Feed traditional Chinese medicine additive for improving chicken quality of broiler chickens and application of feed traditional Chinese medicine additive

Abstract

The invention provides a feed traditional Chinese medicine additive for improving chicken quality of broiler chickens and application thereof, and relates to the field of animal feeds, and the feed traditional Chinese medicine additive provided by the invention comprises the following raw material components in parts by mass: 10-30 parts of radix tetrastigme stems and leaves, 1-2 parts of pomegranate rind, 0.5-1 part of dried orange peel and 0.5-1 part of liquorice. By using the feed traditional Chinese medicine additive and the broiler feed provided by the invention, the contents of flavor amino acids such as glutamic acid, alanine and threonine and essential amino acids such as phenylalanine, lysine and isoleucine can be increased, the amino acid composition of broilers is improved, the flavor of broiler chicken is improved, and the quality of broiler chicken is improved; the abundance of beneficial bacteria such as Prevoteraceae UCG001 and the like can be improved, the abundance of harmful bacteria such as Mucispirillum and the like can be reduced, and meanwhile, the intestinal nutrition transfer can be enhanced and the inflammatory response in vivo can be relieved.

Description

Technical Field

[0001] The invention relates to the field of animal feed, and in particular to a feed Chinese medicinal additive for improving the quality of broiler chicken meat and an application thereof. Background Art

[0002] As green plants, Chinese herbal medicine has both nutritional and medicinal functions. At present, Chinese herbal medicine has been used in the development of broiler feed. However, at present, the purpose of adding Chinese herbal medicine to broiler feed is mainly to use Chinese herbal medicine to replace antibiotics to achieve the purpose of improving the quality of chicken and enhancing the immunity of broilers. There is no research on using Chinese herbal medicine to improve the quality of broiler chickens. At the same time, the Chinese herbal medicine currently used in broiler feed is mainly the medicinal part of Chinese herbal medicine, which leads to a huge waste of resources of non-medicinal parts of Chinese herbal medicine plants during use. Summary of the invention

[0003] The problem to be solved by the present invention is how to improve the quality of broiler chicken meat by using Chinese herbal medicine.

[0004] In order to solve the above technical problems, the first aspect of the present invention provides a feed Chinese medicine additive for improving the quality of broiler chicken meat. The raw material components of the feed Chinese medicine additive for improving the quality of broiler chicken meat include, by weight: 10 to 30 parts of stems and leaves of Tripterygium wilfordii, 1 to 2 parts of pomegranate peel, 0.5 to 1 part of tangerine peel, and 0.5 to 1 part of licorice.

[0005] The Chinese medicine feed additive for improving the quality of broiler chicken provided by the present invention is actually a Chinese medicine compound that can be added to broiler feed. In the compound, the stems and leaves of Tripterygium wilfordii are slightly bitter and flat in nature and flavor, enter the lung, heart, liver and kidney meridians, have the effects of clearing away heat and detoxifying, promoting blood circulation and relieving pain, and play a major therapeutic role in the main symptoms such as heat toxins, qi stagnation and blood stasis, and are the main ingredient and monarch medicine; the pomegranate peel is sour, astringent and warm in nature and flavor, enters the large intestine meridian, has the effects of astringing the intestines and stopping diarrhea and stopping bleeding, and is used to assist the monarch medicine in treating heat toxins. Tangerine peel is bitter, pungent and warm in nature, and enters the lung and spleen meridians. It has the effects of regulating qi and strengthening the spleen, drying dampness and resolving phlegm, regulating spleen and stomach function, promoting the absorption and transportation of drugs, and reducing the adverse effects of the bitter and cold nature of Tripterygium wilfordii on the spleen and stomach; it can also prevent problems such as qi stagnation that may be caused by other drugs in the prescription, and is an auxiliary material and adjuvant; Licorice is sweet and flat in nature, and enters the heart, lung, spleen and stomach meridians. It has the effect of harmonizing various medicines, and can make the various medicinal flavors in the prescription work synergistically as an auxiliary material and adjuvant.

[0006] As a perennial root Chinese medicinal material, it takes 3 to 5 years for Sanyeqing to meet commercial requirements. In the Sanyeqing plant, the yield of stems and leaves is much higher than that of roots, which leads to a huge waste of resources in actual use. In the broiler feed Chinese medicinal additive provided by the present invention, the stems and leaves of Sanyeqing are used as the main ingredients, which can effectively complete the full resource utilization of the non-medicinal parts of traditional Chinese medicine.

