Probe for detecting trace trivalent arsenic ions and ECL detector based on probe

Abstract

The invention discloses a probe for detecting trace trivalent arsenic ions and an ECL detector based on the probe, the probe comprises a polymer quantum dot and trivalent arsenic ion aptamers modified on the surface of the polymer quantum dot, the emission wavelength range of the polymer quantum dot is 500-570nm, the trivalent arsenic ion aptamers are a DNA chain A and a DNA chain B, the DNA chain A is a DNA chain A, and the DNA chain B is a DNA chain B; one end of the DNA chain A is modified with a functional group containing an amino group. On the basis, the ECL detector for detecting trace trivalent arsenic ions is provided, and the resonance energy transfer mechanism between the polymer quantum dots and rhodamine B is utilized, so that the ECL detector has the advantages of ultralow detection limit, high selectivity and field visual detection; the method has important significance in detection of ultratrace toxic substances in the fields of environmental monitoring and food safety.

Description

Technical Field

[0001] The present invention relates to the technical field of arsenic ion detection, and in particular to a probe for detecting trace trivalent arsenic ions and an ECL detector based thereon. Background Art

[0002] Arsenic is a toxic heavy metal that poses a significant risk to environmental safety and has become a major public health issue. With the acceleration of industrialization and changes in agricultural practices, the content of arsenic in drinking water, groundwater and even food has shown an upward trend, triggering a global arsenic exposure crisis. Today, millions of people around the world face increased arsenic exposure through groundwater and food consumption, making it a common international problem in many countries. Accurate and efficient arsenic detection technology has become the first line of defense against arsenic contamination. Monitoring and detection of arsenic contamination is essential to prevent its adverse effects on soil, water and air quality and ensure the protection of biodiversity and ecosystem balance. From a sustainability perspective, early detection of arsenic allows timely intervention and remedial measures to prevent long-term damage to the environment, which is crucial for both human health and the life of the ecosystem. In aquatic environments, arsenic exists mainly in the form of arsenite or arsenate. It has been reported that trivalent arsenite is 60 times more toxic than pentavalent arsenate, which emphasizes the importance of using sensitive analytical monitoring technologies designed for the detection of trivalent arsenic (As(III)).

[0003] In recent years, various arsenic detection methods have been reported, including colorimetric sensors, electrochemical techniques, fluorescent probes, etc. Currently applicable commercial As(III) detection methods include atomic fluorescence spectroscopy (AFS) and inductively coupled plasma mass spectrometry (ICP-MS) as specified in the National Standard of the People's Republic of China (GB 5009.11-2014). These established methods provide reliable detection means, but the detection limit (LOD) value is in the ng / g range.

[0004] At present, the normal As(III) content in natural environmental samples such as fish is usually below the ng / g level. The above-mentioned traditional laboratory technical equipment is expensive and complicated to operate. AFS has limited capabilities in the simultaneous detection of multiple elements, and has high pre-treatment requirements for some samples, making it inconvenient to carry and difficult to achieve rapid on-site detection. HPLC-MS coupling technology can achieve the morphological analysis of trace arsenic, but for the direct analysis of high-boiling point and non-volatile compounds, the separation ability and analysis efficiency still need to be further improved. New detection technologies such as fluorescence cannot detect extremely low concentrations of arsenic. Therefore, the detection limits of the above methods are not sufficient to meet the strict requirements for accurate detection of trace arsenic contamination in aquatic products such as fish. Summary of the invention

[0005] In order to solve the defects and shortcomings of As(III) detection in the prior art, such as low biocompatibility, great environmental impact, and high detection limit, the purpose of the present invention is to provide a probe for detecting trace trivalent arsenic ions and an electrochemiluminescence (ECL) detector based thereon, which realizes high sensitivity, high selectivity and portable detection of trace As(III) in the environment.

