Capture probe of fruit fly miRNA library rRNA and application of capture probe

Abstract

The invention relates to the technical field of miRNA library building and sequencing, in particular to a capture probe of fruit fly miRNA library rRNA and application of the capture probe. The invention provides a capture probe of fruit fly miRNA library rRNA and application of the capture probe. The nucleotide sequence of the drosophila melanogaster rRNA capture probe is as shown in SEQ ID NO. 2. The capture probe of the fruit fly miRNA library rRNA provided by the invention has good specificity, can effectively remove the rRNA sequence in the fruit fly sample miRNA library, and improves the effectiveness and accuracy of miRNA data.

Description

Technical Field

[0001] The invention relates to the technical field of miRNA library construction and sequencing, and in particular to a capture probe of rRNA in a Drosophila miRNA library and an application thereof. Background Art

[0002] Ribosomal RNA (rRNA) is the most abundant type of RNA in cells, accounting for more than 80% of all RNA in cells. In eukaryotes, it is mainly divided into 5S rRNA (about 120nt), 5.8S rRNA (about 160nt), 18S rRNA (about 1900nt) and 28S (about 4700nt) rRNA. Among them, 5.8S rRNA is the rRNA unique to the large subunit of eukaryotes. Since the 5.8S gene fragment is short (about 100bp in length), the amount of information contained is too small and it is rarely used alone.

[0003] MicroRNA (miRNA) is a type of non-coding single-stranded RNA molecule with a length of about 19-24nt encoded by endogenous genes. They participate in post-transcriptional gene expression regulation in animals and plants. MiRNA is usually located in intergenic or intronic regions, so it is generally believed that it is not transcribed as part of encoding other types of genes. These small RNA molecules bind to specific bases of target mRNA, causing target mRNA degradation or inhibiting its translation, thereby regulating gene expression after transcription.

[0004] In order to identify specific miRNAs, small RNA seq is an important research method, which not only has the advantages of efficient screening ability, specificity and sensitivity, but also can quantify miRNA isomers and detect new miRNAs. The classic small RNA library construction method is based on connecting two sequencing adapters at the 3' and 5' ends of RNA, enriching with PCR, and then obtaining the miRNA region by gel cutting and sorting.

[0005] Studies have found that the dipteran insect Drosophila Drosophila , Musca Musca and Glossina GlossinaThe 5.8S rRNA of Drosophila is fragmented, including mature 5S rRNA and 2S rRNA and transcribed spacer sequence ITS-2a. The 5.8S rRNA of Mediterranean fruit fly is divided into two fragments, 5S (122bp) and 2S (30bp) by ITS-2a (28bp), but the Culicidae is an exception, with a complete and continuous 5.8S fragment. In other words, due to the particularity of Drosophila samples, the fragmented 2S rRNA fragment just overlaps with the conventional miRNA region, so the risk of rRNA sequence contamination is increased during the construction of miRNA library. The proportion of rRNA is extremely high, and rRNA is often enriched during gel cutting and sorting. rRNA will occupy a large amount of available data, resulting in rRNA contamination in the offline data.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a capture probe for rRNA of a Drosophila miRNA library and its application.

[0008] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a Drosophila rRNA capture probe, the nucleotide sequence of which is shown in SEQ ID NO. 2. The Drosophila miRNA library rRNA capture probe provided by the present invention has good specificity, can effectively remove rRNA sequences in the Drosophila sample miRNA library, and improve the effectiveness and accuracy of miRNA data.

[0009] In a second aspect, the present invention provides the use of the Drosophila rRNA capture probe in removing rRNA sequences in a Drosophila sample miRNA library.

[0010] In a third aspect, the present invention provides a method for removing rRNA sequences in a Drosophila sample miRNA library. In the process of constructing a Drosophila sample miRNA library, the Drosophila rRNA capture probe is used to perform a hybridization reaction with the total RNA of the Drosophila sample to be sequenced, and then a linker addition reaction is performed.

