Probe for detecting multi-site mononucleotide mutation based on confinement effect and application thereof

Abstract

The invention relates to the technical field of biological detection, in particular to a probe for detecting multi-site mononucleotide mutation based on a confinement effect and application of the probe. A plurality of mononucleotide mutation recognition units are coupled through DNA nanowires, a DNA nanostructure network is constructed, and when a target appears, the target can be combined with the mononucleotide mutation recognition units at the same time, so that the fluorescence intensity is enhanced. The fluorescent groups in each mononucleotide mutation recognition unit are different, and mononucleotide mutation at a limited position can be detected under different excitation wavelengths, so that mononucleotide mutation at multiple sites can be detected. Meanwhile, when a multi-site mononucleotide mutation target object is recognized, after a certain mononucleotide mutation recognition unit is combined with a mutation target spot on the target object, the target object is limited, at the moment, other mononucleotide mutation recognition units can quickly complete recognition of other corresponding mutation target spots, and the detection efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a probe for detecting multi-site single nucleotide mutations based on confinement effect and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Due to the large-scale use and abuse of antibiotics worldwide, various "multi-drug resistant bacteria" continue to emerge, posing a severe challenge to human health and becoming one of the biggest threats to global public health. Bacteria acquire antibiotic resistance through random mutation or expression of potential resistance genes, which is one of the important sources of antibiotic resistance genes (ARGs). Therefore, the analysis of bacterial nucleotide mutations is crucial.

[0004] Traditional bacterial analysis requires cultivation, bacterial enrichment, and isolation, a time-consuming and cumbersome process, and analysis at the gene level still needs to be combined with new technologies. At present, most studies on bacterial gene levels rely on gene sequencing technology to achieve advanced analysis and interpretation of organisms at the molecular and genetic levels, mainly including 16S rRNA and ITS rRNA. However, although high-throughput sequencing technology represented by 16S can directly realize sequence analysis of gene fragments obtained in samples and realize the study of the structure and diversity of microbial communities in samples, it also faces many difficulties. First, its investment cost is high, the amount of data is huge, the analysis requirements are high, and it takes a long time. At the same time, it has high requirements for detection instruments and equipment; second, in sequencing analysis, the identification and detection of single-base mutations is difficult, and there is still the possibility of missed detection and wrong detection. In addition, existing mutation detection technologies based on non-sequencing methods, such as isothermal amplification technology (LAMP) and polymerase chain reaction technology (PCR), mostly focus on the identification of single mutation sites. The biosensing process of trace detection involves continuous search for target DNA in solution, which results in prolonged reaction time and low detection efficiency. In addition, the developed methods are limited in their usage scenarios and fail to achieve dynamic tracking and evaluation of multiple mutation sites in different types of samples. Summary of the invention

[0005] In order to overcome the above problems, the present invention provides a probe for detecting multi-site single nucleotide mutations based on confinement effect and its application.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a probe for detecting multi-site single nucleotide mutations based on confinement effect, comprising:

[0008] Multiple single nucleotide mutation recognition units, and DNA nanowires coupled to the multiple single nucleotide mutation recognition units.

[0009] In one or more embodiments, the single nucleotide mutation recognition units are composed of a DNA tetrahedron and an X-shaped structure;

[0010] The DNA tetrahedron is composed of DNA single strands S1 to S4, wherein any DNA single strand is connected to the other three strands through complementary base pairing;

[0011] The 5' end of DNA single strand S1 is complementary to the DNA single strand Right-up, DNA single strand Right-down, and DNA single strand Left-down in pairs to form an X-shaped structure;

[0012] The 5' end of the DNA single strand S1 is provided with a sticky end including nucleotides A, T, G or C.

[0013] The DNA tetrahedron is composed of DNA single strands S1 to S4, wherein any DNA single strand is connected to the other three strands through complementary base pairing, and the 5' end of DNA single strand S1 is complementary to the DNA single strand Right-up, DNA single strand Right-down, and DNA single strand Left-down in pairs to form an X-shaped structure. This structure can not only detect the target, but also the probe can be used for a long time and will not be instantly degraded by nucleases in the cell, thereby causing false positives.

