule inducer is one or more than one of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose, and a substance containing sophoroside.
[0138] The present application also provides a first set of technical solutions for the culture medium to solve the above technical problems.
[0139] 1.1. A seed culture medium, characterized in that the seed culture medium comprises, in parts by weight, 1-30 parts of glucose, 5-20 parts of yeast extract powder, 0.1-0.4 parts of magnesium sulfate, 1-4 parts of potassium dihydrogen phosphate, 0.2-2 parts of calcium chloride, 0.001-0.01 parts of ferric sulfate, 0.001-0.01 parts of manganese sulfate, 0.001-0.01 parts of zinc sulfate, and 0.001-0.01 parts of cobalt chloride.
[0140] Preferably, the seed culture medium comprises 5-20 parts of glucose, and / or 5-15 parts of yeast extract powder, and / or 0.2-0.35 parts of magnesium sulfate, and / or 1-2 parts of potassium dihydrogen phosphate, and / or 0.5-1.5 parts of calcium chloride, and / or 0.001-0.008 parts of ferric sulfate, and / or 0.001-0.008 parts of manganese sulfate, and / or 0.001-0.008 parts of zinc sulfate, and / or 0.001-0.008 parts of cobalt chloride.
[0141] 1.2. The seed culture medium according to technical solution 1.1, characterized in that the seed culture medium further comprises water.
[0142] Preferably, the seed culture medium comprises glucose at a concentration of 1-30 g / L, yeast extract powder at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, ferric sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L, and cobalt chloride at a concentration of 1-10 mg / L, and the rest is water.
[0143] More preferably, the seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or ferric sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, and the rest is water.
[0144] 1.3. The seed culture medium according to technical solution 1.1 or 1.2, characterized in that the yeast extract is yeast extract F902.
[0145] 1.4. A preparation method of the seed culture medium according to any one of technical solutions 1.1-1.3, characterized in that the method comprises the following steps: mixing glucose, yeast extract, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, ferric sulfate, manganese sulfate, zinc sulfate and cobalt chloride to obtain the seed culture medium.
[0146] 1.5. The preparation method according to technical solution 1.4, characterized in that the method comprises the following steps: mixing glucose, yeast extract, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, ferric sulfate, manganese sulfate, zinc sulfate, cobalt chloride and water to obtain the seed culture medium.
[0147] 1.6. The seed culture medium according to any one of technical solutions 1.1-1.3 or the seed culture medium prepared by the preparation method according to technical solution 1.4 or 1.5, characterized in that the seed culture medium is used to culture fungi to obtain a fungal seed liquid; preferably, the fungi are Aspergillus niger; more preferably, the Aspergillus niger is Aspergillus niger AGM01, with a preservation number of CCTCC NO: M 2024768.
[0148] In order to solve the above technical problems, the present application also provides a second set of technical solutions of the culture medium:
[0149] 2.1. A solid-state fermentation culture medium, characterized in that the solid-state fermentation culture medium comprises 1-20 parts of a small molecule inducer by weight, wherein the small molecule inducer is one or more than one of xylose, cellobiose, lactose, sophorose, gentiobiose, xylose and a substance containing sophoroside.
[0150] Preferably, the small molecule inducer is xylose.
[0151] Preferably, the substance containing sophoroside is kaempferol-3-O-β-D-sophoroside.
[0152] 2.2. The solid-state fermentation medium according to technical solution 2.1, characterized in that the solid-state fermentation medium further comprises lignocellulose-containing material, ammonium sulfate, urea and calcium chloride;
[0153] Preferably, the solid-state fermentation medium comprises, in parts by weight, 30-90 parts of lignocellulose-containing material, 5-25 parts of ammonium sulfate, 1-15 parts of urea, 0.5-3 parts of calcium chloride and 1-20 parts of small molecule inducer;
[0154] More preferably, the solid-state fermentation medium comprises, in parts by weight, 30-75 parts of lignocellulose-containing material, and / or 6-20 parts of ammonium sulfate, and / or 2-12 parts of urea, and / or 0.5-2 parts of calcium chloride, and / or 1-18 parts of small molecule inducer.