[0007] The second aspect of the present invention provides a method for preparing the feed Chinese medicine additive for improving the quality of broiler chicken meat as described in the first aspect, comprising the following steps: mixing and crushing the stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel, and licorice, and then performing alcohol extraction, collecting the extract after alcohol extraction and drying, so as to obtain the feed Chinese medicine additive for improving the quality of broiler chicken meat.

[0008] Preferably, the preparation method specifically comprises the following steps:

[0009] S1. Crushing: Mix and crush the stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel and liquorice, and pass through a 100-200 mesh sieve to obtain a mixture;

[0010] S2, alcohol extraction: add 70% ethanol in a volume ten times the weight of the mixture obtained in step S1, reflux for 1 to 2 hours, and obtain an extract a;

[0011] S3, secondary alcohol extraction: add 70% ethanol in an amount of eight times the weight volume of the mixture to the remaining mixture in step S2, reflux for 1 to 2 hours, and obtain extract b;

[0012] S4, drying: mixing the extract a and the extract b, freeze-drying, and obtaining a feed Chinese medicine additive for improving the quality of broiler chicken meat.

[0013] A third aspect of the present invention provides a broiler feed, which is the Chinese medicinal feed additive for improving the quality of broiler meat as described in the first aspect.

[0014] Preferably, the added mass of the Chinese medicinal feed additive for improving the quality of broiler meat in broiler feed is 1 to 3% of the total mass.

[0015] Preferably, the broiler feed also includes 60-65 parts of corn, 24 parts of soybean meal, 5 parts of bran, 1.5 parts of soybean oil, 1.5 parts of calcium hydrogen phosphate, 1.5 parts of stone powder, and 0.5 part of sodium chloride.

[0016] The beneficial effects of the present invention are as follows: 1. The feed Chinese medicine additive for improving the quality of broiler chicken meat provided by the present invention uses the non-medicinal part of the medicinal plant, the stems and leaves of the trifoliate green as the main ingredients through the Chinese medicine compound compatibility. First, the full resource utilization of the non-medicinal parts of the medicinal plant can be realized, thereby improving the economic benefits. 2. By using the broiler feed provided by the present invention, the contents of flavor amino acids (glutamic acid, alanine and threonine, etc.) and essential amino acids (phenylalanine, lysine and isoleucine, etc.) in broiler chicken meat can be significantly increased, thereby improving the flavor quality and impact value of the chicken meat. Finally, the richness and Alpha diversity of intestinal microorganisms of broilers are increased, the abundance of beneficial bacterial genera such as Prevotellaceae_UCG_001 is increased, and the abundance of harmful bacterial genera such as Mucispirillum is reduced. 3. The feed Chinese medicine additive and broiler feed provided by the present invention can improve the intestinal nutrient transport of broilers and reduce inflammatory reactions in the body, which is conducive to intestinal health and development, and therefore has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a statistical analysis result diagram of amino acid composition of broiler chickens in different treatment groups in Example 1 of the specific embodiment of the present invention;

[0018] Figure 2 This is a graph showing the analysis results of the intestinal microbial Alpha diversity index in Example 2 of a specific embodiment of the present invention;

[0019] Figure 3 This is the analysis result of the intestinal microbial community structure at the phylum level in Example 2 of the specific implementation method of the present invention;

[0020] Figure 4 The results of the analysis of the intestinal microbial community structure at the genus level in Example 2 of the specific implementation method of the present invention;

[0021] Figure 5 The characteristic flora analysis results of the intestinal flora in Example 2 of the specific implementation mode of the present invention;

[0022] Figure 6 These are the results of the expression detection of nutrient transport genes and pro-inflammatory factors in broiler chickens in different treatment groups in Example 3 of the specific implementation mode of the present invention. DETAILED DESCRIPTION

[0023] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation method and typical parameters of the present invention, and are not used to limit the parameter range described in the present invention. Reasonable changes derived therefrom are still within the scope of protection of the claims of the present invention.

[0024] It should be noted that the endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed in this article.

