P53 gene detection kit based on non-specific index-free RCA activated CRISPR / Cas12a and application of p53 gene detection kit

Abstract

The invention discloses a p53 gene detection kit based on CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (CRISPR / Cas12a) activated by RCA (non-specific index free) and application of the p53 gene detection kit. The kit comprises a nicking enzyme triggered target nucleic acid circulating system, a nicking enzyme induced index RCA amplification system and a CRISPR / Cas12a reaction system, the detection method is simple and easy to operate, isothermal amplification is adopted, precise temperature control equipment is not needed, cost is low, universality is good, accuracy is high, detection sensitivity is high, the lowest detection limit is as low as 0.77 fM, and the detection method can be used for p53 gene detection.

Description

Technical Field

[0001] The present invention relates to the field of disease diagnosis, and in particular to a p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA, and also to an application of the kit. Background Art

[0002] The p53 gene is a major player in the development of human cancer. It plays an anti-cancer role mainly by activating senescence, cell cycle arrest, apoptosis and autophagy, and is considered to be the most important tumor suppressor gene. Mutated p53 genes are beneficial to cell survival and proliferation, thereby promoting the occurrence of cancer. Studies have shown that p53 gene mutations exist in about 50% of cancers. Therefore, non-invasive detection of the p53 gene is crucial for early screening and diagnosis of cancer. At present, the methods used for p53 gene detection mainly include real-time quantitative polymerase chain reaction (qPCR) and next-generation sequencing (NGS). However, these methods have the disadvantages of cumbersome operation, high detection cost, and dependence on expensive and precise thermal cyclers, which limits their widespread application in resource-poor areas. In contrast, the CRISPR / Cas molecular diagnostic system has the unique advantages of high sensitivity and high specificity. In recent years, it has gradually developed into the core of the next generation of diagnostic technology because it has the advantages of simple operation, low cost, and portability. Therefore, it is urgent to construct a simple, low-cost, highly sensitive and specific p53 gene detection method for wide use in early screening and diagnosis of cancer patients. Summary of the invention

[0003] In view of this, one of the objects of the present invention is to provide a p53 gene detection kit based on RCA activation of CRISPR / Cas12a without non-specific index; a second object of the present invention is to provide an application of a p53 gene detection kit based on RCA activation of CRISPR / Cas12a without non-specific index in detecting p53 gene; a third object of the present invention is to provide a method for detecting p53 gene using the p53 gene detection kit based on RCA activation of CRISPR / Cas12a without non-specific index.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] 1. A p53 gene detection kit based on non-specific index RCA activation of CRISPR / Cas12a, the kit comprising a nicking enzyme-triggered target nucleic acid circulation system, a nicking enzyme-induced index RCA amplification system and a CRISPR / Cas12a reaction system;

[0006] The nicking enzyme-triggered target nucleic acid circulation system contains circular single-stranded DNA 1 and Nt.BstNBI enzyme, the circular single-stranded DNA 1 contains a sequence complementary to the p53 gene, and forms an Nt.BstNBI enzyme action site in the complementary double-stranded region. When the p53 gene is present, the circular single-stranded DNA 1 hybridizes with the p53 gene to form a double strand, and is thus cut into linear DNA 1 fragments by the Nt.BstNBI enzyme, and the p53 gene is released;

[0007] The nicking enzyme-induced exponential RCA amplification system contains circular single-stranded DNA 2, Nt.BbvCI enzyme and phi29 DNA polymerase; the circular single-stranded DNA 2 contains a base complementary pairing region with the circular single-stranded DNA 1 and a Nt.BbvCI enzyme recognition site, and the circular single-stranded DNA 2 can serve as a template to amplify and extend the linear DNA 1 fragment along the circular single-stranded DNA 2 in the presence of the phi29 DNA polymerase; and under the action of the Nt.BbvCI enzyme, the linear DNA 1 fragment is sheared along the circular single-stranded DNA 2 amplified product, and the product is released from the circular single-stranded DNA 2 to trigger the next RCA reaction as a new primer;

[0008] The CRISPR / Cas12a reaction system includes a crRNA sequence and a fluorescent signal probe. The crRNA sequence can bind to the Cas12a protein to form a complex crRNA / Cas12a and hybridize with the RCA product. The trans-cleavage activity of the crRNA / Cas12a complex is activated in the presence of the RCA product, and the activated crRNA / Cas12a complex can cut the fluorescent signal probe and release a fluorescent signal.

[0009] Preferably, the sequence of the circular single-stranded DNA 1 is shown as SEQ ID NO.2, the sequence of the circular single-stranded DNA 2 is shown as SEQ ID NO.3, the crRNA sequence is shown as SEQ ID NO.4, and the fluorescent signal probe is shown as 5'-FAM-TTATT-BHQ-3'.