[0155] 2.3. The solid-state fermentation medium according to technical solution 2.1 or 2.2, characterized in that the lignocellulose-containing material comprises one or more than one of bran, straw and corncob,
[0156] Preferably, the lignocellulose-containing material is a combination of bran, straw and corncob;
[0157] More preferably, the lignocellulose-containing material is 10-30 parts of bran, 10-30 parts of straw and 10-30 parts of corncob, in parts by weight;
[0158] Most preferably, the lignocellulose-containing material is 10-25 parts of bran, and / or 10-25 parts of straw, and / or 10-25 parts of corncob, in parts by weight.
[0159] 2.4. The solid-state fermentation medium according to any one of technical solutions 2.1-2.3, characterized in that the solid-state fermentation medium further comprises water,
[0160] Preferably, the solid-state fermentation medium comprises lignocellulose-containing material at a concentration of 30-90 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L and small molecule inducer at a concentration of 1-20 g / L, and the rest is water;
[0161] More preferably, the solid-state fermentation medium comprises lignocellulose-containing material at a concentration of 30-75 g / L, and / or ammonium sulfate at a concentration of 6-20 g / L, and / or urea at a concentration of 2-12 g / L, and / or calcium chloride at a concentration of 0.5-2 g / L, and / or small molecule inducer at a concentration of 1-18 g / L, and the rest is water.
[0162] 2.5. The solid fermentation medium according to any one of technical solutions 2.1-2.4, characterized in that the solid fermentation medium comprises: wheat bran at a concentration of 10-30 g / L, straw at a concentration of 10-30 g / L, corn cob at a concentration of 10-30 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, and a small molecule inducer at a concentration of 1-20 g / L, with the remainder being water;
[0163] Preferably, the solid-state fermentation medium comprises: wheat bran at a concentration of 10-25 g / L, and / or straw at a concentration of 10-25 g / L, and / or corn cob at a concentration of 10-25 g / L, and / or ammonium sulfate at a concentration of 5-25 g / L, and / or urea at a concentration of 1-15 g / L, and / or calcium chloride at a concentration of 0.5-3 g / L, and / or a small molecule inducer at a concentration of 1-20 g / L, with the remainder being water.
[0164] 2.6. The method for preparing the solid fermentation culture medium according to any one of technical solutions 2.1-2.5 is characterized in that it includes: mixing a substance containing lignocellulose, ammonium sulfate, urea, calcium chloride and a small molecule inducer to obtain a solid fermentation culture medium.
[0165] 2.7. The method for preparing solid fermentation culture medium according to technical solution 2.6 is characterized in that it includes: mixing a substance containing lignocellulose, ammonium sulfate, urea, calcium chloride, a small molecule inducer and water to obtain a solid fermentation culture medium.
[0166] 2.8. The solid fermentation culture medium of any one of technical solutions 2.1-2.5 or the solid fermentation culture medium prepared by the preparation method of technical solutions 2.6 or 2.7, characterized in that the solid fermentation culture medium is used to culture fungi to obtain fungal solid fermentation broth; preferably, the fungus is Aspergillus niger; more preferably, the Aspergillus niger is Aspergillus niger AGM01, with accession number: CCTCC NO: M 2024768.
[0167] The Aspergillus niger provided by this invention ( Aspergillus niger AGM01 was deposited at the China Center for Type Culture Collection (CCTCC) on April 24, 2024, with accession number CCTCC NO: M 2024768. The depository address is Wuhan University, Wuhan, China, postal code: 430072; telephone: 027-68754052.
[0168] To better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0169] The preparation of the culture media and reagents involved in the examples is shown below:
[0170] 1. Aescin solid medium (g / L): 1 g aescin, 2.5 g ferric ammonium citrate, 2.8 g ammonium sulfate, 4.0 g potassium dihydrogen phosphate, 0.9 g magnesium sulfate heptahydrate, 0.9 g calcium chloride dihydrate, 40 g corn cob juice, 20 g agar and sterile water are mixed and diluted to 1 L with sterile water, and sterilized at 115°C for 30 min to obtain the aescin solid medium.
[0171] 2. The preparation method of the PDA solid medium is as follows:
[0172] (1) 200 g of potatoes are cut into small pieces and mixed with 1 L of water, heated to boiling and maintained for 20-30 min, filtered with 2 layers of gauze while hot and the filtrate is reserved, and the filtrate is mixed with water to obtain 1 L of mixed solution.
[0173] (2) 1 L of the mixed solution obtained in step (1), 20 g of glucose and 15-20 g of agar (broken in advance) are mixed and heated, and after the agar is completely dissolved, water is added to 1 L to complete the preparation of the PDA solid medium.
