A molecular marker of qFAC.C9-1 significantly associated with the fatty acid composition of Brassica napus seeds and its application
Through whole-genome association analysis and PARMS marker method, the significant association site qFAC.C9-1 at base position 3,592,310 on rapeseed chromosome C09 was discovered, which solved the problem of improving the fatty acid composition of rapeseed seeds and achieved efficient and low-cost breeding improvement effects.
Patent Information
- Application Number
- CN202410549744.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-06
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-05-06
AI Technical Summary
Existing technologies make it difficult to effectively improve the fatty acid composition of rapeseed seeds, especially it is difficult to set corresponding breeding goals according to different needs and uses. Traditional methods make it difficult to achieve precise improvement of the fatty acid composition of rapeseed seeds.
Through whole-genome association analysis, a significant association site qFAC.C9-1 at base position 3,592,310 on rapeseed chromosome C09 was discovered, and a PCR-based PARMS marker method was developed to detect the fatty acid component content of rapeseed seeds and screen out high-throughput and low-cost molecular markers.
It has achieved efficient screening and improvement of the fatty acid composition of rapeseed seeds, improved selection efficiency and accuracy, and can significantly affect the content of multiple fatty acids in rapeseed seeds, meeting breeding needs for different purposes.
Smart Images

Figure SMS_1
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker of a site qFAC.C9-1 significantly associated with the fatty acid composition of Brassica napus seeds and its application. Background Art
[0002] Currently, the main goals of rapeseed breeding include resistance, yield, and quality. These traits are complex quantitative traits, regulated by numerous genes and susceptible to environmental conditions. Traditional breeding methods and techniques have made it difficult to achieve precise improvements and breakthroughs in these traits. Rapid advances in molecular marker technology and the widespread use of emerging biotechnologies such as gene editing have made molecular improvements in these traits possible.
[0003] Rapeseed quality traits primarily include seed oil and protein content, the content of various fatty acid components in the oil, the content of glucosinolates (glucosinolates) and their components in the rapeseed meal, and the cellulose and phytic acid contents. Rapeseed seed fatty acid composition primarily consists of seven types: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (20:1), and erucic acid (22:1). The fatty acid synthesis system first synthesizes saturated fatty acids with chain lengths of 18 and 16 carbon atoms. These saturated fatty acids then undergo a desaturation process to produce unsaturated fatty acids. Alternatively, under the control of the fatty acid elongase gene (FAE1), the very long-chain fatty acid synthesis system produces eicosenoic acid or erucic acid. Oleic acid, as a monounsaturated fatty acid, is highly valuable for both food and industrial applications. As an edible oil, increasing the oleic acid content of rapeseed oil can reduce the incidence of cardiovascular disease in obese individuals, lower low-density lipoprotein cholesterol levels in the blood, and prevent arteriosclerosis. High-oleic oil can inhibit lipid oxidation, extending the oil's shelf life and shelf life. Furthermore, high-oleic rapeseed oil produces less smoke when heated to higher temperatures, shortening cooking times and reducing waste. High-oleic rapeseed oil also maintains thermal stability and ensures a pleasant aroma after frying (Xiong Qiufang et al., 2014). In industry, the global energy crisis caused by oil shortages has led to a search for biorenewable energy sources to replace petroleum. High-oleic rapeseed oil, due to its efficient methylation, is gaining popularity in biodiesel production (Guan Mei, 2004). Under the action of desaturases, oleic acid is converted to linoleic acid (ω-6 family), which is then further converted to linolenic acid. As an essential fatty acid, linoleic acid can soften blood vessels, lower cholesterol levels, reduce the risk of arteriosclerosis, and facilitate digestion and absorption (Wu Moucheng, 2004). A deficiency of linoleic acid in the human body can cause cholesterol and