[0010] Preferably, the concentration of the circular single-stranded DNA 1 is 10nM to 1μM; the concentration of the Nt.BstNBI enzyme is 1 to 10U; the concentration of the circular single-stranded DNA 2 is 1nM to 10nM; the concentration of the phi29 DNA polymerase is 1 to 10U; the concentration of the Nt.BbvCI enzyme is 1 to 10U; the concentration of the Cas12a enzyme is 0.1 to 2μM; the concentration of the crRNA is 0.1 to 2μM; and the concentration of the fluorescent signal probe is 1 to 10μM.

[0011] Preferably, the nicking enzyme triggers the target nucleic acid circulation system, comprising 1 μM circular single-stranded DNA 1, 3UNt.BstNBI enzyme and reaction buffer 1; the reaction buffer 1 comprises 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml recombinant albumin.

[0012] Preferably, the nicking enzyme-induced exponential RCA amplification system of the present invention includes 10 nM circular single-stranded DNA 2, 2U t.BbvCI enzyme, 2U phi29 DNA polymerase, 10 mM dNTPs, 1 mM DTT, and 1×phi29 DNA polymerase reaction buffer.

[0013] Preferably, the CRISPR / Cas12a reaction system includes 1 μM crRNA, 1.5 μM Cas12a enzyme, 1 μM fluorescent signal probe and reaction buffer 2; the reaction buffer contains 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml recombinant albumin.

[0014] 2. Application of the p53 gene detection kit based on non-specific index RCA activation CRISPR / Cas12a in detecting the p53 gene.

[0015] 3. A method for detecting the p53 gene using the p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA, characterized in that it comprises the following steps:

[0016] (1) adding the sample to be tested to a mixed solution containing 1 μM circular single-stranded DNA 1, 3 U Nt.BstNBI enzyme and reaction buffer 1; after being fully mixed, incubating at 55° C. for 1 hour to allow the Nt.BstNBI enzyme to fully shear the circular single-stranded DNA 1 into linear DNA 1 fragments, and then heating to 95° C. for 5 minutes to inactivate the Nt.BstNBI enzyme;

[0017] (2) adding the product obtained in step (1) to a mixed solution containing 10 nM circular single-stranded DNA 2, 2 U Nt.BbvCI enzyme, 2 U phi29 DNA polymerase, 10 mM dNTPs, 1 mM DTT, and 1× phi29 DNA polymerase reaction buffer, mixing thoroughly, and incubating at 37° C. for 1 hour to allow the linear DNA 1 to continuously extend along the circular single-stranded DNA 2 template, and the extended product can be cleaved by the Nt.BbvCI enzyme, and the cleaved short fragment product can be released from the circular single-stranded DNA 2 and used as a primer to induce the next RCA reaction to achieve exponential RCA amplification, and finally heating to 80° C. for 20 minutes to inactivate the Nt.BstNBI enzyme and phi29 DNA polymerase;

[0018] (3) Add 1 μM crRNA, 1.5 μM Cas12a enzyme and buffer 2 to a clean enzyme-free PCR reaction tube and leave at room temperature for 10 minutes to form a crRNA / Cas12a complex;

[0019] (4) adding the nicking enzyme-induced exponential RCA amplification product obtained in step (2) and 1 μM fluorescent signal probe to the mixed solution prepared in step (3), mixing thoroughly, and incubating at 37° C. for 5 minutes; in the presence of the RCA product, the Cas12a enzyme is activated and shears the fluorescent signal probe in the reaction system, thereby releasing the fluorescent signal; collecting the fluorescent signal value in real time at intervals of 1 minute to detect the p53 gene content in the sample;

[0020] The concentrations of the components of buffer 1 are as follows: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml recombinant albumin;

[0021] The concentrations of the components of buffer 2 are as follows: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml recombinant albumin.

[0022] The beneficial effects of the present invention are as follows: the present invention discloses a p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA, and the detection using the system has the following advantages:

[0023] (1) Constant temperature detection, no need for precise temperature changing equipment.

[0024] (2) Ultrasensitive detection: Through triple signal amplification of target nucleic acid circulation triggered by nicking enzyme, exponential RCA amplification reaction, and CRISPR / Cas12a reaction, ultrasensitive detection of trace amounts of p53 gene as low as 0.77fM is achieved.