[0025] Unless otherwise defined, all terms, symbols and other scientific terms used herein are intended to have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. In some cases, terms with conventionally understood meanings are defined herein for the purpose of clarification or ease of reference, and such definitions herein should not be construed as indicating significant differences from conventional understandings in the art. The technical methods described or cited herein are generally well understood by those skilled in the art and are adopted by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents and instruments is carried out in accordance with the protocols and parameters given by the manufacturer.

[0026] As described in the background art, there is currently a huge waste of resources in the non-medicinal parts of medicinal plants. At the same time, the main purpose of using Chinese herbal medicine in broiler feed is to replace antibiotics, and there are no reports on using Chinese herbal medicine to improve the quality of broiler chicken meat.

[0027] Based on this, a specific embodiment of the present invention provides a feed Chinese medicine additive for improving the quality of broiler chicken meat. The raw material components of the feed Chinese medicine additive for improving the quality of broiler chicken meat include: 10 to 30 parts of Tripterygium wilfordii stems and leaves, 1 to 2 parts of pomegranate peel, 0.5 to 1 part of tangerine peel, and 0.5 to 1 part of licorice in mass fractions.

[0028] The Chinese medicine compound in the feed Chinese medicine additive provided by the above embodiment uses the stems and leaves of the medicinal plant, which are not medicinal parts, as the main ingredients, which can effectively improve the full resource utilization of the three-leaf green plant. The stems and leaves of the three-leaf green are slightly bitter and flat in nature and taste, and are in the lung, heart, liver, and kidney meridians. They have the effects of clearing away heat and detoxifying, promoting blood circulation and relieving pain, and play a major therapeutic role in the main diseases and syndromes such as heat toxins, qi stagnation and blood stasis. They are the main ingredient and the main medicine; the pomegranate peel is sour, astringent, and warm in nature and tastes, and is in the large intestine meridian. It has the effects of astringing the intestines, stopping diarrhea, and stopping bleeding, and is used as an auxiliary main medicine. It is used to treat intestinal damp-heat caused by heat toxins, etc., and is an auxiliary material and adjuvant; Tangerine peel is bitter, pungent and warm in nature, and enters the lung and spleen meridians. It has the effects of regulating qi and strengthening the spleen, drying dampness and resolving phlegm, regulating spleen and stomach function, promoting the absorption and transportation of drugs, and reducing the adverse effects of the bitter and cold nature of Tripterygium wilfordii on the spleen and stomach; it can also prevent problems such as qi stagnation that may be caused by other drugs in the prescription, and is an auxiliary material and adjuvant; Licorice is sweet and flat in nature, and enters the heart, lung, spleen and stomach meridians. It has the effect of harmonizing various medicines, and can make the various medicinal flavors in the prescription work synergistically as an auxiliary material and adjuvant.

[0029] The above-mentioned Chinese herbal additives in broiler feed can significantly increase the content of flavor amino acids, essential amino acids and total amino acids in chicken, thereby improving the quality of chicken.

[0030] The above-mentioned Chinese medicinal feed additive for improving the quality of broiler chicken meat can be prepared by the following preparation steps:

[0031] S1. Crushing: Mix and crush the stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel and liquorice, and pass through a 100-200 mesh sieve to obtain a mixture;

[0032] S2, alcohol extraction: add 70% ethanol in a volume ten times the weight of the mixture obtained in step S1, reflux for 1 to 2 hours, and obtain an extract a;

[0033] S3, secondary alcohol extraction: add 70% ethanol in an amount of eight times the weight volume of the mixture to the remaining mixture in step S2, reflux for 1 to 2 hours, and obtain extract b;

[0034] S4, drying: mixing the extract a and the extract b, freeze-drying, and obtaining a feed Chinese medicine additive for improving the quality of broiler chicken meat.

[0035] A specific embodiment of the present invention also provides a broiler feed comprising the aforementioned Chinese medicinal feed additive for improving the quality of broiler meat, wherein the content of the Chinese medicinal feed compound additive for improving the quality of broiler meat in the broiler feed is 1 to 3% by mass.

[0036] Specifically, the broiler feed also includes 60 to 65 parts of corn, 24 parts of soybean meal, 5 parts of bran, 1.5 parts of soybean oil, 1.5 parts of calcium hydrogen phosphate, 1.5 parts of stone powder, 0.5 parts of sodium chloride, and appropriate amounts of vitamin and mineral premixes.

