InDel molecular marker related to cotton anthocyanin accumulation and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker related to cotton anthocyanin accumulation and application of the InDel molecular marker, and belongs to the technical field of genetic breeding of cotton. The molecular marker is located in a chromosome D07 of a cotton genome, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.2; the nucleotide sequences of the primer pair for amplifying the InDel molecular marker are as shown in SEQ ID NO.1F and SEQ ID NO.1R. The invention also discloses a kit for amplifying the InDel molecular marker. By detecting the molecular marker in the DNA of the cotton seed or seedling plant, the anthocyanin content accumulation difference between cotton varieties can be accurately, quickly and efficiently identified in the early stage. Through molecular marker-assisted selection developed by the invention, cotton materials accumulated with different anthocyanin contents can be quickly, conveniently, directionally and effortlessly screened in the early stage, and the molecular marker can be effectively used for molecular marker-assisted breeding of cotton.

Description

Technical Field

[0001] The invention relates to the technical field of cotton genetic breeding, and in particular to an InDel molecular marker, a primer and an application thereof for identifying cotton anthocyanin accumulation. Background Art

[0002] Anthocyanins are flavonoid pigments in the phenylalanine synthesis pathway and are important secondary metabolites in plants. In plants, anthocyanins accumulate in vacuoles to make flowers, fruits and nutritional organs appear orange, red, blue and other colors. The brilliant colors play an important role in attracting pollinators and fruit dispersal. As an important agronomic trait, they are used in modern genetic research and landscape design, providing crop breeders with obvious selection markers. Anthocyanins are also stress protectants under biological and abiotic stress conditions, such as strong light, cold and pathogen infection, which can alleviate oxidative damage to plant cells. Anthocyanins can also be used as metabolic markers for nutrient deficiencies, such as nitrogen deficiency, sulfur deficiency and high carbon stress.

[0003] Colorful cotton fibers are ideal agronomic traits for cotton breeding, but the molecular basis for controlling the biosynthesis and accumulation of pigments in fibers is still unclear. Existing studies have shown that the pigments of most colored petals and fibers of cotton come from anthocyanins. Cotton plants rich in anthocyanins not only have extremely high ornamental value, but also red leaves and red spots at the base of flowers can be used as important genetic trait markers in hybrid breeding. In addition, the accumulation of anthocyanins in cotton plants is of great significance for stress and disease and pest defense. However, there is currently a lack of special cotton materials related to anthocyanins, which restricts their application in breeding. It is of great practical significance to explore molecular markers related to the synthesis, transport and accumulation of anthocyanins in plants and quickly screen for special germplasm with anthocyanin accumulation, which is of great practical significance for cotton breeding and safe production.

[0004] InDel molecular markers are molecular markers that reflect sequence length polymorphism by designing specific primers based on the sequences on both sides of the insertion / deletion site through PCR amplification. InDel marker development is based on sequence differences. During the development process, the variation is stable and the accuracy is high, which avoids the problems of subsequent analysis ambiguity caused by specificity and complexity. As a high-throughput molecular marker, InDel markers have a high distribution frequency in plant genomes and have the advantages of high genetic stability, wide distribution, strong polymorphism, and strong versatility. They have been widely used in major crops such as rice, corn, and cotton. Summary of the invention

[0005] The purpose of the present invention is to provide an InDel molecular marker related to cotton anthocyanin accumulation and a primer for amplifying the molecular marker, as well as the application of the molecular marker.

[0006] The invention provides an InDel molecular marker for identifying anthocyanin accumulation-related cotton, characterized in that the molecular marker is located at bases 8900751-8900767 of chromosome D07 of the cotton genome; the sequence of progeny and parents with light red stem phenotype here is GTGTCTCAACGGAAGC, while the sequence is missing in the green stem phenotype.

[0007] Specifically, the nucleotide sequence of the Indel molecular marker in the light red stem material of upland cotton with normal anthocyanin accumulation is shown in SEQ ID NO.1.

[0008] The present invention also provides application of the molecular marker InDel in cotton molecular marker assisted breeding.