[0025] (3) Highly specific detection: The Nt.BstNBI enzyme with the ability to recognize single-base mismatches, the exponential RCA reaction that eliminates nonspecific amplification, and the highly specific CRISPR / Cas12a system highly guarantee the specificity of this detection method and can accurately detect the target p53 gene from a variety of interfering nucleic acids.

[0026] (4) It is universal and easy to operate. It only needs to replace the corresponding circular single-stranded DNA 1 and the nicking enzyme according to the target nucleic acid to complete the ultra-sensitive and highly specific detection of a variety of target nucleic acids. In addition, the method has low detection cost, short response time, and high cost performance. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0028] Figure 1 It is a schematic diagram of the detection principle of the present invention;

[0029] Figure 2 The feasibility analysis results of the detection system of the present invention are shown in Figure 1 (A: Nt.BstNBI enzyme triggered target nucleic acid cycle gel electrophoresis results; B: Nt.BbvCI enzyme induced index RCA gel electrophoresis results; C: CRISPR / Cas12a detection of single-stranded DNA fluorescence results; D: CRISPR / Cas12a activation based on non-specific index RCA detection of p53 gene fluorescence results);

[0030] Figure 3 The optimal conditions for the detection system of the present invention (A: Nt.BstNBI enzyme concentration; B: Nt.BstNBI enzyme-triggered target nucleic acid cycle time; C: circular single-stranded DNA2 concentration; D: phi29 DNA polymerase concentration; E: Nt.BbvCI enzyme concentration; F: Cas12a to crRNA concentration ratio);

[0031] Figure 4 The detection performance of the detection system of the present invention (A: time-dependent fluorescence signal change diagram; B: enlarged diagram of 0fM to 10pM in Figure A; C: 10fM to 1nM calibration curve diagram; D: 10fM to 10pM calibration curve diagram; E: 10pM to 1nM calibration curve diagram);

[0032] Figure 5 The specificity, repeatability and stability of the detection system of the present invention (A: time-dependent fluorescence signal generated by target p53 gene and interfering nucleic acid; B: histogram of fluorescence signal generated by target p53 gene and interfering nucleic acid; C: repeatability result; D: stability result);

[0033] Figure 6 The detection system of the present invention detects clinical serum samples and compares the results with qPCR. DETAILED DESCRIPTION

[0034] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0035] The detection principle of the present invention is as follows: when the target p53 gene exists, the circular single-stranded DNA 1 hybridizes with p53 to form a double-stranded structure containing the Nt.BstNBI enzyme action site. Under the action of the Nt.BstNBI enzyme, the circular single-stranded DNA 1 is sheared into a linear DNA 1 structure, and the p53 gene is released to enter the next cycle. Linear DNA 1 can be used as a primer, and the circular single-stranded DNA 2 is used as a template. Under the action of the phi29 DNA enzyme, the linear DNA 1 is continuously extended along the circular single-stranded DNA 2 template, and the extended product is sheared into short linear fragments by the Nt.BbvCI enzyme, and is released from the circular single-stranded DNA 2 template as a new primer to trigger the next RCA reaction, thereby exponentially amplifying the detection signal. In the exponential RCA reaction system, the RCA front primer (circular single-stranded DNA 1) and the template (circular single-stranded DNA 2) are both designed as a circular structure, which completely eliminates the nonspecific signal amplification in the RCA amplification process and achieves high-fidelity amplification. When RCA products are present, the trans-cleavage activity of crRNA / Cas12a is activated, thereby cleaving the fluorescent signal probes nearby and releasing fluorescent signals. Figure 1 shown.

[0036] (1) The p53 gene sequence is as follows:

[0037] 5'-CCTCACCATCATCACACTGGAAGACTCCAGGTCAGGAGCCACTTGCCACCC TGCACA-3'(SQEID NO.1);

[0038] (2) The sequence of circular single-stranded DNA 1 is as follows:

[0039] 5'-

[0040] TTTCGTAGTAACCAGTCTAGTA GAGTC TTCCA·GTGTGATGAACATGATCT-3'(SQE ID NO.2); (the underline is the Nt.BstNBI enzyme recognition site, the · is the Nt.BstNBI enzyme cleavage site, and the bold italic part is the complementary sequence to the circular single-stranded DNA 2);

[0041] (3) The sequence of circular single-stranded DNA2 is as follows:

[0042] 5'- GAGG AAGACTCTACTAGACTG GCTGAGG TTTGACATCACAGTATCTTAATGA GC T -3'(SEQ ID NO.3); (the bold italic part is the complementary sequence to the circular single-stranded DNA 1, and the double underlined bases are the Nt.BbvCI enzyme recognition sites)

[0043] (4) The crRNA sequence is as follows:

[0044] 5'-UAAUUUCUACUAAGUGUAGAUACAUCACAGUAUCUUAAUGA-3' (SEQ ID NO. 4);

[0045] (5) The sequence of the fluorescent signal probe is as follows: 5′-FAM-TTATT-BHQ-3′;

[0046] Example 1: Feasibility analysis of the detection system of the present invention

[0047] (1) Gel electrophoresis analysis of target nucleic acid circulation triggered by Nt.BstNBI enzyme: 0.5 μM synthetic p53 gene was added to a mixed solution containing 1 μM circular single-stranded DNA 1, 3U Nt.BstNBI enzyme and reaction buffer 1, mixed thoroughly, and incubated at 55°C for 1 hour. 12% polyacrylamide gel electrophoresis (PAGE) was used to verify the feasibility of Nt.BstNBI enzyme triggering target nucleic acid circulation. The results are as follows: Figure 2 As shown in A. When p53 (lane 1) is present, circular single-stranded DNA 1 (lane 2) can hybridize with p53 fragments (lane 5), and circular single-stranded DNA 1 can be cut into linear fragments by Nt.BstNBI enzyme (lane 6). Lane 3 shows that when p53 is not present, Nt.BstNBI enzyme cannot cut circular single-stranded DNA 1. Lane 4 shows that when circular single-stranded DNA 1 is not present, Nt.BstNBI enzyme cannot cut p53 gene either. This result confirms that Nt.BstNBI enzyme is feasible to trigger the target nucleic acid cycle.

[0048] (2) Analysis of the index of RCA induced by Nt.BbvCI enzyme: 10 nM synthetic p53 gene was added to a mixed solution containing 1 μM circular single-stranded DNA 1, 3 U Nt.BstNBI enzyme and reaction buffer 1. After thorough mixing, the mixture was incubated at 55°C for 1 hour, and then heated to 95°C for 5 minutes to inactivate the Nt.BstNBI enzyme. The product was added to a mixed solution containing 10 nM circular single-stranded DNA 2, 2 UNt.BbvCI enzyme, 2 U phi29 DNA polymerase, 10 mM dNTPs, 1 mM DTT, and 1× phi29 DNA polymerase reaction buffer. After thorough mixing, the mixture was incubated at 37°C for 1 hour, and then heated to 80°C for 20 minutes to inactivate the Nt.BstNBI enzyme and phi29 DNA polymerase. For linear RCA reactions, it is not necessary to add Nt.BbvCI enzyme. The feasibility of Nt.BbvCI enzyme-induced exponential RCA was verified by 12% PAGE. Figure 2 As shown in B. In the absence of Nt.BbvCI enzyme, a bright band was observed at the top of the well (lane 2). In contrast, when Nt.BbvCI enzyme was added to the RCA reaction system, in addition to the bright band observed at the top of the well, diffuse bands of varying sizes were observed at the bottom of the lane (lane 1). These diffuse bands were formed by the cleavage of RCA products by Nt.BbvCI enzyme. As expected, no RCA product was observed in the absence of p53 (lane 3). This result confirms the feasibility of Nt.BbvCI enzyme-induced exponential RCA.

[0049] (3) Feasibility verification of CRISPR / Cas12a detection of single-stranded DNA: Add 1μM crRNA, 1μM Cas12a enzyme and buffer 2 to a clean, enzyme-free PCR reaction tube and leave at room temperature for 10 minutes to form a crRNA / Cas12a complex. Add 10nM target ssDNA and 1μM fluorescent signal probe to the reaction tube, mix thoroughly, incubate at 37°C for 5 minutes, and continuously monitor the change of fluorescent signal every one minute. The results are as follows: Figure 2 As shown in C. The target ssDNA induced a significant and gradually increasing fluorescence signal, while the non-target ssDNA only produced a very low and stable background fluorescence signal, the signal intensity of which was not significantly different from the fluorescence signal intensity in the absence of target nucleic acid or Cas12a or crRNA. This result shows that CRISPR / Cas12a can detect target ssDNA.