[0037] By using the broiler feed provided by the present invention, the richness (ACE index) and Alpha diversity (Chao1 index) of intestinal microorganisms of farmed broilers can be significantly improved, the abundance of beneficial bacteria genera Prevotellaceae_UCG_001 and [Ruminococcus]_torques_group can be increased, and the abundance of harmful bacteria genera Subdoligranulum and Mucispirillum can be reduced. The broiler feed provided by the specific embodiment of the present invention can also significantly increase the expression of intestinal amino acids (rBAT, EAAT3) and peptide transport genes (PepT1, APN), effectively enhance intestinal nutrient transport, and thus improve intestinal health. In addition, the broiler feed provided by the specific embodiment of the present invention can also significantly reduce the expression of pro-inflammatory factors, mainly including IL-1β, IL-6 and IFN-γ, and effectively reduce the inflammatory response in broilers.

[0038] The technical solution of the present invention is further described below through specific embodiments.

[0039] Example 1

[0040] Preparation of Chinese herbal compound feed additive for improving broiler chicken meat quality

[0041] Take stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel and liquorice, wash and dry them, mix and crush them according to a mass ratio of 30:1:0.6:0.6, and pass them through a 120-mesh sieve to obtain a mixture; the mixture is subjected to alcohol extraction twice, and the specific operations are as follows: the first time, 70% ethanol is added in an amount of 10 times the weight volume of the mixture, refluxed for 1.5 hours, and the ethanol extract is collected; the second time, 70% ethanol is added in an amount of 8 times the weight volume of the mixture, refluxed for 1.5 hours, the extract is collected, and the extract is freeze-dried to obtain a feed Chinese medicine compound additive for improving the quality of broiler chicken meat.

[0042] Example 2

[0043] Meat quality improvement experiment

[0044] The present embodiment experiment adopts random grouping method, selects 210 healthy broilers of similar weight, and is randomly divided into 7 groups, divided into control group, three-leaf green group (low dose, medium dose and high dose) and Chinese medicine compound group (low dose, medium dose and high dose), each group 6 replicates (each replicate 5 birds). The control group is fed with a basic diet, the three-leaf green group is fed with a diet with 1%, 2% and 3% three-leaf green stem and leaf powder added, and the Chinese medicine compound group is fed with a diet with 1%, 2% and 3% Chinese medicine compound powder added, respectively, and is fed for 56 days by mixing with the basic diet. The basic diet is prepared with reference to the nutritional needs of broilers in NRC (1994), as shown in Table 1. Broilers are raised in experimental chicken houses, with free access to food and water, 24h light, regular cleaning, regular disinfection of the house, and immunization and feeding management are carried out in accordance with the regulations of the experimental chicken farm. According to the feed formula in Table 1 below, 7 kinds of feed are prepared, among which the Chinese medicine additive is a Chinese medicine compound mainly composed of stems and leaves of Tripterygium wilfordii or stems and leaves of Tripterygium wilfordii alone, and the specific feeding is carried out according to Table 1.

[0045] Table 1

[0046]

[0047] On the 56th day of the experiment, breast meat samples were collected from broilers in different dosage groups, and 10-50 mg of breast meat was accurately weighed for quantitative analysis and recording of amino acids. Figure 1 .

[0048] The flavor amino acids described in this embodiment include glutamic acid, aspartic acid, alanine, serine and threonine; the essential amino acids include threonine, phenylalanine, lysine, tryptophan, isoleucine, valine and methionine.

[0049] Since there are more groups in Example 2, Figure 1 The significant differences were analyzed using letter notation. Figure 1 From A in the figure, we can see that compared with the control group, with the increase in the amount of additives, the contents of glutamic acid, phenylalanine, lysine and isoleucine in the clover group and the Chinese medicine compound group increased significantly, especially in the high-dose group, the above amino acids increased significantly; and compared with the clover group, the contents of threonine, phenylalanine, lysine and lysine in the Chinese medicine compound group increased significantly, and were dose-dependent; among them, glutamic acid and alanine in the low-dose group of the Chinese medicine compound increased significantly, and the contents of alanine and serine in the medium-dose group increased significantly, especially in the high-dose group, the contents of seven amino acids, glutamic acid, alanine, serine, threonine, phenylalanine, lysine and isoleucine, were significantly higher than those in the clover group. Figure 1 It can be seen from B in that compared with the control group and the Sanyeqing group, the contents of flavor amino acids, essential amino acids and total amino acids in broilers in each dose group of the Chinese medicine compound were significantly increased. Except for total amino acids, the rest were not dose-dependent. Figure 1 It can be seen from the C in that compared with the control group, the contents of flavor amino acids, essential amino acids and total amino acids in broilers in the TCM compound and Sanyeqing groups were significantly increased. Regardless of flavor amino acids, essential amino acids or total amino acids, the contents of the TCM compound group were significantly higher than those in the Sanyeqing group, indicating that the effect of adding TCM compound feed on improving the amino acid composition of chicken is better than that of the Sanyeqing group, especially the high-dose TCM compound group.