[0011] Preferably, in the hybridization reaction, the concentration of the total RNA sample is 100±20 ng / μL; the concentration of the Drosophila rRNA capture probe buffer is 10±2 μM; and the volume ratio of the total RNA sample to the Drosophila rRNA capture probe buffer is <5-10:1.

[0012] Further preferably, in the hybridization reaction, the concentration of the total RNA sample is 100±10 ng / μL; the concentration of the Drosophila rRNA capture probe buffer is 10±1 μM; and the volume ratio of the total RNA sample to the Drosophila rRNA capture probe buffer is <5:1.

[0013] In a fourth aspect, the present invention provides a method for constructing a Drosophila sample miRNA library, comprising the following steps: adding the Drosophila rRNA capture probe when constructing the Drosophila miRNA library to block the rRNA sequence.

[0014] Preferably, the method for constructing a miRNA library of Drosophila samples comprises the following steps: preparing total RNA of Drosophila samples to be sequenced; adding the Drosophila rRNA capture probe for hybridization reaction; adding linker reaction; reverse transcription synthesis of cRNA; PCR enrichment and purification followed by gel cutting and sorting to obtain the miRNA library to be sequenced.

[0015] Preferably, the linker addition reaction sequentially comprises the steps of: connecting a 3' linker, blocking excess 3' linkers, and connecting a 5' linker.

[0016] In a fifth aspect, the present invention provides the use of the Drosophila rRNA capture probe in preparing a reagent for removing rRNA sequences in a Drosophila sample miRNA library.

[0017] In a sixth aspect, the present invention provides a reagent for removing rRNA sequences in a miRNA library of a Drosophila sample, which comprises the Drosophila rRNA capture probe.

[0018] Beneficial effects:

[0019] The present invention provides a capture probe for rRNA of a Drosophila miRNA library and its application. The nucleotide sequence of the Drosophila rRNA capture probe is shown in SEQ ID NO.2. When constructing a Drosophila miRNA library, the Drosophila rRNA capture probe provided by the present invention is added to block the rRNA sequence to obtain an RNA sequence without rRNA, and miRNA is constructed on this, which can reduce the rRNA information in the library. The rRNA capture probe provided by the present invention can specifically hybridize with Drosophila rRNA, and can achieve high-efficiency and low-cost rRNA removal, significantly improving the specificity and accuracy of target miRNA molecule detection, so that more useful miRNA information can be discovered and utilized in the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0021] Figure 1 It is a technical flow chart of the present invention.

[0022] Figure 2 This is the peak diagram of the library of Example 1 (Drosophila-1) of the present invention.

[0023] Figure 3 This is the peak diagram of the library of Example 2 (Drosophila-2) of the present invention.

[0024] Figure 4 This is the peak diagram of the library of Example 3 (Bactrocera dorsalis) of the present invention.

[0025] Figure 5 This is the peak diagram of the library of Example 3 (Bactrocera melanogaster) of the present invention. DETAILED DESCRIPTION

[0026] The present invention provides a capture probe for rRNA of a Drosophila miRNA library and its application. The Drosophila rRNA capture probe is combined with miRNA library construction and release (when constructing a Drosophila miRNA library, the Drosophila rRNA capture probe is added to block the rRNA sequence to obtain an RNA sequence without rRNA), which can effectively remove rRNA contamination of the miRNA library to solve the problem of excessive residual rRNA information in the Drosophila miRNA library.

[0027] The present invention firstly provides a Drosophila miRNA library rRNA capture probe, which is designed according to the Drosophila rRNA sequence and can specifically hybridize with the Drosophila rRNA. The rRNA sequence after hybridization cannot be added with a 3' linker, so that the library does not contain rRNA sequences.