[0014] Preferably, the 3' end of the DNA single strand S1 is modified with a fluorescent quencher group; the 5' end of the left-down is modified with a fluorescent group;

[0015] Further preferably, the fluorescence quenching group and the fluorescent group in adjacent single nucleotide mutation recognition units in the present invention are different.

[0016] The X-shaped structure and the DNA tetrahedral structure are taken as a whole, and the 3' end of the DNA single-strand S1 is modified with a fluorescent quenching group and the 5' end of the left-down is modified with a fluorescent group close to each other. Because of the energy resonance transfer, the single nucleotide mutation recognition unit does not emit light. When the target appears, the target first binds to the DNA single-strand S1 in the X-shaped structure, and a toehold-mediated chain substitution reaction occurs, thereby replacing the left-down and right-down that play a blocking role. After the recognition is completed, the stable conformation of the X-shaped probe is changed, and the fluorescent group is separated from the quenching group, and the fluorescent group is further released, thereby emitting light. In the present invention, each single nucleotide mutation recognition unit has different fluorescent groups. Under different excitation wavelengths, single nucleotide mutations at limited positions can be detected, and single nucleotide mutations at multiple sites can be detected in the end.

[0017] Preferably, the nucleic acid sequences of the DNA single strands S1 to S4 and the DNA single strand Right-up, DNA single strand Right-down, and DNA single strand Left-down are as shown in SEQ ID NOs. 1 to 17.

[0018] In one or more embodiments, the DNA nanowire is connected to the 5' end of the DNA single strand S3 through base complementary pairing.

[0019] Preferably, the nucleic acid sequence of the DNA nanowire is as shown in SEQ ID NO.18.

[0020] Multiple single nucleotide mutation recognition units are connected in series through DNA nanowires to construct a DNA nanostructure network. When a target with multiple single nucleotide mutations appears, the target will bind to multiple single nucleotide mutation recognition units at the same time, thereby achieving an enhancement of the fluorescence intensity at different sites. In the present invention, each single nucleotide mutation recognition unit has different fluorescent groups, and under different excitation wavelengths, single nucleotide mutations at limited positions can be detected, and then single nucleotide mutations at multiple sites can be detected eventually. Furthermore, when identifying a target with multiple single nucleotide mutations, when a single nucleotide mutation recognition unit binds to a mutation target on the target, the target will be confined. At this time, the remaining single nucleotide mutation recognition units in the DNA nanostructure network can quickly complete the identification of other corresponding mutation targets, greatly improving the detection efficiency of multi-site single base mutations, and realizing low-abundance mutation nucleic acid detection in complex background samples.

[0021] The second aspect of the present invention provides the preparation of the above-mentioned probe for detecting multi-site single nucleotide mutations based on confinement effect, comprising:

[0022] After incubating the single nucleotide mutation recognition unit with the DNA nanowire, a probe for detecting multi-site single nucleotide mutations based on the confinement effect is obtained.

[0023] The ratio of recognition units to DNA nanowires depends on the number of connected recognition units on the DNA nanowires.

[0024] In one or more embodiments, the single nucleotide mutation recognition unit is diluted to 80-120 nmol / L with a 0.01M-0.03M HEPES solution containing magnesium chloride;

[0025] Preferably, the single nucleotide mutation recognition unit is diluted to 100 nmol / L with 0.02 M HEPES solution;

[0026] More preferably, the HEPES solution contains 12.5 mM magnesium chloride.

[0027] In one or more embodiments, the incubation time is 1.5 to 3 hours, preferably 2 hours.

[0028] The third aspect of the present invention provides the use of the above-mentioned probe for detecting multi-site single nucleotide mutations based on confinement effect in detecting bacterial multi-site single nucleotide mutants.