[0006] The above object of the present invention is achieved through the following technical solutions:

[0007] The first aspect of the present invention provides a probe (Pdots@dsDNA) for detecting trace trivalent arsenic ions, comprising polymer quantum dots (Pdots) and trivalent arsenic ion aptamers modified on the surface of the polymer quantum dots, wherein the emission wavelength range of the polymer quantum dots is 500 to 570 nm, the trivalent arsenic ion aptamers are DNA chains A and DNA chains B, one end of the DNA chain A is modified with a functional group containing an amino group, the sequence of the DNA chain A is shown in SEQ ID NO.1, and the sequence of the DNA chain B is shown in SEQ ID NO.2.

[0008] Furthermore, the polymer quantum dots are selected from one or more of poly(9,9-dioctylfluorene-co-benzothiadiazole) (PFBT) quantum dots, cyanopolystyrene (CN-PPV) quantum dots, poly(9,9-di-n-octylfluorenyl-2,7-diyl) (PFO) quantum dots, and poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole)] (PFTBT) quantum dots.

[0009] The second aspect of the present invention provides a method for preparing the probe for detecting trace trivalent arsenic ions described in the first aspect, comprising the following steps: dissolving polymer quantum dots in a solvent, adding a carboxyl activation reagent to activate the carboxyl group, and then sequentially adding DNA chain A and DNA chain B to hybridize to obtain the probe for detecting trace trivalent arsenic ions.

[0010] After the carboxyl group of the polymer quantum dots is activated, they bind to the amino-terminal DNA and again bind to the complementary chain through complementary pairing to obtain a probe for detecting trace trivalent arsenic ions.

[0011] Furthermore, the polymer quantum dots can be prepared from poly(9,9-dioctylfluorene-co-benzothiadiazole) (PFBT) and poly(styrene-co-maleic anhydride) copolymer (PSMA).

[0012] Furthermore, in a solution obtained by dissolving the polymer quantum dots in a solvent, the concentration of the polymer quantum dots is 0.01 to 0.5 mg / mL.

[0013] Furthermore, the particle size of the polymer quantum dots is 10 to 50 nm.

[0014] Furthermore, the carboxyl activation reagent is a mixed solution of 1-ethyl-3 (3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS).

[0015] Furthermore, the molar ratio of the polymer quantum dots to the DNA chain A is (10-100):1.

[0016] Furthermore, the molar ratio of the DNA chain A to the DNA chain B is (0.5-2):1.

[0017] Furthermore, after adding DNA chain A, the step of reacting at 200-300 rpm for 3-4 hours is also included; after adding DNA chain B, the step of hybridizing at 200-300 rpm for 3-4 hours is also included.

[0018] The third aspect of the present invention provides an ECL detector for detecting trace trivalent arsenic ions, comprising a working electrode, a reference electrode, a counter electrode, an electrolyte and a photomultiplier tube (PMT), characterized in that the working electrode is modified with the probe for detecting trace trivalent arsenic ions described in the first aspect and rhodamine B (RhB).

[0019] Furthermore, the working electrode is prepared by the following method: the probe for detecting trace trivalent arsenic ions described in the first aspect is modified on the working electrode, and after the modification, rhodamine B is coated, and the unmodified rhodamine B is washed away to obtain a working electrode for detecting trace trivalent arsenic ions.

[0020] Furthermore, the detection limit of the trivalent arsenic ions is 150 pg / L.

[0021] Beneficial effects of the present invention:

[0022] The ECL detector provided by the present invention utilizes the resonance energy transfer (FRET) mechanism between polymer quantum dots and rhodamine B. In an As(III)-free environment, the strong electrochemiluminescence (ECL) signal of the polymer quantum dots overlaps with the absorption spectrum of rhodamine B in the range of 500 to 570 nm, resulting in significant quenching of the ECL signal. This quenching effect is due to the effective transfer of energy from the quantum dots to rhodamine B during the FRET process. When As(III) is present, it specifically forms a stable pairing structure with the T base in the DNA probe. This pairing causes rhodamine B to be released from the DNA double strand, reducing the chance of FRET. As the concentration of As(III) increases, the quenching effect of rhodamine B weakens, and the ECL signal recovers, achieving enhanced responsiveness to increased As(III) concentrations.