[0050] The umami, sweet, aromatic and other flavor amino acids rich in muscle are one of the important reasons for the deliciousness and unique flavor of chicken meat. Among them, umami amino acids mainly include glutamic acid, aspartic acid, glycine and alanine, sweet amino acids mainly include alanine, serine, threonine and proline, and aromatic amino acids are mainly composed of phenylalanine and tyrosine. The significantly increased glutamic acid, alanine, serine, threonine and phenylalanine in the above-mentioned dose groups are all flavor amino acids, which can not only improve the flavor of chicken and keep it delicious and fragrant, but also ensure adequate nutrition. Therefore, adding different doses of Chinese herbal compound to the broiler diet can significantly increase the content of flavor amino acids, essential amino acids and total amino acids in broilers, thereby effectively improving the amino acid composition of broilers and enhancing the flavor quality of chicken. The overall improvement effect is significantly better than that of the three-leaf green group and the control group.

[0051] Example 3

[0052] Intestinal effects test

[0053] It can be seen from Example 1 that the addition of Chinese herbal compound in different dosage groups can significantly improve the amino acid composition of broilers. The intestine, as the main site of nutrient digestion and absorption and an important organ, is responsible for the normal nutrient digestion and absorption, decomposition and immune regulation of the body. Therefore, intestinal health is closely related to the body's nutrient absorption, and even growth performance and immune function. Therefore, this embodiment is further designed.

[0054] The cecal contents of 6 chickens in each group were randomly selected on the 56th day of feeding at different dosage groups, and DNA was extracted according to the instructions of TGuide S96 Magnetic Soil / Stool DNA Kit.

[0055] (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used as primers to amplify the V3-V4 region of 16SrRNA by PCR to construct a library, and the library was quantified and quality controlled. Then, according to the data volume requirements of the sample, the library was mixed in equal moles and sequenced using the Illumina novaseq6000 platform. The original sequencing sequence of the cecal flora was quality controlled using Trimmomatic v0.33 software and spliced ​​using Usearch v10 software. The optimized sequence was clustered into operational taxonomic units (OTUs) based on 97% similarity, and the flora composition was statistically analyzed.

[0056] The cecal contents of broiler chickens at each dose were selected for comparison and analysis with the control group. After sequence quality control standardization comparison, a total of 1,402,053 high-quality valid sequences were obtained. In this study, all sequences were divided into 1,561 OTUs based on 97% sequence similarity. The Alpha diversity index of each dose group was evaluated using QIIME2 2020.6 software. Alpha diversity reflects the species richness and species diversity of a single sample, and there are many measurement indicators: Ace, Chao1, Shannon, Simpson, etc. The Ace and Chao1 indices measure species richness, that is, the number of species. Shannon and Simpson indices are used to measure species diversity. In the figure, * indicates statistical difference (P < 0.05), ** indicates significant difference (P < 0.01), and *** indicates extremely significant difference (P < 0.001). The analysis results are as follows Figure 2 As shown, compared with the control group, there were significant differences in the intestinal microbial composition structure of ACE and Chao1 index in the high-dose group (P < 0.05), indicating that the addition of the Chinese herbal compound caused changes in the Alpha diversity of broiler intestinal microorganisms.

[0057] Further, by comparing with the database, the OTUs were classified into species, and the composition structure of the intestinal flora in the cecal contents of broiler chickens was analyzed based on the classification level (phylum, class, order, family, genus). Generally, we recommend focusing on the classification at the phylum and genus levels, which are highly representative and have a clear classification hierarchy for easy comparison.