[0009] Specifically, it is used for the identification of cotton anthocyanin accumulation related samples of hybrid offspring of upland cotton red stem material SD3 and upland cotton green stem mutant material rsl as the maternal parent;

[0010] Specifically, when the nucleotide sequence of SEQ ID NO.1 where InDel is located is amplified with primers, and the amplified product is displayed as a single main band in the polyacrylamide gel electrophoresis gel image, and the target band is 361 bp long, it is determined to be a homozygous individual with normal anthocyanin accumulation; when the target band is a single main band and the target band is 345 bp long, it is a homozygous individual with a deficiency in anthocyanin accumulation; when there are two target bands and the lengths of the target bands are 361 bp and 345 bp respectively, it can be determined to be a heterozygous individual with a deficiency in anthocyanin accumulation in cotton.

[0011] The invention provides a primer pair for detecting the InDel molecular marker or identifying cotton varieties with cotton anthocyanin accumulation.

[0012] Specifically, it consists of an upstream primer of SEQ ID NO. 1F and a downstream primer of SEQ ID NO. 1R.

[0013] The present invention provides a method for identifying cotton anthocyanin accumulation-related varieties, which comprises the following steps:

[0014] 1) Extracting genomic DNA from cotton seedlings to be tested;

[0015] 2) using the DNA extracted in step 1) as a template, and performing PCR amplification using the primers shown in SEQ ID NO. 1F-R;

[0016] 3) When the amplified band is 361 bp, it is a homozygous individual with normal anthocyanin accumulation; when the amplified band is 345 bp, it is a homozygous individual with a deficiency in anthocyanin accumulation; when there are two amplified bands with lengths of 361 bp and 345 bp respectively, it is a heterozygous individual with a deficiency in anthocyanin accumulation in cotton; specifically, the PCR product amplified in step 2) is detected by polyacrylamide gel electrophoresis.

[0017] The present invention also provides the use of the InDel molecular marker, the primer pair, or the identification method in any of the following:

[0018] 1) Used for identification of cotton varieties related to anthocyanin accumulation;

[0019] 2) Used in cotton molecular marker-assisted breeding.

[0020] Specifically, the identification or breeding refers to cultivating cotton varieties with light red stem phenotype or green stem phenotype, specifically, the light red stem phenotype variety has the GTGTCTAACGGAAGC sequence, while the green stem phenotype variety lacks this sequence.

[0021] The present invention has at least the following advantages and beneficial effects:

[0022] The present invention provides InDel molecular markers that can be used to identify cotton anthocyanin accumulation. By using marker primers to detect whether cotton seeds or seedlings have the above-mentioned molecular markers, it is possible to accurately, quickly and efficiently identify whether the anthocyanin transport-related genes of the cotton variety are normal at an early stage. The molecular markers of the present invention are closely related to cotton anthocyanin accumulation and can be effectively used in molecular marker-assisted breeding of cotton. Compared with identification methods of other marker types such as SNP, the method for identifying InDel molecular markers related to cotton anthocyanin accumulation provided by the present invention can be detected by ordinary PCR and polyacrylamide gel electrophoresis, without the need for sequencing, and is simple, fast and low-cost to operate.

[0023] In a specific experiment, the molecular marker of the present invention was used to hybridize the green-stem mutant material rs1 of upland cotton as the female parent and the red-stem material SD3 of upland cotton as the male parent to obtain the hybrid F1 generation, and the F1 generation was self-pollinated to obtain 906 F1 plants. 2 The validation was performed in a self-pollination population and a F2:3 family population of 1136 plants obtained through continuous self-pollination, and the accuracy rate was 100%. Therefore, the results of using this molecular marker for identification of cotton anthocyanin accumulation are reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The distribution of delta InDel-index of two offspring on chromosomes, horizontal axis: chromosome length (Mb); vertical axis: △ (InDel index);

[0025] Figure 2 The distribution of delta_All-index of two offspring on chromosomes, horizontal axis: chromosome length (Mb); vertical axis: △ (All index);

[0026] Figure 3 This is a CDS sequence alignment of the GhAT1 gene in materials with normal anthocyanin transport-related genes in stem red phenotype and materials with missing anthocyanin transport-related genes in stem blue phenotype;