[0174] 3. 10 mmol / L cellobiose solution: 3.42 g of cellobiose is mixed with distilled water and diluted to 1 L with distilled water to obtain a 10 mmol / L cellobiose solution.
[0175] 4. 5.55 mmol / L glucose standard solution: 0.999 g of glucose is mixed with distilled water and diluted to 1 L with distilled water to obtain a 5.55 mmol / L cellobiose solution.
[0176] The various reagents / instruments used in the embodiments of the present application are all conventional commercially available products unless otherwise specified. The experimental reagent information used in the present application is shown in Table 1 below, and the experimental instrument information used in the present application is shown in Table 2 below:
[0177]
[0178]
[0179] Example 1 Strain isolation and identification
[0180] 10 g of soil containing Jilin chicken and goose feces collected from Zuojia Town, Changyi District, Jilin City, Jilin Province is dissolved in 50 mL of sterile water to obtain a mixed solution, and the mixed solution is gradiently diluted, and then 10 -2 and 10 -3The mixed solution is coated on a plate of esculin solid culture medium, and after 36 hours of culture at 28°C, a single colony with obvious black color on the plate is selected as a dominant strain. The single colony of the dominant strain has a texture as shown in Figure 1 Then, the single colony is purified once according to a purification method, that is, the single colony is picked on PDA liquid culture medium and cultured at 28°C and 250 rpm for 36 hours to obtain a spore suspension purified once. Then, the spore suspension purified once is divided and streaked on a plate of esculin solid culture medium and cultured at 29°C for 24 hours. After that, a single colony is picked and purified twice according to the above purification method to obtain a spore suspension purified twice. The spore suspension purified twice is inoculated on PDA solid culture medium and cultured at 28°C for 24 hours, and then the colony morphology is observed.
[0181] A strain is obtained, and the colony of the strain is black-brown, the conidium is spherical, black or black-brown, and smooth or rough. The genomic sequence of the strain is extracted by using primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO. 1) and ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO. 2) to amplify the gene sequence. After 1% gel electrophoresis detection and sequencing, the sequence is analyzed and compared with the sequence in GenBank. If the sequence similarity is greater than 99%, it is the same species. The ITS gene sequence of the strain is measured as shown in SEQ ID NO. 3. The PCR reaction system is specifically shown in Table 3, and the PCR reaction procedure is specifically shown in Table 4.
[0182]
[0183]
[0184]
[0185] SEQ ID NO. 3:
[0186] TCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGA ACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCA GAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGGTCGCCGTCCCCCTCT CCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTCTTTCCAGGT
[0187] A phylogenetic tree was constructed using MEGA11.0 based on the ITS gene sequence shown in SEQ ID NO.3. The constructed phylogenetic tree is as follows: Figure 2 As shown, from Figure 2 The phylogenetic tree shows that this strain is most closely related to *Aspergillus niger*. Further morphological analysis and molecular identification confirmed that this bacterium is *Aspergillus niger*. Aspergillus niger AGM01 was deposited at the China Center for Type Culture Collection on April 24, 2024, with accession number CCTCC NO: M2024768. Figure 2 The figure shown is a phylogenetic tree constructed based on the ITS gene sequence of Aspergillus niger AGM01.
[0188] Example 2: The ability of Aspergillus niger AGM01 to produce β-glucosidase and protein
[0189] (1) Preparation of crude enzyme solution of Aspergillus niger AGM01: Take 1 mL of the spore suspension that has been purified twice and dilute it to 10. -2 10 -3 The hemocytometer was used to observe and count the cells under a microscope at 40×10 magnification. 1 mL of a solution containing 10... 7A spore suspension of Aspergillus niger AGM01 spores was inoculated into a shake flask and fermented at 28°C and 200 rpm to obtain a fermentation broth. The fermentation broth cultured for 7 days was centrifuged at 8000 rpm for 10 min, and the supernatant was retained, which is the crude enzyme solution of Aspergillus niger AGM01.
[0190] (2) Determination of β-glucosidase activity in crude enzyme solution of Aspergillus niger AGM01 using cellobiose as substrate:
[0191] It should be noted that, using cellobiose as a substrate, β-glucosidase reacts with cellobiose to produce 2 molecules of glucose. The glucose is then converted into gluconic acid and hydrogen peroxide by glucose oxidase. Under the action of peroxidase, hydrogen peroxide couples and condenses reduced 4-aminoantipyrine with phenol to form a quinone compound that can be measured by a spectrophotometer.