[0023] Compared with ICP-MS, ECL instruments are low-cost, small in size, and can even be further miniaturized, thus solving the problem of portable measurement. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The figures are the test results of the ECL detector in the presence of different concentrations of As(III); wherein A is the ECL signal intensity data diagram of testing As(III) solutions with different concentrations, and B is the calibration curve diagram of the ECL signal intensity and the logarithmic value of the As(III) concentration.

[0025] Figure 2 The graph is a test result graph of the selectivity and stability of the ECL detector for As(III); wherein A is the ECL signal intensity data graph, and B is the visual detection result graph.

[0026] Figure 3 This is a visual detection diagram of the ECL detector performing ECL imaging on As(Ⅲ) solutions with different concentrations.

[0027] Figure 4 The figures are the test results of the As(Ⅲ) content in the water samples of Dushu Lake and Taihu Lake in Suzhou using ECL detector and ICP-MS; wherein, A is the ECL signal intensity data diagram of the ECL detector testing the As(Ⅲ) content in the water samples of Dushu Lake and Taihu Lake in Suzhou, B is the visualization detection diagram of the ECL detector performing ECL imaging on the water samples of Dushu Lake and Taihu Lake in Suzhou, and C is the test data of the As(Ⅲ) content in the water samples of Dushu Lake and Taihu Lake in Suzhou using ECL detector and ICP-MS. DETAILED DESCRIPTION

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0029] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0031] The sequence of DNA strand A in the following examples is as follows:

[0032] 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACA GAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAA TCT-3', the 5' end is modified with an amino group (-C6H 12 NH2).

[0033] The sequence of DNA strand B in the following examples is as follows:

[0034] 5'-AGATTGCACTTACTATCTCGATGAAGAAGTACCCGGAGCGACGTTG GTTGTTCTGTAAAATTGAATAAGCTGGTATCTCCCTATAGTGAGTCGTATTA CC-3'.

[0035] Example 1

[0036] A method for preparing a probe (Pdots@dsDNA) for detecting trace amounts of As(III) comprises the following steps:

[0037] (1) 5 mg of poly(9,9-dioctylfluorene-co-benzothiadiazole) (PFBT) and 1 mg of poly(styrene-co-maleic anhydride) copolymer (PSMA) were completely dissolved in 5 mL of tetrahydrofuran (THF) to obtain a transparent mixed solution. A 20 mL sample bottle was taken, 10 mL of ultrapure water was added, and after ultrasonic degassing for 20 min, 1 mL of the above mixed solution was quickly added, and ultrasonic dispersion was continued for 5 min. The excess THF was removed by rotary evaporator to prepare a Pdots solution. (2) Take 500 μL of the Pdots solution obtained in step (1), add 60 μL of EDC and NHS (wherein the concentration of EDC is 20 mM and the concentration of NHS is 40 mM) solution, react for 2 h at pH 7.1 to activate the carboxyl group; add 60 μL of DNA chain A (40 μΜ), shake at 200 rpm for 3 h, further add 60 μL of DNA chain B (40 μM), and hybridize for 3 h at 200 rpm to obtain Pdots@dsDNA.

[0038] Example 2

[0039] An ECL detector for detecting trace As(III) comprises a working electrode, a reference electrode, a counter electrode, an electrolyte and a photomultiplier tube (PMT). An Ag / AgCl electrode is used as a reference electrode, a platinum wire electrode is used as a counter electrode, and a 0.1M phosphate (PBS) buffer solution is used as an electrolyte. The working electrode is prepared by the following method: a glassy carbon electrode is polished with α-alumina powder for three minutes, ultrasonically cleaned with ethanol and water respectively, and after drying with argon gas, Pdots@dsDNA is modified to the surface of an indium tin oxide (ITO) electrode (array channels are pasted on the electrode surface, black insulating tape is used around the channels, the channel diameter is about 0.3mm, and 20 microliters of Pdots@dsDNA are dripped into each channel), and then dried at room temperature; RhB is dripped onto the surface of the ITO electrode modified with Pdots@dsDNA for 1 hour, 20μL of 10mM RhB is added to each channel, and the unmodified RhB is washed with ultrapure water to obtain a working electrode for detecting As(III).