[0027] Figure 4 InDel-labeled polyacrylamide gel electrophoresis, A, parent polyacrylamide gel electrophoresis; M: DS2000, 1-2: red stem parent, 3-4: green stem parent; B, F2 population progeny polyacrylamide gel electrophoresis; M: DS2000, 5-6, 8: progeny with red stem phenotype, 9-10, 11-12, 15: progeny with green stem phenotype; 1-4, 7, 11, 14, 16-17, 19-21: heterozygous progeny with light red stem phenotype;

[0028] Figure 5 This is a distribution box plot of the total anthocyanin content of some individual stems corresponding to the genotype of the Indel site of the F2 population in Example 3 of the present invention. 1 / 1 is a homozygous individual genotype with normal anthocyanin accumulation, 1 / 0 is a heterozygous individual genotype with anthocyanin accumulation deficiency, and 0 / 0 is an individual genotype with anthocyanin accumulation deficiency.

[0029] Figure 6 The results of localization of Indel markers related to anthocyanin accumulation in cotton population. DETAILED DESCRIPTION

[0030] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0031] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0032] The present invention describes only preferred methods and materials, but any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0034] Example 1

[0035] 1. The hybridization was carried out with the green-stem mutant material rs1 of upland cotton as the female parent and the red-stem material SD3 of upland cotton as the male parent to obtain the hybrid F1 generation, and the F1 generation was self-pollinated to obtain the F2 generation. 25 red-stem offspring SD3-25, 30 green-stem offspring rs1-30, 1 red-stem parent SD3 and 1 green-stem parent rs1 were selected, and 1-1.5g of young leaves were collected from each material and placed in correspondingly marked 2ml centrifuge tubes. The collected 2ml centrifuge tubes containing leaf samples were stored in dry ice and sent to Beijing Novogene Company to construct parent and offspring type mixed pools, and then the sterility trait gene was located by extreme trait mixed pool resequencing (BSA).

[0036] 2. DNA was extracted from young leaves using the CTAB method (Song Guoli, Cui Rongxia, Wang Kunbo, Guo Liping, Li Shaohui, Wang Chunying, Zhang Xiangdi. Improved CTAB method for rapid extraction of cotton DNA. Cotton Science 05 (1998): 50-52.). The extracted DNA was qualified and randomly fragmented into 35 bp fragments using a Covaris crusher according to standard procedures. The library was constructed using the TruSeq Library Construction Kit and sequenced using Illumina HiSeqTM PE150. The obtained Rawdata was quality controlled to obtain Clean data, which was then aligned to the upland cotton reference genome TM-1 (Zhang TZ, Hu Y, Jiang WK, et al. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nat Biotechnol, 2015, 33 (5): 531-537.) using BWA software. The alignment rates of all aligned samples were between 98.54% and 99.55%, the average depth was between 10.53X and 28.02X, and the 1X and 4X coverages were greater than 96.04% and 89.74%, respectively (Table 1), which allowed for subsequent InDels detection and related analysis.

[0037] Table 1. Sequencing depth and coverage statistics

[0038]

[0039]

[0040] 3. Based on the genotyping results, the homozygous markers in the parents were screened, and a total of 305,835 InDels polymorphic markers were selected from the offspring. TM-1 was selected as the reference parent, and the InDel-index ( Figure 1 ). According to the InDel-index threshold, when the confidence level after fitting is P<0.05, the target trait region is located on chromosome D07 ( Figure 2 ), the size of the InDels candidate interval is 2.75MB Mb.

[0041] 4. Based on the InDels in the candidate interval located by BSA, we designed 34 pairs of polymorphic primers and used DNA extracted from the tender leaves of any one of the two parents as an amplification template. The amplified products were screened by polyacrylamide gel electrophoresis (Wang Lulu, Liu Xinting, Zhou Tao, et al. Optimization of silver-stained polyacrylamide gel electrophoresis technology system [J]. Xinjiang Agricultural Science, 2019, 56(12): 2312-2319.). When the target band is a single band and consistent with the SD3 band, it is a homozygous individual with normal anthocyanin accumulation; when the target band is a single band and consistent with the rsl band, it is a homozygous individual with anthocyanin accumulation deficiency; when the target band is two, it is a heterozygous individual with anthocyanin accumulation deficiency in cotton. Finally, we successfully obtained 8 pairs of polymorphic primers related to anthocyanin accumulation in cotton. Subsequently, these 8 pairs of primers were used to amplify 906 F 2 The amplification was carried out in the self-pollination population and the F2:3 family population obtained by continuous self-pollination of 1136 plants, and the amplification products were analyzed based on the number of exchanged plants counted by polyacrylamide gel electrophoresis and the results of the field cotton fertility survey. Finally, the candidate gene was locked between 8.0kb of chromosome D07 and a genetic linkage map was constructed ( Figure 6 ), which has two ORFs. The sequencing results showed that only the GhAT1 coding region had a 16bp deletion, which once again confirmed that GhAT1 was a cotton anthocyanin transport-related gene, and finally the candidate gene was determined to be the GhAT1 gene.