certain saturated fatty acids to combine and deposit on blood vessel walls, leading to arteriosclerosis and cardiovascular and cerebrovascular diseases (Zhou Yinzhu, 2011). Linoleic acid exists in two forms: α-linolenic acid and γ-linolenic acid. α-linolenic acid is the predominant form found in rapeseed. A deficiency in α-linolenic acid can disrupt lipid metabolism, leading to symptoms such as decreased immunity, fatigue, and atherosclerosis (Li Jiaxing et al., 2009). For infants and adolescents, α-linolenic acid deficiency can seriously affect their intellectual development, making α-linolenic acid essential for maintaining human health (Liu Feng, 2007). Furthermore, α-linolenic acid is a precursor to EPA (eicosapentaenoic acid, commonly known as the blood vessel scavenger) and DHA (docosahexaenoic acid, commonly known as brain gold). As long as there is an adequate supply of α-linolenic acid in the diet, the body can use it to synthesize the necessary ω-3 fatty acids.Erucic acid is a long-chain fatty acid that is difficult to break down and absorb in the human body, resulting in low nutritional value. Excessive erucic acid content can also limit the increase in oleic and linoleic acid content (Liu Houli, 2000; Fu Tingdong, 2004). However, erucic acid holds great promise as a fatty acid for industrial applications. Erucic acid and its derivatives are widely used in industries such as steel casting, lubrication, plastics, paints, inks, cosmetics, and food. Palmitic acid and stearic acid are saturated fatty acids with high melting points. They easily coagulate on blood vessel walls, leading to hypertension and arteriosclerosis, and also increasing blood cholesterol levels (Liu Lili et al., 2005). The higher the saturated fatty acid content in rapeseed oil, the lower its nutritional value. In summary, various fatty acids have distinct functions, so rapeseed fatty acid improvement should be tailored to specific needs and applications. Currently, rapeseed oil in my country is still primarily consumed for food, so the focus of rapeseed fatty acid improvement remains on reducing erucic acid content and increasing oleic, linoleic, and linolenic acid content.
[0004] A number of quantitative trait loci (QTLs) controlling seed fatty acid content have been mapped in rapeseed using linkage and / or association mapping methods (Bao et al., 2021; Cai et al., 2016; Li et al., 2016; Liu Liezhao, 2014; Meng Jiangyu, 2019; Yang Shengqiang, 2010; Ye Sang, 2019; Zhang Jiefu, 2008; Burn et al., 2011; Chen et al., 2018; Li et al., 2014; Smooker et al., 2011; Wang et al., 2015; Yan et al., 2011; Zhao et al., 2008). Two major QTLs are located on chromosomes A8 and C3, corresponding to different copies of FAE1 (Li et al., 2014). However, these QTLs are insufficient to explain the variation in fatty acid content among rapeseed germplasm resources, indicating that new regulatory loci for fatty acid content remain to be discovered.
[0005] This paper uses rapeseed core association population and high-density SNP genotype data to conduct genome-wide association analysis of seed fatty acid components under eight environments, aiming to find new stable association sites and develop practical high-throughput and low-cost molecular markers based on them for molecular improvement of rapeseed seed fatty acid composition. Summary of the Invention
[0006] The purpose of the present invention is to provide an application of a reagent for detecting bases 3,592,310 on the C09 chromosome of Brassica napus in screening and breeding of the fatty acid component content of Brassica napus seeds.
[0007] Another object of the present invention is to provide a primer for detecting bases 3,592,310 on the C09 chromosome of Brassica napus in the screening and breeding of the fatty acid component content of Brassica napus seeds.
[0008] The last object of the present invention is to provide a method for screening and breeding Brassica napus seeds based on the fatty acid component content.
[0009] In order to achieve the above object, the present invention adopts the following technical measures:
[0010] Obtaining PARMS markers that are significantly associated with the fatty acid composition content of Brassica napus seeds:
[0011] (1) Total DNA was extracted from 331 accessions of the Brassica napus core association population constructed by our team (Li et al., 2020), and genotype analysis was performed on each sample using the rapeseed 60K SNP array (Clarke et al., 2016).