[0040] The method of testing using the ECL detector test for detecting trace As(III) of Example 2 is as follows: the solution to be tested is added dropwise to the working electrode for detecting As(III) prepared in Example 2, and after sufficient incubation, the electrode is rinsed for electrochemiluminescence detection. The test conditions are as follows: 25 mM tri-n-propylamine (TPrA) is added to 0.1 M PBS buffer, the test initial voltage is 0 V, the maximum voltage is 2 V, the minimum voltage is 0 V, the scanning speed is 100 mV / s, the number of scanning cycles is 2, and the PMT is 600 V.

[0041] Test Example 1

[0042] The ECL detector for detecting trace As(III) of Example 2 was used to test As(III) solutions of different concentrations. The test method was as follows: As(III) solutions of different concentrations were added dropwise to the working electrode for detecting As(III) prepared in Example 2. After sufficient incubation, the electrode was rinsed for electrochemiluminescence detection. The test conditions were as follows: 25 mM TPrA was added to 0.1 M PBS buffer, TPrA was used as a co-reactant, the initial voltage of the test was 0 V, the maximum voltage was 2 V, the minimum voltage was 0 V, the scanning speed was 100 mV / s, the number of scanning cycles was 2, and the PMT was 600 V.

[0043] Test results such as Figure 1 As shown in the figure, with the increase of As(Ⅲ) concentration, the ECL signal gradually increases. The ECL signal intensity of the ECL detector has a good linear relationship. When the As(Ⅲ) concentration is 1-10μg / L, the ultra-low LOD value of the ECL detector is 150pg / L.

[0044] Test Example 2

[0045] The selectivity and stability of the ECL detector for detecting trace As(III) in Example 2 were tested by performing tests on a blank group, an interfering ion group, an As(III) group (100 ng / L), and an As(III) group containing interfering ions, wherein the interfering ions were K in environmental water samples. + 、Na + Mg 2+ , Ca 2+ , Sr 2+ And the representative of heavy metals Fe 3+ 、Cd 2+ , Cu 2+ , Pb 2+ 、Eu 3+ (The concentration of each ion is 0.1 mg / L).

[0046] Test results such as Figure 2 As shown, Figure 2 Comparison of the four sets of data in Figure A shows that despite the addition of interfering ions, the ECL detector still has good selectivity for As(III). Figure 2 The visual detection result diagram in Figure B shows the stability of the ECL detector.

[0047] Test Example 3

[0048] The ECL detector for detecting trace As(III) of Example 2 was used to further perform ECL imaging, with cyclic voltage scanning from 0 V to 2.0 V, and visualization using a charge coupled device (CCD) to achieve rapid determination of trace As(III).

[0049] Test results such as Figure 3 As shown in the figure, after the ECL detector was treated with a higher concentration of As(III) solution, the ECL signal was significantly brighter. Visualization can truly reflect the ECL signal intensity. Compared with the control sample (ECL detector not treated with As(III) solution), ECL imaging has an indispensable advantage in accurately and quickly judging whether the sample under test exceeds the standard.

[0050] Test Example 4

[0051] In order to further confirm the practicality of the ECL detector, the ECL detector and ICP-MS for detecting trace As(III) in Example 2 were used to determine the content of As(III) in water samples from Suzhou Dushu Lake (Sample 1) and Taihu Lake (Sample 2), respectively. The ECL detector also performed visual detection.