[0029] In one or more embodiments, the nucleic acid sequence of the multi-site single nucleotide mutant is shown as SEQ ID NO.19.

[0030] A fourth aspect of the present invention provides a method for detecting bacterial multi-site single nucleotide mutants, comprising:

[0031] (1) Obtaining the initial fluorescence signal F0 of different single nucleotide mutation recognition units in the probe for detecting multi-site single nucleotide mutations based on the confinement effect;

[0032] (2) adding the DNA to be tested to the solution of the probe for detecting multi-site single nucleotide mutations based on the confinement effect, adding a buffer to make the final concentration of the probe 80 to 120 nM, and after co-incubation, obtaining the fluorescence signal F of different single nucleotide mutation recognition units again;

[0033] (3) The difference between the initial fluorescence signal F0 and the fluorescence signal F after co-incubation is used to determine whether the DNA to be tested has undergone multi-site single nucleotide mutations.

[0034] In one or more embodiments, the nucleic acid sequence of the multi-site single nucleotide mutant is shown as SEQ ID NO.19.

[0035] In one or more embodiments, the incubation conditions are: incubation at 37° C. for 35 to 45 min; and the buffer is HEPES buffer.

[0036] In one or more embodiments, in step (3), if there is a difference between the initial fluorescence signal F0 in a single nucleotide mutation recognition unit and the fluorescence signal F after co-incubation, it indicates that a single nucleotide mutation has occurred in the single nucleotide mutation recognition unit.

[0037] The fifth aspect of the present invention provides a product for detecting bacterial multi-site single nucleotide mutants, including the above-mentioned probe for detecting multi-site single nucleotide mutations based on confinement effect described in the first aspect.

[0038] In one or more embodiments, the product comprises a biosensor, a test strip, or a kit.

[0039] Preferably, the kit further comprises HEPES buffer. In addition, it may also comprise any other buffers for maintaining the activity of the probe.

[0040] The beneficial effects of the present invention are:

[0041] (1) The present invention provides a probe for detecting multi-site single nucleotide mutations based on confinement effect, comprising: a plurality of single nucleotide mutation recognition units, and a DNA nanowire coupled with the plurality of single nucleotide mutation recognition units. The plurality of single nucleotide mutation recognition units are connected in series through DNA nanowires to construct a DNA nanostructure network. When a target with multi-site single nucleotide mutations appears, the target will simultaneously bind to the plurality of single nucleotide mutation recognition units, thereby enhancing the fluorescence intensity. In the present invention, each single nucleotide mutation recognition unit has different fluorescent groups, and under different excitation wavelengths, single nucleotide mutations at limited positions can be detected, and then single nucleotide mutations at multiple sites can be detected in the end. At the same time, when identifying a target with multi-site single nucleotide mutations, when a single nucleotide mutation recognition unit binds to a mutation target on the target, the target will be confined. At this time, the remaining single nucleotide mutation recognition units in the DNA nanostructure network can quickly complete the recognition of other corresponding mutation targets, greatly improving the detection efficiency of multi-site single base mutations, and realizing low-abundance mutation nucleic acid detection in complex background samples.

[0042] (2) The probe for detecting multi-site single nucleotide mutations based on the confinement effect provided by the present invention exhibits strong specificity and selectivity, and can accurately detect the target in the presence of multiple interfering substances, thus meeting clinical needs. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0044] Figure 1This is a schematic diagram of the principle of detecting multiple-site single nucleotide mutations using a probe for detecting multiple-site single nucleotide mutations based on the confinement effect of the present invention;

[0045] Figure 2 This is a gel electrophoresis characterization diagram of the first single nucleotide mutation recognition unit in Example 1 of the present invention;

[0046] Figure 3 The fluorescence spectrum is a feasibility verification diagram of the confinement effect in Example 2 of the present invention;

[0047] Figure 4 The fluorescence detection spectra (a) and working fitting curves (b) of the single nucleotide mutants at different concentrations in Example 3 of the present invention;