[0012] (2) Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the heterozygous rate, missing rate, and minor allele frequency of each locus in the population. Markers with no polymorphism, high missing rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain position, and multiple copies were removed. Finally, 24,508 high-quality SNP markers were obtained for subsequent analysis.
[0013] (3) A total of 331 samples of the core associated population of Brassica napus constructed by our team were planted in eight environments (codenamed N14, W12, W13, W14, W15, W16, Z13, and Z14) in Nanchang in 2014, Wuhan in 2012-2016, and Zhengzhou in 2013-2014. Ten plants were harvested from each plot at maturity, dried, and threshed. The fatty acid content was determined by near-infrared spectroscopy (Qiu et al., 2006): arachidonic acid (ARA), erucic acid (ERU), linoleic acid (LOL), linolenic acid (LON), oleic acid (OLE), palmitic acid (PAL), and stearic acid (STE).
[0014] (4) Association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007), combining the phenotypic and genotypic data of the fatty acid composition traits of the core association population with the population structure. Finally, a locus qFAC.C9-1 was identified on chromosome C09 of the Darmor V4 reference genome, which was significantly associated with multiple fatty acid components. Its peak SNP marker, Bn-scaff_17190_1-p9206, was located at base 3,592,310 (either A or G) and was reproducibly detected in eight environments.
[0015] (5) Sequences of 100 bp upstream and downstream of base 3,592,310 on the rapeseed C09 chromosome were extracted, and the PARMS detection primer sequences were obtained according to the primer design principles: qFAC.C9-1F: TGTAAAAGACATGTGATGATGGTTC; qFAC.C9-1Ra: gaaggtgaccaagttcatgctTTTGCATAGATCATAAGCCAAACTA; qFAC.C9-1Rg: gaaggtcggagtcaacggattTTGCATAGATCATAAGCCAAACTG.
[0016] The protection scope of the present invention includes:
[0017] Application of a reagent for detecting bases 3,592,310 on chromosome C09 of Brassica napus in screening and breeding of fatty acid components in Brassica napus seeds.
[0018] The reagents described above are preferably primers.
[0019] The primers mentioned above are preferably the PARMS detection primers provided by the present invention.
[0020] A method for screening and breeding Brassica napus seeds based on the fatty acid component content comprises detecting bases 3,592,310 on the Brassica napus C09 chromosome using conventional protocols in the art, wherein the conventional protocols include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.
[0021] The judgment method is:
[0022] If the AA genotype is detected, it indicates that the content of arachidonic acid and erucic acid in the seeds of this variety is relatively low, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively high.
[0023] If the GG genotype is detected, it indicates that the content of arachidonic acid and erucic acid in the seeds of this variety is relatively high, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively low.
[0024] The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genoscope.cns.fr / brassicanapus / .
[0025] Compared with the prior art, the present invention has the following advantages:
[0026] (1) The present invention obtained a locus qFAC.C9-1 that is significantly associated with the fatty acid composition of rapeseed, which can be repeatedly detected and can explain an average of 8.6% of the phenotypic variance, and can be effectively applied to the genetic improvement of rapeseed fatty acid composition.
[0027] (2) The present invention obtains PARMS markers that are significantly associated with rapeseed fatty acid components. The detection method is simple and low-cost, and high-throughput screening of genomic haplotype regions of rapeseed fatty acid components can be performed to improve selection efficiency and accuracy. DETAILED DESCRIPTION
[0028] The technical solutions described in this invention, unless otherwise specified, are conventional techniques in the art; all reagents and materials described, unless otherwise specified, are commercially available. The Brassica napus genome used in this invention is version 4.1 (Darmor-bzh) available at https: / / www.genoscope.cns.fr / brassicanapus / . The majority of the materials tested in the examples herein were pure lines, and therefore no heterozygous genotype data were available.