[0052] Test results such as Figure 4As shown, according to the standard curve, the As(III) determination results of the water samples of Dushu Lake and Taihu Lake are 1.4 μg / L and 10.8 ng / g, respectively. The ECL detector and ICP-MS for detecting trace As(III) provided by the present invention can both correctly determine the concentration of As(III), confirming the good effectiveness of the ECL detector in the determination of trace As(III) in environmental samples.

[0053] In summary, the ECL detector for detecting trace As(III) provided by the present invention can realize ultra-trace detection of As(III) with an extremely low detection limit of 150pg / L, which is of great significance for detecting ultra-trace toxic substances in the fields of environmental monitoring and food safety. In the technical scheme of the present invention, As(III) can selectively release RhB, restore the electrochemiluminescence signal, and add different interfering ions, including common ions and heavy metal ions in the environment, which will not interfere with the detection, which shows that the ECL detector has high selectivity in detecting specific target substances. The present invention tested the applicability of the ECL detector under different water samples, and the results showed that the ECL signal was stable under different conditions, which means that the ECL detector can be directly applied to actual sample analysis, and has been successfully applied to the visual determination of trace arsenic ions in water samples, showing the ability to perform rapid detection directly on site.

[0054] Obviously, the above embodiments of the present invention are only examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. Those skilled in the art should understand that other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the embodiments here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A probe for detecting trace amounts of trivalent arsenic ions, characterized in that: The invention comprises polymer quantum dots and trivalent arsenic ion aptamers modified on the surface of the polymer quantum dots, wherein the emission wavelength range of the polymer quantum dots is 500-570 nm, the trivalent arsenic ion aptamers are DNA chains A and DNA chains B, one end of the DNA chain A is modified with a functional group containing an amino group, the sequence of the DNA chain A is shown in SEQ ID NO.1, and the sequence of the DNA chain B is shown in SEQ ID NO.

2.

2. The probe for detecting trace trivalent arsenic ions according to claim 1, characterized in that: The polymer quantum dots are selected from one or more of poly(9,9-dioctylfluorene-co-benzothiadiazole) quantum dots, cyanopolystyrene quantum dots, poly(9,9-di-n-octylfluorenyl-2,7-diyl) quantum dots and poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole)] quantum dots.

3. A method for preparing a probe for detecting trace trivalent arsenic ions according to claim 1 or 2, characterized in that: The method comprises the following steps: dissolving polymer quantum dots in a solvent, adding a carboxyl activation reagent to activate the carboxyl group, sequentially adding a DNA chain A and a DNA chain B, and hybridizing to obtain the probe for detecting trace trivalent arsenic ions.

4. The preparation method according to claim 3, characterized in that: The polymer quantum dots are prepared from a copolymer of poly(9,9-dioctylfluorene-co-benzothiadiazole) and poly(styrene-co-maleic anhydride).

5. The preparation method according to claim 3, characterized in that: The particle size of the polymer quantum dots is 10 to 50 nm.

6. The preparation method according to claim 3, characterized in that: The carboxyl activation reagent is a mixed solution of 1-ethyl-3 (3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide.

7. The preparation method according to claim 3, characterized in that: The molar ratio of the polymer quantum dots to the DNA chain A is (10-100):

1.

8. An ECL detector for detecting trace trivalent arsenic ions, comprising a working electrode, a reference electrode, a counter electrode, an electrolyte and a photomultiplier tube, characterized in that: The working electrode is modified with the probe for detecting trace trivalent arsenic ions according to claim 1 or 2 and rhodamine B.

9. The ECL detector for detecting trace trivalent arsenic ions according to claim 8, characterized in that: The working electrode is prepared by the following method: modifying the probe for detecting trace trivalent arsenic ions according to claim 1 on the working electrode, coating rhodamine B after modification, and washing away the unmodified rhodamine B to obtain the working electrode for detecting trace trivalent arsenic ions.

10. The ECL detector for detecting trace trivalent arsenic ions according to claim 8, characterized in that: The detection limit of the trivalent arsenic ion is 150 pg / L.

Images