[0042] 5. The InDel molecular marker is located at positions 58-74 of the nucleotide sequence shown in SEQ ID No.1. The sequence of the offspring with light red stem phenotype and the parent SD3 here is GTGTCTCAACGGAAGC (SEQ ID No.2), while the offspring with blue stem phenotype lacks the [GTGTCTCAACGGAAGC] sequence (Table 2). The upstream primer CTTAGCCATCTACCCGCTCTT and the downstream primer TTGAGTGACCAAAAAACAAATAC can be used to amplify the nucleotide sequence of SEQ ID No.1, and then the amplified product is verified by polyacrylamide gel electrophoresis. When the target band is 361bp, it is a homozygous individual with normal anthocyanin accumulation; when the target band is 345bp, it is a homozygous individual with missing anthocyanin accumulation; when the target band is two, with lengths of 361bp and 345bp respectively, it is a heterozygous individual with missing anthocyanin accumulation in cotton.

[0043]

[0044]

[0045] SEQ ID No. 2: GTGTCTCAACGGAAGC.

[0046] Table 2. Base types of InDel marker sites in progenies with light red stem phenotype and progeny with green stem

[0047] InDel sites Offspring with light red stem phenotype / red stem father Stem green InDel SEQ ID No.2:GTGTCTCAACGGAAGC Missing

[0048] Example 2

[0049] The hybridization was carried out with the green-stem mutant material rs1 of upland cotton as the female parent and the red-stem material SD3 of upland cotton as the male parent to obtain the hybrid F1 generation. The F1 generation was self-pollinated to obtain 906 F2 self-pollination populations and 1136 F2:3 family populations were obtained by continuous self-pollination for DNA extraction. The primers corresponding to the InDel marker were used for amplification, and the target bands were counted by polyacrylamide gel electrophoresis based on the amplified products. The results showed that among the 2042 individual plants, the number of individual plants with a target band of 361bp amplified by the InDel marker primer was 507, the number of individual plants with a target band of 345bp was 1048, and the number of individual plants with target bands of 361bp and 345bp was 488. This showed that among the 2042 individual plants, 507 plants showed a red stem phenotype, 1048 plants showed a light red stem phenotype, and 488 plants showed a green stem phenotype, which was consistent with the results of the field cotton fertility survey (Table 3). These results prove that InDel markers have a significant role in identifying cotton fertility.

[0050] Table 3. Identification of InDel markers in F2 self-pollinated populations and F2:3 family populations

[0051] InDel marker sites Number of individual plants with red stems Number of individual plants with light red stems Number of individual plants with green stems Marking Identification 507 1048 488 Field statistics 507 1048 488

[0052] Example 3

[0053] Weigh 0.10 g of fresh stem tissue samples corresponding to the genotype of the Indel site of the F2 population and put them into a 2 ml centrifuge tube. Add two steel balls and quickly place them in liquid nitrogen. Use a high-speed oscillator (CryoMill, USA) to break the sample at a speed of 30 r / s for 40 s. Quickly add 1 ml of methanol extract (containing 0.5% HCL), shake vigorously for 30 s, and use an iron suction to suck out the steel balls in the centrifuge tube. Place it at 4 ° C in the dark for 48 h, mix it every 12 h, centrifuge it at 5000 g at 25 ° C for 10 minutes, absorb the supernatant and dilute it with the extract at 1:10, 1:50, 1:100, 1:500, and 1:000, respectively. Use an ultraviolet spectrophotometer to measure the absorbance value. Use the extract as a control to measure the absorbance values ​​at 530 nm, 620 nm, and 650 nm, respectively, and calculate the total anthocyanin content. The formula is as follows:

[0054] Anthocyanin optical density value: ODλ = (OD530-OD620)-0.1x (OD650-OD620)

[0055] Anthocyanin content (μmol / g) = 106·ODλxV / (ε·M).