[0050] (4) Feasibility analysis of the detection system of the present invention: 1nM synthetic p53 gene was added to a mixed solution containing 1μM circular single-stranded DNA1, 3U Nt.BstNBI enzyme and reaction buffer 1. After thorough mixing, incubate at 55°C for 1 hour, then heat to 95°C for 5 minutes to inactivate the Nt.BstNBI enzyme. The product was added to a mixed solution containing 10nM circular single-stranded DNA2, 2UNt.BbvCI enzyme, 2U phi29 DNA polymerase, 10mM dNTPs, 1mM DTT, and 1×phi29 DNA polymerase reaction buffer, and after thorough mixing, incubate at 37°C for 1 hour, then heat to 80°C for 20 minutes to inactivate the Nt.BstNBI enzyme and phi29 DNA polymerase. 1μM crRNA, 1μM Cas12a enzyme and buffer 2 were added to a clean enzyme-free PCR reaction tube and placed at room temperature for 10 minutes to form a crRNA / Cas12a complex. Add RCA product and 1 μM fluorescent signal probe to the reaction tube containing crRNA / Cas12a, mix thoroughly, and immediately place in a PCR instrument for incubation at 37°C for 5 minutes, and continuously monitor the change of fluorescent signal every one minute. The results are as follows: Figure 2 As shown in D. p53 can induce a significant and gradually increasing fluorescence signal (with p53); when p53 is absent, only a very low and stable fluorescence signal intensity is generated (no p53); when Nt.BbvCI is not added, RCA is a linear amplification, and the fluorescence signal intensity is significantly lower than the fluorescence signal intensity generated when Nt.BbvCI is present (no Nt.BbvCI). This result shows that the detection system of the present invention is feasible.

[0051] Example 2: Condition optimization of the detection system of the present invention

[0052] The present invention obtains the best reaction conditions by keeping other conditions unchanged and changing the concentration or time of a certain parameter in the experiment one by one. 0 ) / F 0 The values ​​of F and F 0 Represent the fluorescence signal intensity of the experimental group containing p53 and the control group without p53, respectively.

[0053] Nt.BstNBI enzyme concentration optimization:

[0054] (1) 0.5U, 1U, 2U, 3U, 4U, and 5U of Nt.BstNBI enzyme were added to a mixed solution containing 100 pM synthetic p53 gene, 1 μM circular single-stranded DNA 1, and reaction buffer 1. After thorough mixing, the mixture was incubated at 55°C for 1 hour, and then heated to 95°C for 5 minutes to inactivate the Nt.BstNBI enzyme.

[0055] (2) The product of step (1) was added to a mixed solution containing 10 nM circular single-stranded DNA2, 2 U Nt.BbvCI enzyme, 2 U phi29 DNA polymerase, 10 mM dNTPs, 1 mM DTT, and 1× phi29 DNA polymerase reaction buffer. After thorough mixing, the mixture was incubated at 37° C. for 1 hour, and then heated to 80° C. for 20 minutes to inactivate the Nt.BstNBI enzyme and phi29 DNA polymerase.

[0056] (3) Add 1 μM crRNA, 1 μM Cas12a enzyme and buffer 2 to a clean enzyme-free PCR reaction tube and leave at room temperature for 10 minutes to form a crRNA / Cas12a complex.

[0057] (4) Add the product of step (2) and 1 μM fluorescent signal probe to the reaction tube containing step (3), mix thoroughly, and immediately place in a PCR instrument for incubation at 37° C. for 5 minutes, and continuously monitor the change of the fluorescent signal every one minute.

[0058] The results are as follows Figure 3 As shown in A, the maximum ΔF value appeared when the Nt.BstNBI enzyme concentration was 3U. Thereafter, the ΔF value decreased with the increase of Nt.BstNBI enzyme concentration, indicating that the optimal concentration of Nt.BstNBI enzyme was 3U.

[0059] Optimization of target nucleic acid cycle time triggered by Nt.BstNBI enzyme:

[0060] Because Nt.BstNBI enzyme plays a key role in the first signal amplification process, the cycle time of target nucleic acid triggered by Nt.BstNBI enzyme was optimized. The cycle time of target nucleic acid triggered by Nt.BstNBI enzyme was 0.5h, 1h, 1.5h, 2h, and 2.5h respectively, and the other experimental steps were the same as Example 2. The results are shown in Figure 3 As shown in B, as the target nucleic acid circulation time triggered by Nt.BstNBI enzyme increases from 0.5h to 2.5h, the ΔF value first gradually increases and then gradually decreases. When the target nucleic acid circulation time triggered by Nt.BstNBI enzyme is 1h, the ΔF value reaches the maximum value, indicating that 1h is the optimal time for Nt.BstNBI enzyme to trigger the target nucleic acid circulation.

[0061] Circular single-stranded DNA2 concentration optimization:

[0062] The exponential RCA reaction was performed with the circular single-stranded DNA 2 at concentrations of 1 nM, 3 nM, 5 nM, 10 nM, and 15 nM, respectively, and the other experimental steps were the same as those in Example 2. The results are shown in FIG. Figure 3As shown in Figure C, as the concentration of circular single-stranded DNA2 increases from 1 nM to 10 nM, the ΔF value gradually increases, but when the concentration of circular single-stranded DNA2 continues to increase from 10 nM to 15 nM, the ΔF value gradually decreases, indicating that 10 nM is the optimal concentration of circular single-stranded DNA2.