[0048] Figure 5 is the specificity of the first single nucleotide mutation recognition unit for single nucleotide mutant detection in Example 4 of the present invention;

[0049] Figure 6 The fluorescence detection spectrum (a) and working fitting curve (b) of multi-site single nucleotide mutants in Example 5 of the present invention are shown;

[0050] Figure 7 This is a fluorescence image of the probe for detecting multi-site single nucleotide mutations based on the confinement effect in Example 6 of the present invention during the process of detecting multi-site single nucleotide mutants. DETAILED DESCRIPTION

[0051] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0052] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0053] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0054] Sticky end: According to the base matching principle and the chain displacement principle, when the 3' end of the target can stably match and bind to the 5' end of the capture chain, the target can replace the closed chain bound to the capture chain, thereby achieving chain displacement. The sticky end in the present invention actually refers to the 5' sequence of the capture chain that matches the 3' end of the target. Generally, more than or equal to 3 bases are set as the sticky end. The sticky end in the present invention is located at 5'-CATTAA-3' in the S1 sequence, with a total of 6 bases.

[0055] The nucleic acid sequences used in the following examples are as follows:

[0056] 1-S1 (SEQ ID NO.1):

[0057] ACCGGTCATTGCTGTCGACGGAACGCCATTAATTTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT-BHQ1;

[0058] 2-S1 (SEQ ID NO.2):

[0059] ACCGGTCATTGCTGATTCCGATACTGTTACTCTTTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT-BHQ3;

[0060] 3-S1 (SEQ ID NO.3):

[0061] ACCGGTCATTGCTGCGGTGGTGTGTATCGTCCTTTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT-BHQ2;

[0062] S2 (SEQ ID NO.4):

[0063] ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA;

[0064] 1-S3 (SEQ ID NO.5):

[0065] AGAAGTCCATGAATTTTTCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCT;

[0066] 2-S3(SEQ ID NO.6):

[0067] TCCAAGCTAAAGTTTTTTCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTATATGGCGGCTCTTCT:

[0068] 3-S3(SEQ ID NO.7):

[0069] GGATTGGCTACTTTTTTTCACTGCCTGGTGATAAAACGACACTACGTGGGAATCTATATGGCGGCTCTTCT:

[0070] S4(SEQ ID NO.8):

[0071] TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGT CCAATAC:

[0072] 1-Rightup(SEQ ID NO.9):

[0073] ATTTCACAGCAATGACCGGT:

[0074] 2-Rightup(SEQ ID NO.10):

[0075] CTTTTGACAGCAATGACCGGT:

[0076] 3-Rightup(SEQ ID NO.11):

[0077] GAATTTCAGCAATGACCGGT:

[0078] 1-Rightdown(SEQ ID NO.12):

[0079] AACTACTATCCACTGAGAAT:

[0080] 2-Rightdown(SEQ ID NO.13):

[0081] AACTACTATCCCACTCAAAAG:

[0082] 3-Rightdown(SEQ ID NO.14):

[0083] AACTACTATCCCACAAATTTC:

[0084] 1-Leftdown (SEQ ID NO.15):

[0085] FAM-GCGTTCCGTCGAGTGGATAGTAGTT;

[0086] 2-Leftdown (SEQ ID NO.16):

[0087] Cy5-TATGACAATGAGGTGGATAGTAGTT;

[0088] 3-Leftdown (SEQ ID NO.17):

[0089] Cy3-TACACACCACCGGTGGATAGTAGTT;

[0090] DNA nanowire (SEQ ID NO.18):

[0091] TTCATGGACT TCTGATTATGTTCCTATTGCCAACGACGACCTGACTGTG AGATCTA ACTTTAGCTTG GA GATATAAGGTTCAGTGCCGATCCCCAGATAAG GACCACGGACT AAGTAGCCAATCC TAGAAATTATGGTACAT (the underlined position is the position where the identification unit is connected);