[0028] The present invention further provides the use of the probe in preparing a Drosophila miRNA library, comprising the following steps: S1: Prepare total RNA of fruit fly samples to be sequenced; S2: For the full-length sequence of rRNA, a single-stranded DNA probe is designed according to each RNA sequence, which is reverse complementary to its sequence; S3: in a hybridization buffer, the total RNA molecules are contacted with the probes to allow the probes to hybridize with the rRNA molecules therein to form RNA-DNA hybrid double strands, thereby obtaining a hybridization mixture to block the rRNA sequence; S4: Connect the hybridization mixture in the above step to the 3' adapter. Since the rRNA molecules hybridize to form a hybrid double strand of RNA-DNA, the 3' adapter cannot be connected, while the remaining RNA sequences can be connected to the 3' adapter normally; S5: Block the 3' linker to prevent linker self-ligation; S6: Connect the above sample to the 5' linker; S7: Reverse transcription is performed on the sample connected with the 3' adapter and the 5' adapter to synthesize cRNA, and then PCR enrichment is performed and purification is performed to obtain the product to be sorted; S8: The above-mentioned products to be sorted are subjected to gel excision and sorting to obtain a miRNA library to be sequenced.

[0029] Preferably, the sample of total RNA molecules in step S1 can be a tissue sample, a cell sample, a paraffin-embedded sample, a formalin-fixed paraffin-embedded sample or a whole blood sample.

[0030] In the present invention, the biological sample to be sequenced is a fruit fly tissue sample, which may include multiple species of the family Tephritidae, such as Bactrocera dorsalis, Drosophila melanogaster, and Bactrocera citrinum.

[0031] The invention also provides application of the probe in a library construction kit for preparing a Drosophila miRNA library and removing rRNA.

[0032] Compared with the prior art, the present invention has the following technical effects and advantages: The present invention designs a specific rRNA capture probe, which can effectively remove rRNA sequences in the miRNA library of Drosophila samples and improve the effectiveness and accuracy of miRNA data.

[0033] The present invention provides a method for constructing a miRNA library by removing rRNA contamination sequence information, which can achieve high-efficiency and low-cost rRNA removal; significantly improve the specificity and accuracy of target RNA molecule (mRNA, lncRNA, circRNA, etc.) detection, thereby discovering and utilizing more useful transcriptome information in samples.

[0034] The present invention significantly improves the specificity and accuracy of target miRNA molecule detection, thereby being able to discover and utilize more useful miRNA information in samples.

[0035] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0037] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "specific implementations", or "some specific implementations" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0038] In the examples provided in this specification, if no specific techniques or conditions are specified, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0039] Example 1 Design of single-stranded DNA probe An embodiment of the present invention provides a Drosophila sample rRNA capture probe.

[0040] The 5.8S rRNA of Drosophila is fragmented, including mature 5S rRNA and 2S rRNA and transcribed spacer sequence ITS-2a, wherein the 30nt long 2S rRNA is very abundant in the ovary of Drosophila. The present invention uses the sequence of Drosophila 2S rRNA as a reference sequence and designs a Drosophila rRNA capture probe according to the principle of complementary base pairing.

[0041] The present invention searches for Drosophila 2S rRNA sequences on the NCBI official website and obtains the information in Table 1 below. It is found that the rRNA sequences corresponding to 2S rRNAs with different sequence numbers are all TGCTTGGACTACATATGGTTGAGGGTTGTA (SEQ ID NO.1). According to the principle of complementary base pairing, the Drosophila rRNA capture probe sequence is designed to be TACAACCCTCAACCATATGTAGTCCAAGCA (SEQ ID NO.2).

[0042] Table 1

[0043] Example 2 Probe hybridization and Drosophila miRNA library construction and analysis 1. Hybridization of RNA samples with probes RNA samples: The total RNA of Drosophila samples was extracted by Trizol method. 500 ng of total RNA was taken and diluted to 5 μL with Nuclease-free water and placed on ice for later use.

[0044] Probe buffer: Take out the Drosophila rRNA removal probe synthesized in Example 1, centrifuge at 5000 rpm for 1 min, and dilute to a 10 μM working solution.

[0045] In a 0.2 mL centrifuge tube, prepare according to Table 2 below.