[0192] (2.1) Determination of the absorbance of the crude enzyme solution of Aspergillus niger AGM01 at a wavelength of 505 nm: The crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was centrifuged at 10000 rpm for 5 min. 100 mL of the supernatant was added to 100 mL of 10 mmol / L cellobiose solution and heated in a water bath at 60 °C for 10 min to obtain the reaction system. Then, 2.5 mL of the reaction system was mixed with the reagents in a 250 mL glucose assay kit and incubated at 37 °C for 10 min. The absorbance was measured at a wavelength of 505 nm to obtain the absorbance value of the crude enzyme solution of Aspergillus niger AGM01 at a wavelength of 505 nm.
[0193] (2.2) Determine the absorbance of the crude enzyme solution of Asperillium niger Q270-C6 at a wavelength of 505 nm: The determination method is the same as step (2.1). Asperillium niger Q270-C6 has been disclosed in Chinese patent application with patent number CN117143739A. The preservation number of this strain is: CCTCCNO: M20231261.
[0194] (2.3) Blank group: The absorbance value of the crude enzyme solution of Aspergillus niger AGM01 after inactivation was measured at a wavelength of 505 nm. Specifically, the crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was centrifuged at 10,000 rpm for 5 min to obtain 100 mL of supernatant, which was added to 100 mL of a 10 mmol / L cellobiose solution. After inactivation at 80°C for 30 min, a reaction system was obtained. Then, 2.5 mL of the reaction system was mixed with 250 mL of reagents in the glucose determination kit, and incubated at 37°C for 10 min. The absorbance value was measured at a wavelength of 505 nm to obtain the absorbance value of the crude enzyme solution of Aspergillus niger AGM01 after inactivation at a wavelength of 505 nm.
[0195] (3) Method for calculating the enzyme activity of β-glucosidase: The absorbance values of the crude enzyme solutions of Aspergillus niger obtained in steps (2.1) and (2.2) were compared with a 5.55 mmol / L glucose standard solution to calculate the glucose concentration, wherein the glucose concentration = ((absorbance value of the crude enzyme solution of Aspergillus niger - absorbance value of the blank group) / (absorbance value of the standard - absorbance value of the blank group)) x 5.55, and 5.55 is the concentration of glucose in the glucose standard solution. Then, the enzyme activity of β-glucosidase was calculated according to the enzyme activity formula of β-glucosidase, wherein the enzyme activity formula of β-glucosidase is as follows:
[0196]
[0197] wherein U represents the enzyme activity of β-glucosidase; A represents the glucose concentration, in units of μmol / mL; N represents the dilution factor, wherein the dilution factor in this example is 200; t represents the reaction time, in units of min; V1 represents the volume of the reaction system, in units of mL; and V2 represents the volume of the crude enzyme solution of Aspergillus niger AGM01, in units of mL.
[0198] Definition of one enzyme activity unit of β-glucosidase: The amount of enzyme required to produce 1 μmol of glucose per min per mL of the crude enzyme solution of Aspergillus niger AGM01 under the conditions of 60°C and pH 5 is defined as one enzyme activity unit (U) of β-glucosidase.
[0199] According to the method for calculating the enzyme activity of β-glucosidase in step (3), the comparison results of the enzyme activity of β-glucosidase in Aspergillus niger are shown in Table 5:
[0200]
[0201] (3) Determination of protein content in the crude enzyme solution of Aspergillus niger AGM01
[0202] The 1 mL of the crude enzyme solution of Aspergillus niger AGM01 obtained in step (1) was diluted to 10 mL with a volumetric flask to obtain a diluted crude enzyme solution. The crude enzyme solution was centrifuged at 10,000 rpm for 5 min to obtain a supernatant. 5 μL of the supernatant was mixed with 250 μL of Coomassie brilliant blue dye to stand for 5 min to obtain a mixed solution. The absorbance value of the mixed solution at 595 nm was measured by an enzyme marker instrument. The absorbance value was compared with a protein standard curve to obtain the protein content of the crude enzyme solution as 1.5 mg / mL.