[0092] Single nucleotide mutants:

[0093] TT A ATGGCGTTCCGTCGATGAGAAT; the underline indicates the position of the mutated base;

[0094] Double-site single nucleotide mutants:

[0095] TT A ATGGCGTTCCGTCGATGAGAATTTATAAATAGATCGGCGTTTTCA CACCAGAGCCTTGGCAAGGATA A GGCTATGACAATGAGTCAAAAG; the underline indicates the position of the mutated base;

[0096] Multiple site single nucleotide mutants (SEQ ID NO.19):

[0097] TT AATGGCGTTCCGTCGATGAGAATTTATAAATACATCGGCGTTTTCACACCAGAGCCTTGGCAAGGATA A GGCTATGACAATGAGTCAAAAGCTGTTTTAAAACAAGGCAACATCAGGGGCAAAGAGATAACATGGG A CGATACACACCACCCAAATTTC; the underline indicates the position of the mutated base;

[0098] Single base mismatch:

[0099] TT G ATGGCGTTCCGTCGATGAGAAT

[0100] wild type:

[0101] TTTATGGCGTTCCGTCGATGAGAAT;

[0102] Bacillus cereus:

[0103] TACGAACTAAGAAGGATATTCCAA;

[0104] Shigella:

[0105] CCGCAGCACGTTCTTGCTTATGCA;

[0106] E. coli:

[0107] GGCCAAGGATTAGCTGTACAT.

[0108] Figure 1The detection principle diagram of the present invention is a probe for detecting multi-site single nucleotide mutations based on the confinement effect in the present invention, including: multiple single nucleotide mutation recognition units, and DNA nanowires coupled to multiple single nucleotide mutation recognition units. The single nucleotide mutation recognition units are composed of a DNA tetrahedron and an X-shaped structure. The X-shaped structure and the DNA tetrahedron structure are taken as a whole, and the 3' end of the DNA single strand S1 is modified with a fluorescent quenching group and the 5' end of the Left-down is modified with a fluorescent group close to each other. Because of the energy resonance transfer, the single nucleotide mutation recognition unit does not emit light. When the target appears, the target first binds to the DNA single strand S1 in the X-shaped structure, and a toehold-mediated chain substitution reaction occurs, thereby replacing the left-down and right-down that play a blocking role. After the recognition is completed, the stable conformation of the X-shaped probe is changed, and the fluorescent group is separated from the quenching group, and the fluorescent group is further released, thereby emitting light. Furthermore, when identifying targets with multi-site single nucleotide mutations, when a single nucleotide mutation recognition unit binds to a mutation target on the target, the target will be confined. At this time, the remaining single nucleotide mutation recognition units in the DNA nanostructure network can quickly complete the identification of other corresponding mutation targets, greatly improving the detection efficiency of multi-site single base mutations and realizing the detection of low-abundance mutant nucleic acids in complex background samples.

[0109] Example 1

[0110] Preparation of single nucleotide mutation recognition unit:

[0111] Mix the seven DNA chains of 1-S1, S2, 1-S3, S4, 1-Leftdown1, 1-Rightup and 1-Rightdown in equal volumes, dilute 400nmol / L with 0.02M HEPES solution containing 12.5mM magnesium chloride, place in a constant temperature heater for annealing, and naturally cool to room temperature after annealing. The annealing process is reduced from 95℃ to 30℃, and each 5℃ reduction should be maintained for 7 minutes.

[0112] The gel electrophoresis results during the synthesis of the first single nucleotide mutation recognition unit are as follows Figure 2 As shown, from Figure 2 It can be seen that as the four single-stranded DNAs constituting the tetrahedron are continuously added, the bands in the lanes continue to move upward, the migration rate gradually slows down, and the band migration rate is the lowest in lane 4, and there are no other single-stranded nucleic acid bands, indicating that the DNA tetrahedron is successfully constructed. In lanes 5 and 6, the other three single-stranded DNAs constituting the X-type probe are continuously added, and the color of the tetrahedron band continues to deepen, and no other single-stranded DNA bands are generated, which proves that the first single nucleotide mutation recognition unit (tetrahedron-X-type probe) is successfully constructed.