[0046] Table 2

[0047] 2. Connect 3' connector Pre-denaturation: Place the hybridized centrifuge tube on ice, add 1 μL RL3Adapter, flick to mix, place on a PCR instrument, and heat at 70°C for 2 min.

[0048] Then, the mixture was immediately placed on ice and the following reaction system (Table 3) was prepared on ice.

[0049] Table 3

[0050] After the system is prepared, mix thoroughly with a pipette, centrifuge briefly, place the centrifuge tube into a PCR instrument, incubate at 25°C for 1 hour, and then immediately place on ice.

[0051] 3. Reverse transcription primer annealing Keep the tubes on ice and prepare the following reaction mixture (Table 4).

[0052] Table 4

[0053] After the system is prepared, mix thoroughly with a pipette, centrifuge briefly, place the centrifuge tube into a PCR instrument (heated cover temperature 105°C), and execute the following (Table 5) program.

[0054] Table 5

[0055] After the reaction is completed, place on ice and proceed to the next step immediately.

[0056] 4. Connect 5' connector Take out 1.1 μL RL5 Adapter, flick to mix, centrifuge briefly, heat at 70℃ for 2 min in a PCR instrument to denature, and then immediately place on ice for later use.

[0057] Prepare the following reaction system (Table 6).

[0058] Table 6

[0059] After the system is prepared, mix thoroughly with a pipette, centrifuge briefly, place the centrifuge tube into a PCR instrument, incubate at 25°C for 1 hour, and then immediately place on ice.

[0060] 5. Reverse transcription Keep the tubes on ice and prepare the following reaction mixture (Table 7).

[0061] Table 7

[0062] After the system is prepared, mix thoroughly with a pipette, centrifuge briefly, place the centrifuge tube into a PCR instrument (heated cover temperature 105°C), and execute the following (Table 8) program.

[0063] Table 8

[0064] After the reaction is completed, place on ice and proceed to the next step.

[0065] 6. PCR amplification Keep the tubes on ice and prepare the following reaction mixture (Table 9).

[0066] Table 9

[0067] After the system is prepared, mix thoroughly with a pipette, centrifuge briefly, place the centrifuge tube into a PCR instrument (heated cover temperature 105°C), and execute the following (Table 10) program.

[0068] Table 10

[0069] 7. Library purification (1) Transfer the above PCR products into a new 96-well PCR plate, add 90 μL (1.8X) balanced magnetic beads, and mix by pipetting; (2) Incubate at room temperature for 5 min, then place on a magnetic rack and let stand for 5 min, then discard the supernatant; (3) Place the 96-well plate (1.8X) on a magnetic stand, wash the magnetic beads with 200 μL of freshly prepared 80% ethanol (do not blow off the beads), leave it on the magnetic stand for 30 seconds, and discard the supernatant; (4) Repeat the previous step and remove the supernatant with a 10 μL pipette tip after the second wash. (5) Place the 96-well plate (1.8X) on a magnetic rack and dry at room temperature for 3-5 minutes. The standard of drying is that the surface of the magnetic beads is not smooth but has no cracks. (6) Place the 96-well plate (1.8X) on the magnetic stand, add 29 μL of Nuclease-free Water, then remove the 96-well plate (1.8X) from the magnetic stand, pipette to mix, and let stand at room temperature for 5 min. (7) Then place the 96-well plate (1.8X) on a magnetic rack and let it stand for 5 min. Pipette 27.5 μL of supernatant into a new 0.2 mL PCR centrifuge tube (spotting tube).

[0070] (8) Take 1.5 μL of PCR purified product and send it to Qsep400 for testing.