[0063] Optimization of phi29 DNA polymerase content:

[0064] The phi29 DNA polymerase content was 0.5U, 1U, 1.5U, 2U and 2.5U respectively for exponential RCA reaction, and the other experimental steps were the same as in Example 2. The results are shown in Figure 3 As shown in D, as the phi29 DNA polymerase content increased, the ΔF value gradually increased. When the phi29 DNA polymerase content exceeded 2U, the ΔF value decreased slightly, indicating that the optimal content of phi29 DNA polymerase was 2U.

[0065] Nt.BbvCI enzyme content optimization:

[0066] The exponential RCA reaction was performed with Nt.BbvCI enzyme contents of 0.5U, 1U, 1.5U, 2U and 3U, and the other experimental steps were the same as in Example 2. The results are shown in Figure 3 As shown in Figure E, as the Nt.BbvCI enzyme content increased, the ΔF value gradually increased. When the Nt.BbvCI enzyme content exceeded 2U, the ΔF value decreased slightly, indicating that the optimal content of Nt.BbvCI enzyme was 2U.

[0067] Optimization of Cas12a and crRNA concentration ratio:

[0068] The CRISPR / Cas12a reaction was performed with a Cas12a to crRNA concentration ratio of 0.2:1, 0.5:1, 1:1, 1.5:1, and 2:1, respectively, and the other experimental steps were the same as in Example 2. The results are shown in Figure 3 As shown in Figure F, as the concentration ratio of Cas12a to crRNA increases, the ΔF value gradually increases. When the concentration ratio of Cas12a to crRNA exceeds 1.5:1, the ΔF value tends to stabilize, indicating that the optimal concentration ratio of Cas12a to crRNA is 1.5:1.

[0069] Example 3: Detection performance of the detection system of the present invention

[0070] The sensitivity analysis of the detection system of the present invention was carried out under the optimal conditions optimized in Example 2. Synthetic p53 was diluted to concentrations of 0fM, 10fM, 50fM, 100fM, 500fM, 1pM, 5pM, 10pM, 50pM, 100pM, 500pM, and 1nM, and then detected by the detection system of the present invention. The results are shown in FIG. Figure 4As shown in Figure 2, as the p53 concentration gradually increases, the fluorescence signal intensity gradually increases ( Figure 4 When the p53 concentration was between 10fM and 1nM, the ΔF value showed a linear trend with the logarithm of the p53 concentration ( Figure 4 C in the figure). The linear fitting equation for p53 concentration between 10fM and 10pM is: ΔF 1 =0.34lg cp53+0.094, R 2 is 0.995( Figure 4 D); the linear fitting equation for p53 concentration between 10pM and 1nM is: ΔF 2 =4.723lgcp53–17.448, R 2 is 0.997( Figure 4 E). By adding three times the standard deviation of the average signal of the blank sample, the minimum detection limit (LOD) of the detection system of the present invention is calculated to be 0.77 fM, indicating that the method has high sensitivity.

[0071] Example 4: Specificity, repeatability and stability of the detection system of the present invention

[0072] The specificity of the detection system of the present invention was verified by detecting target p53, interfering nucleic acid sequences, and a mixture of target p53 and all interfering nucleic acids, and the concentration of all nucleic acid sequences was 1nM. Interfering nucleic acid sequences include: single-base mismatch sequence (MT1), double-base mismatch sequence (MT2), triple-base mismatch sequence (MT3), miRNA-21, EGFR 19del, Krase. The repeatability of the detection system of the present invention was verified by repeating the detection of 1nM target p53 10 times in a batch. The stability of the detection system of the present invention was verified by storing the reaction solution at -20°C, monitoring the fluorescence signal intensity every day, and continuously monitoring for 10 days. All reaction conditions were carried out under the optimal conditions of Example 2.

[0073] The specific results of the detection system of the present invention are as follows Figure 5 As shown in A and B in FIG, target p53 induced a significant time-dependent fluorescence intensity, which was not significantly different from the response of the mixture containing p53 and interfering oligonucleotides; however, the fluorescence intensity of other interfering oligonucleotides was almost negligible, indicating that the detection system of the present invention can accurately identify target p53 from interfering nucleic acids with high specificity. The reproducibility results of the detection system of the present invention are shown in FIG. Figure 5 As shown in C in FIG. 1 , the relative standard deviation (RSD) of 10 repeated experiments is 2.9%, indicating that the detection system of the present invention has good repeatability. The stability results of the detection system of the present invention are shown in FIG. Figure 5As shown in D, the ΔF value of the reaction solution after being stored at -20°C for 10 days can still reach 97.78% of the initial value, and the RSD is 4.02%, indicating that the detection system of the present invention has excellent stability.