[0203] The protein standard curve was obtained by taking the measured absorbance value of each protein standard at 595 nm as the ordinate and the corresponding protein standard concentration as the abscissa, as follows: y = 0.5716x + 0.5075, R 2 = 0.9968.
[0204] Example 3
[0205] 1. Example 3.1 provides a preparation method of Aspergillus niger solid-state fermentation liquid, as shown below:
[0206] (1) Preparation of seed medium: glucose, yeast extract F902, magnesium sulfate, potassium dihydrogen phosphate, calcium chloride, ferric sulfate, manganese sulfate, zinc sulfate, cobalt chloride and sterile water were mixed and sterilized at 115°C for 30 min to obtain a seed medium. In the seed medium, the concentration of glucose was 20 g / L, the concentration of yeast extract F902 was 15 g / L, the concentration of magnesium sulfate was 0.3 g / L, the concentration of potassium dihydrogen phosphate was 2.5 g / L, the concentration of calcium chloride was 1.2 g / L, the concentration of ferric sulfate was 7 mg / L, the concentration of manganese sulfate was 6 mg / L, the concentration of zinc sulfate was 4 mg / L, and the concentration of cobalt chloride was 6 mg / L, and the rest was water.
[0207] (2) The spore suspension of Aspergillus niger AGM01 was inoculated into the seed medium obtained in step (1) at 10% by volume, and cultured at 28°C and 200 rpm for 36 h to obtain a seed solution.
[0208] (3) Preparation of xylose-induced solid-state fermentation medium: powder bran, powder straw, powder corn cob, ammonium sulfate, urea, calcium chloride, xylose and sterile water were mixed and sterilized at 115°C for 30 min to obtain a solid-state fermentation medium. Among them, the concentration of bran in the solid-state fermentation medium is 20 g / L, the concentration of straw is 25 g / L, the concentration of corn cob is 22 g / L, the concentration of ammonium sulfate is 15 g / L, the concentration of urea is 10 g / L, the concentration of calcium chloride is 2.2 g / L and the concentration of xylose is 2.5 g / L, and the rest is water.
[0209] (4) Preparation of xylose-induced crude enzyme liquid: the seed liquid obtained in step (2) was inoculated into the xylose-induced solid-state fermentation medium obtained in step (3) at a 5% volume inoculation amount, and fermented at 28°C, pH=5, humidity of 80% for 120h to obtain a solid-state fermentation product. Then, according to the volume ratio of solid-state fermentation product to pH=5 phosphate buffer solution=1:8, it was mixed and soaked for 2h, then stirred at a speed of 120rpm for 20min, and then plate and frame filtration was performed to obtain a xylose-induced crude enzyme liquid.
[0210] (5) Preparation of xylose-induced concentrated liquid: the xylose-induced crude enzyme liquid obtained in step (4)
[0211] and step (4) was subjected to ultrafiltration concentration under the condition of membrane aperture of 30kD and water flux of 80L / m 2 h to obtain a xylose-induced concentrated liquid.
[0212] 2, Comparative Example 3.1 provides a preparation method of Aspergillus niger solid-state fermentation liquid, which is shown as follows:
[0213] Steps (1)-(2) are the same as Example 3.1.
[0214] (3) Preparation of xylose-induced solid-state fermentation medium: powder bran, powder straw, powder corn cob, ammonium sulfate, urea, calcium chloride, xylose and sterile water were mixed and sterilized at 115°C for 30 min to obtain a solid-state fermentation medium. Among them, the concentration of bran in the solid-state fermentation medium is 20 g / L, the concentration of straw is 25 g / L, the concentration of corn cob is 22 g / L, the concentration of ammonium sulfate is 15 g / L, the concentration of urea is 10 g / L, the concentration of calcium chloride is 2.2 g / L and the concentration of xylose is 2.5 g / L, and the rest is water.
[0215] (4) Preparation of the crude enzyme solution induced by xylose: the seed solution obtained in step (2) was inoculated into the solid state fermentation medium induced by xylose obtained in step (3) at a 5% inoculation volume, and then the fermentation was carried out at 28°C, pH=5, and humidity of 80% for 120h to obtain a solid state fermentation product. Then the solid state fermentation product was mixed with the phosphate buffer solution at pH=5 at a volume ratio of 1:8, and then soaked for 2h. After stirring at a speed of 120rpm for 20min, the plate-frame filtration was carried out to obtain the crude enzyme solution induced by xylose.