[0029] Example 1: Obtaining SNP markers significantly associated with the fatty acid content of rapeseed seeds
[0030] (1) A total of 1063 rapeseed inbred lines from various countries around the world were collected (Li et al., 2015). 331 accessions were selected from these accessions based on their genotypic and phenotypic data to construct a core association population (Li et al., 2020). Individual leaves from each line in the association population were collected, and total DNA was extracted using the CTAB method. Genotypic analysis of each sample was performed using the rapeseed 60K SNP array (Clarke et al., 2016).
[0031] (2) Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the marker heterozygosity rate, missing rate, and minor allele frequency at each locus. SPAGeDi software was used to calculate the kinship among 331 Brassica napus germplasm resources (Hardy and Vekemans, 2002). SNP markers were filtered using the criteria of missing rate ≤ 0.2, heterozygosity ≤ 0.2, minor allele frequency > 0.05, and unique match in the Brassica napus genome. A total of 24,508 high-quality SNP markers were obtained for genome-wide association analysis.
[0032] (3) 331 strains from the core population were planted in eight plots (codenamed N14, W12, W13, W14, W15, W16, Z13, and Z14) in Nanchang in 2014, Wuhan in 2012-2016, and Zhengzhou in 2013-2014. At maturity, 10 representative plants were harvested from each plot, dried, and threshed. The fatty acid content was determined using a near-infrared spectrometer (Qiu et al., 2006): arachidonic acid (ARA), erucic acid (ERU), linoleic acid (LOL), linolenic acid (LON), oleic acid (OLE), palmitic acid (PAL), and stearic acid (STE).
[0033] (4) Combining the genotypic data of the association population and the phenotypic data of fatty acid components, genome-wide association analysis was performed using TASSEL 5.0 software. By integrating the significantly associated SNP markers detected in different environments and models, a site qFAC.C9-1 with significant and reproducible association with fatty acid components was obtained on chromosome C09. It could be repeatedly detected in four environments. Its peak SNP marker Bn-scaff_17190_1-p9206 was located at base 3,592,310 (T / A or C / G) of the DarmorV4.1 reference genome, with an average contribution rate of 8.6%. This site was significantly associated with arachidonic acid content in three environments, with an average additive effect of -1.42(%) and a contribution rate of 8.2%; this site was significantly associated with erucic acid content in five environments, with an average additive effect of -4.97(%) and a contribution rate of 9.1%; this marker was significantly associated with oleic acid content in five environments, with an average additive effect of 5.76(%) and a contribution rate of 8.7%; this marker was significantly associated with palmitic acid in two environments, with an average additive effect of 0.21(%) and a contribution rate of 7.6%.
[0034] Table 1. Information on QTL-qFAC.C9-1 associated with fatty acid content in rapeseed seeds
[0035]
[0036] Example 2:
[0037] Development and use of a PARMS marker significantly associated with the content of rapeseed fatty acid components:
[0038] The associated markers obtained in Example 1 are derived from the SNP chip and only have probe sequence information for molecular hybridization. The rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is relatively cumbersome and requires special equipment. In addition, it is expensive to use the rapeseed SNP chip to detect a large amount of breeding intermediate materials, so it is necessary to convert it into a simple and low-cost PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System) labeling. This labeling system includes a pair of fluorescent universal primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers and a reverse shared primer, which can quickly and easily perform SNP allele type detection.
[0039] (1) For the peak SNP marker Bn-scaff_17190_1-p9206 associated with qFAC.C9-1, the sequences of 100 bp upstream and downstream of bases 3,592,310 on chromosome C09 of the rapeseed Darmor V4.1 reference genome were extracted. The PARMS marker detection primer sequences were obtained according to the primer design principles:
[0040] qFAC.C9-1Ft:gaaggtgaccaagttcatgctTCCAGTCCACTTTGACAAAGCT;
[0041] qFAC.C9-1Fc:gaaggtcggagtcaacggattCCAGTCCACTTTGACAAAGCC;
[0042] qFAC.C9-1R: TATGCTTGTTCCAACGGGTCT;
[0043] (2) Using the genomic DNA of the rapeseed-associated population as a template, the above primers were used for fluorescence quantitative PCR amplification. Tecan F200 was used to scan the FAM, HEX and ROX signals and output the results, which were finally converted into genotypes.