[0113] The second single nucleotide mutation recognition unit is different from the first single nucleotide mutation recognition unit in that 1-S1, 1-S3, 1-Leftdown, 1-Rightdown, 1-Rightup DNA chains are replaced by 2-S1, 2-S3, 2-Leftdown, 2-Rightdown, 2-Rightup DNA chains.

[0114] The third single nucleotide mutation recognition unit is different from the first single nucleotide mutation recognition unit in that 1-S1, 1-S3, 1-Leftdown, 1-Rightdown, 1-Rightup DNA chains are replaced by 3-S1, 3-S3, 3-Leftdown, 3-Rightdown, 3-Rightup DNA chains.

[0115] Take 25 μL of the first single nucleotide mutation recognition unit, the second single nucleotide mutation recognition unit and the third single nucleotide mutation recognition unit at 400 nmol / L after annealing, and take 2 μL of 5 μmol / L DNA nanowire, dilute it to 100 nmol / L with 0.02 M HEPES solution containing 12.5 mM magnesium chloride, and incubate it for 2 hours. This can synthesize a probe for detecting multi-site single nucleotide mutations based on the confinement effect.

[0116] Example 2

[0117] To verify the confinement effect brought by DNA nanowires, this example uses the presence or absence of DNA nanowires in the construction of the combined probe as the only variable, uses the constructed initial fluorescence signal as the starting value, adds 2 μL of single nucleotide mutants, mixes thoroughly, and measures the change in fluorescence spectrum over time.

[0118] Take 50 μL of the first single nucleotide mutation recognition unit of 400 nmol / L after annealing, and take 2 μL of 5 μmol / L long-chain DNA, dilute 100 nmol / L with 0.02M HEPES solution containing 12.5 mM magnesium chloride, fully incubate for 2 hours, and obtain the detection probe with the same single nucleotide mutation recognition unit. (The confinement is a molecular dynamics concept. The reaction of the first recognition unit accelerates the reaction of the second recognition unit. Therefore, the present embodiment uses the same two first single nucleotide mutation recognition units to detect the first mutation site + the second mutation site. Two identical single nucleotide mutation recognition units with the same fluorescent marker are required here, because the same fluorescent marker can detect the dynamics of its rise. If it is a different fluorescent marker, there is no way to measure the dynamics, and the signals can only be measured separately)

[0119] Take 100 μL of the probe solution prepared above (concentration of 100 nmol / L) and 100 μL of the first single nucleotide mutation recognition unit solution prepared in Example 1 (concentration of 100 nmol / L), and scan the fluorescence spectrum under the conditions of excitation 495 nm and scanning emission range of 510-600 nm, and use this as the initial fluorescence signal. Add 2 μL of 10 nmol / L double-site single nucleotide mutant solution, incubate at room temperature for 1 hour, and scan the fluorescence spectrum again.

[0120] The results are as follows Figure 3 As shown in the figure, after adding the same volume concentration of double-site single nucleotide mutants, the fluorescence signal of the experimental group was much higher than that of the control group within the same time range, and the reaction rate was significantly improved. The presence of DNA nanowires in the reaction system confines the detection probes of each single base mutation to a limited space, thereby increasing the local concentration of single nucleotide mutants, greatly improving the reaction kinetics, and significantly improving the detection efficiency of the probes for the corresponding mutation targets.

[0121] Example 3

[0122] In this example, the first single nucleotide mutation recognition unit solution prepared in Example 1 is used to identify and detect single nucleotide mutants to verify that the single nucleotide mutation recognition unit can effectively achieve accurate detection of single base mutations.