[0074] Example 5: The detection system of the present invention detects clinical serum samples and compares them with qPCR

[0075] Before the launch, the present invention was approved by the Medical Ethics Committee of the Second Affiliated Hospital of the Army Medical University, and a total of 8 clinical blood samples were collected from the Second Affiliated Hospital of the Army Medical University in Chongqing. The blood was centrifuged at 3000 rpm for 10 minutes, and the upper light yellow serum was aspirated and frozen at -80°C for standby use. Free cell DNA (cfDNA) was extracted and purified from the same volume of serum using a serum / plasma circulating DNA kit (Tian Gen). The DNA content was then determined using a Nanodrop 2000 spectrophotometer, and the extracted cfDNA was stored at -20°C for standby use.

[0076] qPCR detection of cfDNA extraction: qPCR was performed using the TB Green Premix Ex Taq II kit (Takara). The β-actin gene was used as the internal reference for the qPCR reaction. The volume of the qPCR reaction solution was 25 μL, consisting of 1 μL reverse primer (10 μL), 1 μL forward primer (10 μL), 12.5 μL 2×TB Green Premix Ex Taq II (Tli RNase H Plus), 2 μL extracted cfDNA, and 8.5 μL DNase / RNase-free water. The amplification reaction was performed according to the following thermal cycle parameters: 95°C for 30 s; then 95°C for 5 s, 55°C for 30 s, and 72°C for 30 s for 40 cycles. The relative expression of the p53 gene in each sample was calculated using the threshold cycle method (Ct), that is, the Ct value of the β-actin gene minus the Ct value of the p53 gene.

[0077] p53 forward primer sequence: CAC CAT CAT CAC ACT GGA AGA C (SEQ ID NO. 5);

[0078] p53 reverse primer sequence: GTA TGG AAG AAA TCG GTA AGA GG (SEQ ID NO. 6);

[0079] β-actin forward primer sequence: CAT CCG CAA AGA CCT GTA CG (SEQ ID NO. 7);

[0080] β-actin reverse primer sequence: CCT GCT TGC TGA TCC ACA TC (SEQ ID NO. 8).

[0081] The detection system of the present invention detects the extracted cfDNA: Before detection by the detection system of the present invention, all extracted cfDNA samples with the same mass concentration are heated to 95°C for 5 minutes, and then quickly placed at -20°C for 10 minutes to dissociate the dsDNA into ssDNA, and then each sample is detected under the optimal conditions of Example 2.

[0082] The results of the detection system of the present invention and qPCR detection of clinical serum samples are as follows Figure 6 As shown, the measurement results of the detection system of the present invention are completely consistent with the results of qPCR, indicating that the detection system of the present invention can accurately detect p53 in clinical serum samples and is expected to be used for the detection of p53 in real clinical serum samples, providing potential application prospects for early screening and diagnosis of cancer.

[0083] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA, characterized in that: The kit includes a nicking enzyme-triggered target nucleic acid circulation system, a nicking enzyme-induced exponential RCA amplification system and a CRISPR / Cas12a reaction system; The nicking enzyme-triggered target nucleic acid circulation system comprises a circular single-stranded DNA 1 and an Nt.BstNBI enzyme. The circular single-stranded DNA 1 contains a sequence complementary to the p53 gene and forms an Nt.BstNBI enzyme action site in the complementary double-stranded region. When the p53 gene is present, the circular single-stranded DNA 1 hybridizes with the p53 gene to form a double strand, and is thus cut into linear DNA 1 fragments by the Nt.BstNBI enzyme, and the p53 gene is released. The nicking enzyme-induced exponential RCA amplification system contains circular single-stranded DNA 2, Nt.BbvCI enzyme and phi29 DNA polymerase; the circular single-stranded DNA 2 contains a base complementary pairing region with the circular single-stranded DNA 1 and a Nt.BbvCI enzyme recognition site, and the circular single-stranded DNA 2 can serve as a template to amplify and extend the linear DNA 1 fragment along the circular single-stranded DNA 2 in the presence of the phi29 DNA polymerase; and under the action of the Nt.BbvCI enzyme, the linear DNA 1 fragment is sheared along the circular single-stranded DNA 2 amplified product, and the product is released from the circular single-stranded DNA 2 to trigger the next RCA reaction as a new primer; The CRISPR / Cas12a reaction system includes a crRNA sequence and a fluorescent signal probe. The crRNA sequence can bind to the Cas12a protein to form a complex crRNA / Cas12a and hybridize with the RCA product. The trans-cleavage activity of the crRNA / Cas12a complex is activated in the presence of the RCA product, and the activated crRNA / Cas12a complex can cut the fluorescent signal probe and release a fluorescent signal.