[0044] Using the above primers, the sequence amplified from the rapeseed variety Double 11 is: TCCAGTCCACTTTGACAAAG CT GACTGTATCTCACCTCCATCCCCTGTTAAAGTTG AGACCCGTTGGAACAAGCATA .
[0045] Using the above primers, the sequence amplified in the rapeseed variety Tapidor is: CCAGTCCACTTTGACAAAGCC GACTGTATCTCACCTCCATCCCCTGTTAAAGTTG AGACCCGTTGGAACAAGCATA .
[0046] The judgment method is:
[0047] If the AA genotype is detected, it indicates that the content of arachidonic acid and erucic acid in the seeds of this variety is relatively low, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively high.
[0048] If the GG genotype is detected, it indicates that the content of arachidonic acid and erucic acid in the seeds of this variety is relatively high, while the content of linoleic acid, oleic acid, palmitic acid and stearic acid is relatively low.
[0049] Example 3: Application of PARMS markers in the selection of fatty acid components in rapeseed
[0050] 96 samples were randomly selected from 732 materials of non-core associated groups (i.e., 1063 rapeseed inbred lines excluding 331 core associated groups in Example 1) (for convenience of PCR amplification). Using the PARMS marker qFAC.C9-1 provided in Example 2, 83 samples were detected to have an AA genotype and 13 samples to have a GG genotype. The two genotypes showed significant differences in the contents of six fatty acid components (except linolenic acid) (Tables 2-7). There were extremely significant differences in the arachidic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of -5.37 (%); there were extremely significant differences in the erucic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of -19.17 (%); there were significant differences in the linoleic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of 3.23 (%); there were extremely significant differences in the oleic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of 22.67 (%); there were extremely significant differences in the palmitic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of 0.69 (%); there were extremely significant differences in the stearic acid content in seeds of the AA and GG genotype materials in all eight environments, with an average difference of 0.20 (%).
[0051] The following fatty acid components were detected by near-infrared analysis (Qiu et al., 2006).
[0052] Table 2. Comparison of arachidonic acid content (%) between two genotypes of PARMS-labeled qFAC.C9-1 in 96 Brassica napus seeds
[0053] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 2.85 3.03 2.06 3.07 3.24 3.06 3.72 3.12 3.02 GG(13) 8.38 7.81 7.96 9.41 8.69 9.06 7.92 7.86 8.39 AA-GG -5.53 -4.79 -5.90 -6.34 -5.45 -6.01 -4.20 -4.74 -5.37 Pt-test 2.8E-09 1.1E-04 2.8E-09 2.0E-09 1.4E-08 7.5E-10 1.7E-04 3.4E-08
[0054] Table 3. Comparison of erucic acid content (%) between two genotypes of PARMS marker qFAC.C9-1 in 96 Brassica napus seeds
[0055] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 2.91 1.60 0.66 0.91 3.28 3.50 3.59 3.02 2.43 GG(13) 22.47 20.95 22.29 23.94 23.49 24.88 19.04 15.73 21.60 AA-GG -19.55 -19.35 -21.63 -23.03 -20.21 -21.39 -15.45 -12.71 -19.17 Pt-test 8.1E-10 2.0E-05 9.0E-10 4.1E-10 2.1E-09 4.5E-10 5.7E-05 1.4E-07
[0056] Table 4 Comparison of linoleic acid content (%) between two genotypes of PARMS-labeled qFAC.C9-1 in 96 Brassica napus seeds