[0071] 8. PAGE gel preparation (1) Preparation of 5×TBE buffer (Table 11) Table 11

[0072] (2) PAGE gel formula (Table 12) Table 12

[0073] (3) PAGE gel preparation Clean the glass plates and combs, prepare the gel rack, and make sure the rubber pad is intact. Take a set of glass plates, insert one set of glass plates into the plastic clamp, and place it on a clean table with the flat side facing down. Make sure the bottoms of the two glass plates are flush, then clamp them and fix them on the gel rack, with the bottom of the glass plates placed on the rubber pad (the purpose is to seal the bottoms of the two glass plates to form a container that can hold the gel).

[0074] Add the corresponding volume of reagents according to the formula table, pour the glue, pay attention to the height of the glue, leave enough space, quickly insert the comb, do it once, try not to pull it out and insert it again. Let it stand at room temperature and observe until the glue solidifies.

[0075] After confirming that the gel has solidified, carefully remove the gel rack, take down the glass plate (the two glass plates and the gel as a sandwich remain as a whole), wrap the glass plate with plastic wrap, and then soak it in pure water and store it in a refrigerator at 4 degrees. Generally, do not store it for more than a week (polyacrylamide hydrolysis will occur over a long period of time).

[0076] 9. PAGE gel electrophoresis (1) Add 5 μL of 6× Gel Loading dye (gel loading buffer) to the purified PCR product and flick to mix, avoiding bubbles. (2) Rinse the electrophoresis tank three times with distilled water and then pour in freshly prepared 1×TBE (5×TBE dilution) buffer; (3) Take out the gel sheet, mark the long board with a marker pen, and slowly put the gel sheet into the electrophoresis tank. Make sure there are no bubbles at the bottom of the gel sheet and fasten the fixing clip. (4) After making sure that the TBE buffer has submerged the sample wells, hold both sides of the comb with both hands and gently pull it out; (5) After the electrophoresis tank and gel are prepared, before sample application, start electrophoresis and perform a dry run without sample to test whether the electrophoresis instrument and tank are operating normally. Under normal circumstances, bubbles can be seen rising from the bottom of the tank. If there are no bubbles, check whether the circuit is well connected. (6) After the electrophoresis detection is completed, the sample is spotted. The product is added to two consecutive PAGE gel spotting wells twice, with 16.5 μL in each well. 9 μL of 20 bp Marker (TaKaRa, Takara Biotech) is added to the spotting wells on both sides of each group of samples. That is, the order of spotting wells is: marker, sample, sample, marker. There should be one marker between two samples. Three samples can be spotted on each gel.

[0077] (7) Cover the electrophoresis tank and run the electrophoresis at 120-150 V for 55 min. The end of electrophoresis is when the bromophenol blue is about 2 cm away from the bottom of the gel block.

[0078] (8) After the electrophoresis is completed, open the fixing clamp, take out the gel sheet, and use a shovel to pry open the gel sheet along the edge in order, leaving the gel on the long board (do not leave the gel on the short board). Place the gel sheet with the gel block into the newly prepared EB gel staining solution (the gel staining box should be rinsed with distilled water three times in advance to avoid cross contamination) and soak for 10 minutes.

[0079] (9) Prepare PE gloves, mark the interlayer in numerical order, and carefully transfer the dyed rubber from the long board to the PE gloves (with the protruding side of the rubber strip facing up). Be sure to ensure that the number on the rubber board is consistent with the number on the PE gloves.

[0080] 10. Rubber cutting (1) Take a 0.6 mL centrifuge tube and use a blood collection needle to poke 3 to 4 small holes at the bottom of the centrifuge tube from the inside to the outside. Put the 0.6 mL centrifuge tube into the 2 mL centrifuge tube and mark the library number on both tubes. (2) Open the 2 mL centrifuge tube and insert it into the 0.6 mL centrifuge tube, and arrange them in the order of spotting; (3) Place the gel block on a PE glove for rapid UV photography to determine the target band at 140-160 bp. If there is a specific band, cut the gel block within the target range. The cutting range is from the upper edge of 140 bp to the lower edge of 160 bp.