[0216] (5) Preparation of the concentrated solution induced by xylose: the crude enzyme solution induced by xylose obtained in step (4) was subjected to ultrafiltration concentration under the condition of a membrane with a pore size of 30kD and a water flux of 80L / m2h to obtain the concentrated solution induced by xylose.
[0217] 2
[0218] Technical effect evaluation: the β-glucosidase enzyme activity of the crude enzyme solution induced by xylose obtained in Example 3.1, the concentrated solution induced by xylose obtained in Example 3.1, and the concentrated solution induced by xylose obtained in Comparative Example 3.1 was determined. The determination method of the β-glucosidase enzyme activity was the same as that in step (2) of Example 2.
[0219] The results showed that the β-glucosidase enzyme activity of the crude enzyme solution induced by xylose was 16.8U, the β-glucosidase enzyme activity of the concentrated solution induced by xylose was 134.4U, and the β-glucosidase enzyme activity of the concentrated solution induced by xylose was 95.6U. It can be seen that the β-glucosidase enzyme activity of the crude enzyme solution induced by xylose was increased by 40.6%.
[0220] Application example (application in preparation of lignocellulose hydrolysis sugar solution)
[0221] (1) 540kg of sugarcane bagasse with a water content of 50wt% (the dry matter mass of the sugarcane bagasse was 270kg) and 300L of phosphate buffer solution with pH=4.8 were mixed to obtain a mixed liquid, and then a mixed enzyme solution was added into the mixed liquid in three times to obtain an enzyme hydrolysis reaction system. The enzyme hydrolysis reaction system contained cellulase with an enzyme activity of 4350U, xylanase with an enzyme activity of 69600U, and β-glucosidase with an enzyme activity of 1740U based on the dry matter mass of the sugarcane bagasse, and then the hydrolysis was carried out at 50°C for 144h to obtain a lignocellulose hydrolysis sugar solution.
[0222] The mixed enzyme solution is prepared by mixing 0.435 g of cellulase, 0.696 g of xylanase, 12.95 mL of the concentrated solution of xylose induced obtained in step (5.1) of Example 3 and 37.5 L of the phosphate buffer solution.
[0223] (2) The content of cellulose and hemicellulose in the enzymatic reaction substrate is detected by using the method of NY-T3494-2019, wherein the content of cellulose is 35.4 wt%, the content of hemicellulose is 20.6 wt%, and the total content of cellulose and hemicellulose in the bagasse enzymatic reaction substrate is 151.2 g (calculated by the dry matter mass of bagasse).
[0224] The content of reducing sugar in the lignocellulose hydrolysis sugar liquid is detected by using the method of GB 5009.7-2016, and the content of reducing sugar in the lignocellulose hydrolysis sugar liquid is 158 g / L. The mass of reducing sugar in the lignocellulose hydrolysis sugar liquid is 138.65 g, and the saccharification rate of the lignocellulose hydrolysis sugar liquid is detected by using the saccharification rate calculation formula, and the saccharification rate of the lignocellulose hydrolysis sugar liquid is 91.7%.
[0225] The saccharification rate calculation formula is (m2 / m1) x 100%, wherein m1 represents the mass of cellulose and hemicellulose in the bagasse enzymatic reaction substrate, and m2 represents the mass of reducing sugar obtained in the lignocellulose hydrolysis sugar liquid.
[0226] The above examples are only for further elaboration and understanding of the technical solutions of the present application, and are not a limitation of the present application. Any improvement made by a person skilled in the art on the basis of the above examples, which does not have any outstanding substantial features and does not have any significant progress, should belong to the protection scope of the present application.