[0057] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 18.20 20.17 19.31 20.15 17.35 19.25 20.06 16.75 18.90 GG(13) 15.14 16.24 15.69 16.33 14.16 16.03 17.34 14.46 15.67 AA-GG 3.05 3.93 3.61 3.83 3.18 3.22 2.71 2.29 3.23 Pt-test 1.1E-06 9.2E-06 2.5E-08 1.8E-07 2.2E-06 1.6E-06 9.2E-04 1.0E-05
[0058] Table 5. Comparison of oleic acid content (%) between two genotypes of PARMS-labeled qFAC.C9-1 in 96 Brassica napus seeds
[0059] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 58.45 60.74 60.31 58.13 58.53 59.83 56.79 61.01 59.22 GG(13) 35.45 38.85 35.46 31.94 35.17 34.82 39.51 41.23 36.55 AA-GG 22.99 21.88 24.86 26.19 23.36 25.01 17.28 19.78 22.67 Pt-test 7.0E-10 6.9E-05 1.4E-09 5.2E-10 2.2E-09 2.0E-10 1.1E-04 6.7E-08
[0060] Table 6. Comparison of palmitic acid content (%) between two genotypes of PARMS marker qFAC.C9-1 in 96 Brassica napus seeds
[0061] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 3.91 4.28 3.98 4.29 3.94 4.42 4.18 3.57 4.07 GG(13) 3.24 3.46 3.16 3.51 3.28 3.69 3.63 3.07 3.38 AA-GG 0.67 0.81 0.82 0.78 0.67 0.73 0.55 0.51 0.69 Pt-test 1.3E-08 7.7E-07 2.8E-10 1.7E-09 3.8E-08 2.5E-09 1.1E-04 8.7E-08
[0062] Table 7. Comparison of stearic acid content (%) of two genotypes of PARMS-labeled qFAC.C9-1 in 96 Brassica napus seeds
[0063] genotype N14 W12 W13 W14 W15 W16 Z13 Z14 mean AA(83) 1.67 1.32 1.69 1.08 1.21 0.98 1.20 1.55 1.34 GG(13) 1.42 1.13 1.52 0.83 1.04 0.80 1.00 1.39 1.14 AA-GG 0.24 0.19 0.17 0.25 0.18 0.18 0.20 0.16 0.20 Pt-test 8.5E-07 1.1E-04 2.5E-06 5.7E-11 4.3E-05 4.2E-07 1.5E-04 2.6E-04
[0064] The above results are sufficient to show that the PARMS molecular marker qFAC.C9-1 we prepared is highly correlated with the main fatty acid components of rapeseed and has a good selection effect.
Claims
1. Use of a reagent for detecting base 3,592,310 on chromosome C09 of Brassica napus in screening and breeding of Brassica napus seeds for fatty acid composition content. The version number of the Brassica napus genome is Darmor-bzh Version 4.
1.
2. The use according to claim 1, wherein the reagent is a primer.
3. The use according to claim 2, wherein the primers are: qFAC.C9-1R: TATGCTTGTTCCAACGGGTCT; qFAC.C9-1Ft: gaaggtgaccaagttcatgctTCCAGTCCACTTTGACAAAGCT; qFAC.C9-1Fc: gaaggtcggagtcaacggattCCAGTCCACTTTGACAAAGCC.
4. A method for screening and breeding Brassica napus seeds based on fatty acid content, the method comprising detecting bases 3,592,310 on chromosome C09 of Brassica napus, the method comprising: Sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, mass spectrometry; The judgment method is: If the AA genotype is detected, it indicates that the seeds of this variety have low contents of arachidic acid and erucic acid, and high contents of linoleic acid, oleic acid, palmitic acid and stearic acid; If the GG genotype is detected, it indicates that the seeds of this variety have high contents of arachidic acid and erucic acid, and low contents of linoleic acid, oleic acid, palmitic acid and stearic acid; The version number of the Brassica napus genome is Darmor-bzh Version 4.1.
Citation Information
Patent Citations
High throughput genome specific molecular markers for erucic acid content genes in brassica napus (l.)
CA2612505A1
Haplotype BnHapFatty related with oilseed rape fatty acid character and application
CN105950734A