[0123] The specific experimental process includes:

[0124] Take 100 μL of the first single nucleotide mutation recognition unit solution prepared in Example 1 (concentration of 10 nmol / L), scan the fluorescence spectrum under the conditions of excitation 495 nm and scanning emission range of 510-600 nm, and use this as the initial fluorescence signal. Add 2 μL of single nucleotide mutants with concentrations of 10 nmol / L, 15 nmol / L, 20 nmol / L, 25 nmol / L, and 30 nmol / L, incubate at 37°C for 40 min, and scan the fluorescence spectrum again.

[0125] The results are as follows Figure 4 As shown, from Figure 4 As can be seen in a, when 2 μL of single-base mutant was added to the solution, the fluorescence signal gradually increased over time and gradually stabilized after 20 minutes of reaction. Figure 4 b. The fluorescence signal was fitted. The results showed that as the number of single-base mutants increased, the fluorescence signal increased accordingly, showing a significant correlation.

[0126] Example 4

[0127] Take 100 μL of the first single nucleotide mutation recognition unit solution prepared in Example 1, and detect the single nucleotide mutant (target DNA in this example), single base mismatch sample, wild-type sample, Bacillus cereus sample, Shigella sample and Escherichia coli sample of the same concentration (10 nmol / L), and obtain Figure 5 The fluorescence signal.

[0128] The specific process includes: taking 100 μL of the first single nucleotide mutation recognition unit solution prepared in Example 1 (concentration of 100 nmol / L), scanning the fluorescence spectrum under the conditions of excitation 495 nm and scanning emission range of 510-600 nm, and using this as the initial fluorescence signal. Add 2 μL of the same concentration (10 nmol / L) of single nucleotide mutants, single base mismatch samples, wild-type samples, Bacillus cereus samples, Shigella samples and Escherichia coli samples, respectively, incubate at 37°C for 40 min, and scan the fluorescence spectrum again.

[0129] Results, such as Figure 5 It shows that, except for the single nucleotide mutant (the target DNA in this example), the fluorescence signal values ​​of the other samples are at a relatively low level with significant differences, indicating that the probe has good detection specificity and does not produce significant response to other samples.

[0130] Example 5

[0131] Take 100 μL of the probe solution (concentration of 100 nmol / L) prepared in Example 1 for detecting multi-site single nucleotide mutations based on confinement effect, and scan the fluorescence spectrum under the conditions of excitation 495 nm and scanning emission range 510-600 nm, and use this as the initial fluorescence signal. Add 2 μL of single nucleotide mutants with concentrations of 10 nmol / L, 15 nmol / L, 17.5 nmol / L, 25 nmol / L and 30 nmol / L, incubate at 37°C for 40 min, and scan the fluorescence spectrum again.

[0132] The results are as follows Figure 6 As shown, Figure 6 a and Figure 6 b shows that the probe solution for detecting multi-site single nucleotide mutations based on the confinement effect can achieve better detection of single-base mutation samples. As the concentration of single-nucleotide mutants changes, the peak value of the fluorescence signal gradually increases, and there is a significant correlation between the concentration of single-base mutations and the strength of the fluorescence signal.

[0133] Example 6

[0134] The probe solution (concentration of 100nmol / L) for detecting multi-site single nucleotide mutations based on the confinement effect prepared in Example 1 was added with 2 μL of a multi-site single nucleotide mutant solution at a concentration of 25nmol / L, and incubated at 37°C for 40 min, and then mixed and incubated with a 1-micron diameter, positively charged PS (polystyrene) bead, and the fluorescence image of the bead was taken under different excitation conditions. The PS bead is positively charged, and the nucleic acid itself is negatively charged. After adding the PS bead, the nucleic acid can be enriched on the surface of the PS bead by combining positive and negative charges. Under the action of different excitation wavelengths, different color fluorescence can be observed by fluorescence microscopy.