[0081] 11. Glue recycling (1) Place the gelatin blocks cut from the previous step into a marked 0.6 mL centrifuge tube, tightly cover the 0.6 mL tube, and centrifuge at 12,000 rpm for 2 min to allow the gelatin blocks to pass through the small holes and become broken gelatin blocks. Ensure that all gelatin blocks are centrifuged into the 2 mL centrifuge tube; (2) Discard the 0.6 mL centrifuge tube, add 125 μL GE buffer to the 2 mL centrifuge tube containing the colloid particles, and place in a 50°C metal bath for 1 h. During this period, take out and flick it every half an hour and put it back; (3) Prepare a tube of anhydrous ethanol and a tube of 80% ethanol in advance and place them in a -20℃ refrigerator for precooling; (4) Centrifuge at 12000rpm for 2min, collect the liquid evaporated to the tube wall at the bottom of the tube, transfer the supernatant of the sol solution to the Filtration Column, and centrifuge at 12000rpm for 2min (if there is no Filtration Column, centrifuge the 2mL centrifuge tube containing the colloid particles at 14000rpm for 2min, aspirate the supernatant and transfer it to a new 1.5mL centrifuge tube, but do not aspirate the colloid particles. Repeat the operation 1~2 times to ensure that the colloid particles can be removed more thoroughly); (5) Add the reagents in the following table (Table 13) to the supernatant, vortex to mix, do not centrifuge after mixing, and precipitate at -80℃ for at least 0.5h, or overnight. Table 13

[0082] (6) Precool the centrifuge at 4°C in advance, centrifuge the above precipitate at 12000rpm, 4°C, for 30min, and discard the supernatant (to avoid aspirating the precipitate); (7) Add 1 mL of pre-cooled 80% ethanol to wash the precipitate, centrifuge at 12,000 rpm, 4°C for 10 min, and discard the supernatant; centrifuge briefly and remove the remaining ethanol with a 10 μL pipette tip; (8) Dry the precipitate at room temperature, and then add 15 μL of Nuclease-free water to dissolve the precipitate; (9) After the precipitate is completely dissolved, take 1.5 μL of the sample and transfer it to a new 1.5 mL centrifuge tube and send it to Qsep400 for testing.

[0083] 12. The library quality inspection results are shown in the following table (Table 14) and Figure 2 shown.

[0084] Table 14

[0085] 13. The above library was sequenced by Illumina PE150.

[0086] 14. Sequencing statistics and quality control The original sequence obtained by sequencing contains adapter sequences or low-quality sequences. In order to ensure the accuracy of information analysis, it is necessary to perform quality control on the original data to obtain high-quality sequences (ie, clean data).

[0087] (1) Remove the joint; (2) Remove sequences shorter than 18 or longer than 30 nucleotides; (3) For each sample, remove the sequences with low quality values; (4) Remove reads with an unknown base N (N is an unrecognizable base) content greater than or equal to 10%; The statistics of sequencing data output are shown in the table below (Table 15).

[0088] Table 15

[0089] 15. ncRNA and repetitive sequence annotation Bowtie software is a short sequence alignment software, especially suitable for reads alignment obtained by high-throughput sequencing. Using Bowtie software, Clean Reads (clean reads) are aligned with the Silva database, GtRNAdb database, Rfam database and Repbase database, filtering ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA) and other ncRNAs and repetitive sequences to obtain Unannotated reads (unannotated reads) containing miRNA. The sRNA annotation classification statistics are shown in the following table (Table 16): Table 16

[0090] Example 3 Construction and analysis of a Drosophila miRNA library without rRNA removal 1. Library construction Another round of library construction was performed using the same sample according to the method of Example 2, except that rRNA removal was not performed, and the remaining steps were the same as the above example.

[0091] 2. Sequencing statistics and quality control The off-machine data generated by sequencing were preprocessed according to the method of Example 2. The statistics of sequencing data output are shown in the following table (Table 17).

[0092] Table 17

[0093] It can be seen that the proportion of valid data is significantly reduced when the sequencing data without removing rRNA.