Claims
1. A method for preparing Aspergillus niger solid-state fermentation broth, characterized in that, Includes the following steps: (a) Amplification culture of Aspergillus niger was carried out to obtain a suspension of Aspergillus niger spores; (b) The Aspergillus niger spore suspension obtained in step (a) is inoculated into a seed culture medium for cultivation to obtain Aspergillus niger seed liquid; (c) The Aspergillus niger seed culture obtained in step (b) is inoculated into a solid-state fermentation medium for culture to obtain Aspergillus niger solid-state fermentation product, wherein the solid-state fermentation medium comprises: wheat bran at a concentration of 10-30 g / L, straw at a concentration of 10-30 g / L, corn cob at a concentration of 10-30 g / L, ammonium sulfate at a concentration of 5-25 g / L, urea at a concentration of 1-15 g / L, calcium chloride at a concentration of 0.5-3 g / L, and xylose at a concentration of 1-18 g / L, with the remainder being water. (d) The Aspergillus niger solid fermentation product obtained in step (c) is mixed with a buffer solution, soaked, stirred and filtered to obtain a crude enzyme solution; (e) The crude enzyme solution obtained in step (d) is concentrated to obtain a concentrated solution, namely, the Aspergillus niger solid-state fermentation broth. The *Aspergillus niger* mentioned is *Aspergillus niger* AGM01, with accession number CCTCC NO: M2024768. The enzyme activity of β-glucosidase in the Aspergillus niger solid fermentation broth is 110-170 U, where U refers to one enzyme activity unit of β-glucosidase. One enzyme activity unit of β-glucosidase is defined as the amount of enzyme required per minute to produce 1 μmol of glucose by enzymatic hydrolysis of cellobiose in each mL of the Aspergillus niger solid fermentation broth.
2. The preparation method according to claim 1, characterized in that, The ITS gene sequence of Aspergillus niger AGM01 is shown in SEQ ID NO.
3.
3. The preparation method according to claim 1, characterized in that, The Aspergillus niger AGM01 has the characteristic of producing β-glucosidase.
4. The preparation method according to claim 3, characterized in that, The β-glucosidase activity of Aspergillus niger AGM01 is 20-30 U, where U refers to one enzyme activity unit of β-glucosidase. One enzyme activity unit of β-glucosidase is defined as the amount of enzyme required per minute to produce 1 μmol of glucose by enzymatic hydrolysis of cellobiose in each mL of crude enzyme solution of Aspergillus niger AGM01. The crude enzyme solution of Aspergillus niger AGM01 was prepared by the following method: Aspergillus niger was amplified and cultured to obtain Aspergillus niger spore suspension, the Aspergillus niger spore suspension was fermented and cultured to obtain fermentation broth, and then solid-liquid separation was performed to obtain supernatant, which is the crude enzyme solution of Aspergillus niger AGM01.
5. The preparation method according to claim 4, characterized in that, The fermentation culture time is 5-7 days.
6. The preparation method according to claim 1, characterized in that, The solid-state fermentation broth of Aspergillus niger is obtained by culturing Aspergillus niger in a seed culture medium, wherein the seed culture medium comprises, by weight: 1-30 parts glucose, 5-20 parts yeast extract, 0.1-0.4 parts magnesium sulfate, 1-4 parts potassium dihydrogen phosphate, 0.2-2 parts calcium chloride, 0.001-0.01 parts ferric sulfate, 0.001-0.01 parts manganese sulfate, 0.001-0.01 parts zinc sulfate, and 0.001-0.01 parts cobalt chloride.
7. The preparation method according to claim 6, characterized in that, The seed culture medium comprises: 5-20 parts glucose, and / or 5-15 parts yeast extract, and / or 0.2-0.35 parts magnesium sulfate, and / or 1-2 parts potassium dihydrogen phosphate, and / or 0.5-1.5 parts calcium chloride, and / or 0.001-0.008 parts ferric sulfate, and / or 0.001-0.008 parts manganese sulfate, and / or 0.001-0.008 parts zinc sulfate, and / or 0.001-0.008 parts cobalt chloride.
8. The preparation method according to claim 6, characterized in that, The yeast extract is yeast extract F902.
9. The preparation method according to claim 7, characterized in that, The yeast extract is yeast extract F902.
10. The preparation method according to any one of claims 6-9, characterized in that, The seed culture medium also includes: water.
11. The preparation method according to claim 1, characterized in that, The seed culture medium comprises: glucose at a concentration of 1-30 g / L, yeast extract at a concentration of 5-20 g / L, magnesium sulfate at a concentration of 0.1-0.4 g / L, potassium dihydrogen phosphate at a concentration of 1-4 g / L, calcium chloride at a concentration of 0.2-2 g / L, ferric sulfate at a concentration of 1-10 mg / L, manganese sulfate at a concentration of 1-10 mg / L, zinc sulfate at a concentration of 1-10 mg / L, and cobalt chloride at a concentration of 1-10 mg / L, with the remainder being water.