[0135] The results are as follows Figure 7 As shown, Figure 7 a shows that the multi-site mutation combined detection probe can set corresponding fluorescent labels (FAM, Cy5, Cy3) for different mutation sites, and the corresponding fluorescence can be observed under different excitation wavelengths, thereby realizing the analysis of multiple mutation sites.

[0136] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A probe for detecting multi-site single nucleotide mutations based on confinement effect, characterized in that: include: Multiple single nucleotide mutation recognition units, and DNA nanowires coupled to the multiple single nucleotide mutation recognition units.

2. The probe according to claim 1, characterized in that The single nucleotide mutation recognition units are composed of a DNA tetrahedron and an X-shaped structure; The DNA tetrahedron is composed of DNA single strands S1 to S4, wherein any DNA single strand is connected to the other three strands through complementary base pairing; The 5' end of the DNA single strand S1 is complementary to the DNA single strand Right-up, the DNA single strand Right-down, and the DNA single strand Left-down in pairs to form an X-shaped structure; preferably, the 5' end of the DNA single strand S1 is provided with a sticky end including nucleotides A, T, G or C; The 3' end of the DNA single strand S1 is modified with a fluorescent quenching group; the 5' end of the left-down is modified with a fluorescent group; preferably, the fluorescent quenching group and the fluorescent group in the adjacent single nucleotide mutation recognition units are different; The nucleic acid sequences of DNA single strands S1 to S4 and DNA single strand Right-up, DNA single strand Right-down, and DNA single strand Left-down are shown in SEQ ID NOs. 1 to 17; The DNA nanowire is connected to the 5' end of the DNA single strand S3 through base complementary pairing; preferably, the nucleic acid sequence of the DNA nanowire is as shown in SEQ ID NO.

18.

3. The method for preparing a probe for detecting multi-site single nucleotide mutations based on confinement effect according to any one of claims 1 to 2, characterized in that: include: After incubating the single nucleotide mutation recognition unit with the DNA nanowire, a probe for detecting multi-site single nucleotide mutations based on the confinement effect is obtained.

4. The preparation method according to claim 3, characterized in that: Dilute the single nucleotide mutation recognition unit to 80-120 nmol / L with 0.01M-0.03M HEPES solution containing magnesium chloride; Alternatively, the incubation time is 1.5 to 3 hours, preferably 2 hours.

5. The probe for detecting multi-site single nucleotide mutations based on confinement effect as described in claim 1 is used in detecting multi-site single nucleotide mutants in bacteria.

6. The use according to claim 5, characterized in that The nucleic acid sequence of the multi-site single nucleotide mutant is shown in SEQ ID NO.

19.

7. A method for detecting bacterial multi-site single nucleotide mutants, characterized in that: include: (1) Obtaining the initial fluorescence signal F0 of different single nucleotide mutation recognition units in the probe for detecting multi-site single nucleotide mutations based on the confinement effect; (2) adding the DNA to be tested to the solution of the probe for detecting multi-site single nucleotide mutations based on the confinement effect, adding a buffer to make the final concentration of the probe 80 to 120 nM, and after co-incubation, obtaining the fluorescence signal F of different single nucleotide mutation recognition units again; (3) The difference between the initial fluorescence signal F0 and the fluorescence signal F after co-incubation is used to determine whether the DNA to be tested has undergone multi-site single nucleotide mutations.

8. The method according to claim 7, characterized in that The incubation conditions are: incubation at 37°C for 35-45 min; the buffer is HEPES buffer; Or, in step (3), if there is a difference between the initial fluorescence signal F0 in a single nucleotide mutation recognition unit and the fluorescence signal F after co-incubation, it means that a single nucleotide mutation has occurred in the single nucleotide mutation recognition unit.

9. A product for detecting bacterial multi-site single nucleotide mutants, characterized in that: It includes the probe for detecting multi-site single nucleotide mutations based on the confinement effect as described in claim 1.

10. The product according to claim 9, characterized in that The product includes a biosensor, a test strip or a test kit; Preferably, the kit further comprises HEPES buffer.

Images