2. According to claim 1, the p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA is characterized in that: The sequence of the circular single-stranded DNA 1 is shown as SEQ ID NO.2, the sequence of the circular single-stranded DNA 2 is shown as SEQ ID NO.3, the crRNA sequence is shown as SEQ ID NO.4, and the fluorescent signal probe is shown as 5'-FAM-TTATT-BHQ-3'.

3. According to claim 1, the p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA is characterized in that: The concentration of the circular single-stranded DNA 1 is 10nM~1μM; the concentration of the Nt.BstNBI enzyme is 1~10U; the concentration of the circular single-stranded DNA 2 is 1nM~10nM; the concentration of the phi29 DNA polymerase is 1~10U; the concentration of the Nt.BbvCI enzyme is 1~10U; the concentration of the Cas12a enzyme is 0.1~2μM; the concentration of the crRNA is 0.1~2μM; the concentration of the fluorescent signal probe is 1~10μM.

4. The p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA according to claim 1, characterized in that: The nicking enzyme-triggered target nucleic acid circulation system includes 1 μM circular single-stranded DNA 1, 3UNt.BstNBI enzyme and reaction buffer 1; the reaction buffer 1 includes 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, and 100 μg / ml recombinant albumin.

5. The p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA according to claim 1, characterized in that: The nicking enzyme-induced exponential RCA amplification system includes 10nM circular single-stranded DNA2, 2UNt.BbvCI enzyme, 2Uphi29 DNA polymerase, 10mM dNTPs, 1mM DTT, and 1×phi29 DNA polymerase reaction buffer.

6. The p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA according to claim 1, characterized in that: The CRISPR / Cas12a reaction system includes 1 μM crRNA, 1.5 μM Cas12a enzyme, 1 μM fluorescent signal probe and reaction buffer 2; the reaction buffer contains 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 100 μg / ml recombinant albumin.

7. Use of the p53 gene detection kit based on non-specific index RCA activation CRISPR / Cas12a according to any one of claims 1 to 6 in detecting the p53 gene.

8. A method for detecting the p53 gene using the p53 gene detection kit based on CRISPR / Cas12a activation without non-specific index RCA according to any one of claims 1 to 6, characterized in that: The steps include: (1) adding the sample to be tested to a mixed solution containing 1 μM circular single-stranded DNA 1, 3 U Nt.BstNBI enzyme and reaction buffer 1; after being fully mixed, incubating at 55° C. for 1 hour to allow the Nt.BstNBI enzyme to fully shear the circular single-stranded DNA 1 into linear DNA 1 fragments, and then heating to 95° C. for 5 minutes to inactivate the Nt.BstNBI enzyme; (2) adding the product obtained in step (1) to a mixed solution containing 10 nM circular single-stranded DNA 2, 2 U Nt.BbvCI enzyme, 2 U phi29 DNA polymerase, 10 mM dNTPs, 1 mM DTT, and 1× phi29 DNA polymerase reaction buffer, mixing thoroughly, and incubating at 37° C. for 1 hour to allow the linear DNA 1 to continuously extend along the circular single-stranded DNA 2 template, and the extended product can be cleaved by the Nt.BbvCI enzyme, and the cleaved short fragment product can be released from the circular single-stranded DNA 2 and used as a primer to induce the next RCA reaction to achieve exponential RCA amplification, and finally heating to 80° C. for 20 minutes to inactivate the Nt.BstNBI enzyme and phi29 DNA polymerase; (3) Add 1 μM crRNA, 1.5 μM Cas12a enzyme and buffer 2 to a clean enzyme-free PCR reaction tube and leave at room temperature for 10 minutes to form a crRNA / Cas12a complex; (4) adding the nicking enzyme-induced exponential RCA amplification product obtained in step (2) and 1 μM fluorescent signal probe to the mixed solution prepared in step (3), mixing thoroughly, and incubating at 37° C. for 5 minutes; in the presence of the RCA product, the Cas12a enzyme is activated and shears the fluorescent signal probe in the reaction system, thereby releasing the fluorescent signal; collecting the fluorescent signal value in real time at intervals of 1 minute to detect the p53 gene content in the sample; The concentrations of the components of the buffer 1 are as follows: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml recombinant albumin; The concentrations of the components of the buffer 2 are as follows: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 100 μg / ml recombinant albumin.

Images