[0056] ODλ: optical density of anthocyanin at 530 nm; ε: molar extinction coefficient of anthocyanin 4.62×106; V: total volume of anthocyanin extract (ml); M: mass of cotton leaf 0.10 g, 106: multiple of the calculated result converted to μmol.

[0057] In summary, in the cotton breeding work and practical production based on the green-stem mutant material rsl of upland cotton, by detecting whether the cotton seeds or seedlings have InDel molecular markers, it is possible to accurately, quickly and efficiently identify whether the anthocyanin transport-related genes of the cotton variety are normal in the early stage. The molecular markers of the present invention are closely related to the accumulation of anthocyanins in cotton, can be effectively used in molecular marker-assisted breeding of cotton, and are of great significance to accelerating the selection and breeding of new high-quality cotton varieties and improving the economic benefits of cotton.

[0058] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Used to identify InDel molecular markers related to anthocyanin accumulation in cotton, characterized in that: The molecular marker is located at bases 8900751-8900767 of chromosome D07 of the cotton genome; the sequence of the progeny and parent with light red stem phenotype is GTGTCTCAACGGAAGC, while the sequence is missing in the green stem phenotype.

2. The InDel molecular marker according to claim 1, characterized in that The nucleotide sequence of the Indel molecular marker in the light red stem material of upland cotton with normal anthocyanin accumulation is shown in SEQ ID NO.

1.

3. Use of the molecular marker InDel according to claim 1 or 2 in cotton molecular marker-assisted breeding.

4. The use according to claim 2, characterized in that: Used for the red stem material SD3 of upland cotton and as the female parent upland cotton green stem mutant material rsl Identification of cotton anthocyanin accumulation in hybrid progeny samples; Specifically, when the primers are used to amplify the nucleotide sequence of SEQ ID NO.1 where InDel is located, the amplified product is displayed by polyacrylamide gel electrophoresis. When the target band is a single main band and the target band is 361 bp long, it is determined to be a homozygous individual with normal anthocyanin accumulation; When the target band is a single main band and the length of the target band is 345 bp, it is a homozygous individual with anthocyanin accumulation deficiency; When there are two target bands, and the lengths of the target bands are 361 bp and 345 bp respectively, it can be determined that there is a heterozygous individual with deletion in anthocyanin accumulation in cotton.

5. A primer pair for detecting the InDel molecular marker according to claim 1 or identifying a cotton variety that accumulates anthocyanins in cotton.

6. The primer pair according to claim 5, characterized in that It consists of an upstream primer of SEQ ID NO. 1F and a downstream primer of SEQ ID NO. 1R.

7. A method for identifying cotton varieties related to anthocyanin accumulation, characterized in that: The following steps are involved: 1) Extract genomic DNA from cotton seedlings to be tested; 2) Using the DNA extracted in step 1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO.1 FR; 3) When the amplified band is 361 bp, it is a homozygous individual with normal anthocyanin accumulation; When the amplified band is 345 bp, it is a homozygous individual with anthocyanin accumulation deletion; When there are two amplified bands with lengths of 361 bp and 345 bp respectively, it is a heterozygous individual with deletion in anthocyanin accumulation in cotton; specifically, the PCR product amplified in step 2) is detected by polyacrylamide gel electrophoresis.

8. Use of the InDel molecular marker according to claim 1 or 2, the primer pair according to claim 5 or 6, or the identification method according to claim 7 in any of the following: 1) Used for identification of cotton varieties related to anthocyanin accumulation; 2) Used in cotton molecular marker-assisted breeding.

9. The use according to claim 7, characterized in that The identification or breeding refers to cultivating cotton varieties with light red stem phenotype or green stem phenotype. Specifically, the light red stem phenotype variety has the GTGTCTAACGGAAGC sequence, while the green stem phenotype variety lacks this sequence.

Images