12. The preparation method according to claim 11, characterized in that, The seed culture medium comprises: glucose at a concentration of 5-20 g / L, and / or yeast extract at a concentration of 5-15 g / L, and / or magnesium sulfate at a concentration of 0.2-0.35 g / L, and / or potassium dihydrogen phosphate at a concentration of 1-2 g / L, and / or calcium chloride at a concentration of 0.5-1.5 g / L, and / or ferric sulfate at a concentration of 1-8 mg / L, and / or manganese sulfate at a concentration of 1-8 mg / L, and / or zinc sulfate at a concentration of 1-8 mg / L, and / or cobalt chloride at a concentration of 1-8 mg / L, with the remainder being water.
13. The preparation method according to claim 1, characterized in that, The solid-state fermentation medium comprises: wheat bran at a concentration of 10-25 g / L, and / or straw at a concentration of 10-25 g / L, and / or corn cob at a concentration of 10-25 g / L, and / or ammonium sulfate at a concentration of 5-25 g / L, and / or urea at a concentration of 1-15 g / L, and / or calcium chloride at a concentration of 0.5-3 g / L, with the remainder being water.
14. The preparation method according to claim 1, characterized in that, In step (a), each mL of Aspergillus niger spore suspension contains 10 6 -10 7 The spores of Aspergillus niger described above.
15. The preparation method according to claim 1, characterized in that, The culture temperature in step (a) is 26-30℃; and / or the culture temperature in step (b) is 26-30℃; and / or the culture temperature in step (c) is 27-29℃.
16. The preparation method according to claim 1, characterized in that, The culture time in step (a) is 24-48h; and / or the culture time in step (b) is 24-48h; and / or the culture time in step (c) is 100-144h.
17. The preparation method according to claim 1, characterized in that, The culture rotation speed in step (b) is 150-300 rpm.
18. The preparation method according to claim 1, characterized in that, The culture pH in step (c) is 4.5-5.
5.
19. The preparation method according to claim 1, characterized in that, The culture humidity in step (c) is 50-95%.
20. The preparation method according to claim 1, characterized in that, In step (d), the volume ratio of the Aspergillus niger solid fermentation product to the buffer solution is (0.8-1.2):(6-10).
21. The preparation method according to claim 1, characterized in that, The soaking time in step (d) is 1-4 hours.
22. The preparation method according to claim 1, characterized in that, The stirring speed in step (d) is 100-300 rpm.
23. The preparation method according to claim 1, characterized in that, The stirring time in step (d) is 20-50 min.
24. The preparation method according to claim 1, characterized in that, The filtering in step (d) is plate and frame filtering.
25. The preparation method according to claim 1, characterized in that, In step (e), the concentration is ultrafiltration concentration.
26. The preparation method according to claim 25, characterized in that, The membrane used for ultrafiltration concentration has a pore size of 10-60 kD.
27. The preparation method according to claim 26, characterized in that, The ultrafiltration concentration time is 1-5 hours.
28. A solid fermentation broth of Aspergillus niger prepared by any one of claims 1-27.
29. A lignocellulose hydrolysate, characterized in that, It is obtained by hydrolysis in a system containing the Aspergillus niger solid fermentation broth as described in claim 28.
30. The lignocellulose hydrolysate according to claim 29, characterized in that, Lignocellulose is one or a combination of agricultural and forestry waste.
31. The lignocellulose hydrolysate according to claim 30, characterized in that, Agricultural waste consists of one or a combination of sugarcane bagasse and straw.
32. The lignocellulose hydrolysate according to any one of claims 29-31, wherein the mass ratio of reducing sugars in the lignocellulose hydrolysate is 90% or more, wherein... The reducing sugar mass ratio refers to the percentage of the mass of reducing sugar (m2) that is converted from the lignocellulosic raw material by enzymatic hydrolysis, relative to the total mass (m1) of cellulose and hemicellulose contained in the lignocellulosic raw material before hydrolysis.
33. The application of the Aspergillus niger solid fermentation broth according to claim 28 in the preparation of lignocellulose hydrolysate.
Citation Information
Patent Citations
Aspergillus niger strain with high yield of mycoprotein and application of aspergillus niger strain
CN117143739A
Beta-glucosidase preparing method
CN101649310A
Culture method for producing high-activity beta-glucosidase
CN102154249A
Aspergillus niger capable of producing cellulase at high yield
CN104630069A