[0094] 3. ncRNA and repetitive sequence annotation (Table 18) Table 18

[0095] It can be seen from this that compared with the sequencing data after rRNA removal, in the sequencing data without rRNA removal, rRNA accounts for as high as 80%, and the valid data is less than 20%, while the valid data after rRNA removal can reach more than 80%.

[0096] Example 4 Probe hybridization of multiple Drosophila samples and construction and analysis of Drosophila miRNA library 1. Library construction According to the method of Example 2, a library was constructed for samples of Bactrocera dorsalis and Bactrocera gigas.

[0097] 2. Sequencing statistics and quality control The off-machine data generated by sequencing was preprocessed according to the method of Example 2. The statistics of sequencing data output are shown in the following table (Table 19).

[0098] Table 19

[0099] 3. ncRNA and repetitive sequence annotation (Table 20 and Table 21) Bactrocera dorsalis Table 20

[0100] Bactrocera citrifolia Table 21

[0101] In summary, the embodiments of the present invention analyze the characteristics of rRNA of fruit fly samples, analyze the characteristics of rRNA sequences, design capture probes synthesized from rRNA of fruit fly samples, build probe hybridization and miRNA library construction processes, and perform miRNA library construction and analysis, which can effectively remove more than 60% of rRNA information. For miRNA sequencing analysis, the capture probes of rRNA of fruit fly samples of the present invention can effectively overcome the high proportion of rRNA contamination in offline data caused by the high rRNA content of some eukaryotic organisms themselves. For other samples with high rRNA content, a new idea for miRNA library construction is provided.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Drosophila rRNA capture probe, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

2. Use of the Drosophila rRNA capture probe according to claim 1 in removing rRNA sequences from a Drosophila sample miRNA library.

3. A method for removing rRNA sequences from a Drosophila sample miRNA library, characterized in that: In the process of constructing the miRNA library of Drosophila samples, the Drosophila rRNA capture probe according to claim 1 is used to perform a hybridization reaction with the total RNA of the Drosophila sample to be sequenced, and then a linker addition reaction is performed.

4. The method for removing rRNA sequences from a Drosophila sample miRNA library according to claim 3, characterized in that: In the hybridization reaction, the concentration of the total RNA sample is 100±20 ng / μL; the concentration of the Drosophila rRNA capture probe buffer is 10±2 μM; and the volume ratio of the total RNA sample to the Drosophila rRNA capture probe buffer is <5-10:

1.

5. The method for removing rRNA sequences from a Drosophila sample miRNA library according to claim 4, characterized in that: In the hybridization reaction, the concentration of the total RNA sample is 100±10 ng / μL; the concentration of the Drosophila rRNA capture probe buffer is 10±1 μM; and the volume ratio of the total RNA sample to the Drosophila rRNA capture probe buffer is <5:

1.

6. A method for constructing a miRNA library of Drosophila samples, characterized in that: The method comprises the following steps: adding the Drosophila rRNA capture probe according to claim 1 when constructing the Drosophila miRNA library to block the rRNA sequence.

7. The method for constructing a Drosophila sample miRNA library according to claim 6, characterized in that: The method comprises the following steps: preparing total RNA of a fruit fly sample to be sequenced; adding the fruit fly rRNA capture probe described in claim 1 for hybridization reaction; adding a linker reaction; reverse transcription synthesis of cRNA; PCR enrichment and purification followed by gel cutting and sorting to obtain a miRNA library to be sequenced.

8. The method for constructing a Drosophila sample miRNA library according to claim 7, characterized in that: The linker addition reaction sequentially comprises the steps of connecting a 3' linker, blocking excess 3' linkers, and connecting a 5' linker.

9. Use of the Drosophila rRNA capture probe according to claim 1 in preparing a reagent for removing rRNA sequences from a Drosophila sample miRNA library.

10. A reagent for removing rRNA sequences from a miRNA library of a Drosophila sample, characterized in that: The invention comprises the Drosophila rRNA capture probe according to claim 1.

Images