[0058] like Figure 3 As shown in the data, at the phylum level, Bacteroidetes and Firmicutes were the two main bacterial communities in the intestine of broiler chickens, but there was no significant difference in these two dominant bacterial communities between the two groups in this experiment. The addition of the Chinese herbal compound significantly reduced the abundance of Deferribacterota in each dosage group (P < 0.01).

[0059] like Figure 4 As shown in Figure 2, at the genus level, the addition of Chinese herbal medicine compound can significantly increase the number of beneficial bacterial genus

[0060] The abundance of Prevotellaceae_UCG_001 (P<0.01) was significantly increased, and the abundance of harmful bacteria genera Subdoligranulum (P<0.05) and Mucispirillum (P<0.05) was significantly reduced. In addition, the abundance of [Ruminococcus]_torques_group increased with increasing doses, but there was no significant difference compared with the blank control group.

[0061] Figure 5 A in is the LDA Effect Size (LeFSe) evolutionary branch diagram, Figure 5 B in is the LDA value distribution bar graph (LDA value>3), such as Figure 5 As shown in the figure, the specific intestinal microorganisms of different dose groups and the control group were further analyzed by LEfSe and confirmed that after adding the Chinese medicine compound, the beneficial bacteria genus Prevotellaceae_UCG_001 was the characteristic genus of the Chinese medicine compound addition group, which not only helped to lower the intestinal pH and promote calcium absorption, but also accelerated the absorption and metabolism of nutrients in broilers by regulating the intestinal flora; while the harmful bacteria genus Mucispirillum was the characteristic genus of the blank control group. As a conditional pathogen of intestinal symbiosis, its abundance changes are often accompanied by the occurrence of enteritis and Salmonella infection.

[0062] It can be seen from Example 1 and Example 2 that the Chinese herbal compound in different dosage groups can not only improve the amino acid composition of broiler chickens, but also significantly increase the richness and diversity of intestinal microorganisms in broiler chickens, strengthen the colonization of beneficial intestinal bacteria, and thus contribute to the intestinal health of broiler chickens.

[0063] Example 4

[0064] Intestinal nutrient transport receptors and related pro-inflammatory factors

[0065] Broiler breeding experiments were carried out according to Example 1. Six chickens were randomly selected from each experimental group on the 56th day for blood and duodenum extraction. Total RNA was extracted according to the kit instructions to obtain cDNA. The expression of genes related to intestinal nutrient transporters, including peptide transporter (PepT1), amino acid transporter (rBAT, b o,+ AT, LAT1 and EAAT3) and digestive enzymes (APN).

[0066] Depend on Figure 6 It can be seen that compared with the control group, the relative expression levels of PepT1, rBAT, LAT1, EAAT3 and APN in the low-dose group were significantly increased (P < 0.05), the relative expression levels of EAAT3 and APN in the medium-dose group were significantly increased (P < 0.01), and the relative expression levels of rBAT, EAAT3 and APN in the high-dose group were significantly increased (P < 0.05). o,+ The relative expression of AT increased significantly (P<0.01). The results showed that the appropriate dose of Chinese herbal compound can enhance the nutritional transport of intestinal peptides and amino acid-related substances and improve intestinal health.

[0067] Sanyeqing is known for its heat-clearing, detoxifying, anti-inflammatory and analgesic effects. By detecting the expression of common pro-inflammatory factors (IL-1β, IL-6, TNF-α, NF-κB and IFN-γ) in broilers, the anti-inflammatory effect of the Chinese medicine compound can be preliminarily measured. Figure 6 It can be seen that compared with the control group, the expression of pro-inflammatory factors IL-1β, IL-6, TNF-α, NF-κB and IFN-γ in broilers was reduced. In particular, the expression of IL-1β and IL-6 in the medium-dose group was significantly reduced (P < 0.01), and the expression of IL-1β, IL-6 and IFN-γ in the high-dose group was significantly reduced (P < 0.05), but there was no dose dependence. The results show that medium and high doses of Chinese herbal compound can reduce the expression of pro-inflammatory factors and alleviate the body's inflammatory response.

[0068] Depend on Figure 6 It can be seen that the addition of appropriate doses of Chinese herbal compound can not only enhance the transport of intestinal peptides and amino acid-related nutrients in broiler chickens, improve intestinal health, but also reduce inflammatory responses.

[0069] It can be seen from the above embodiments that the Chinese medicinal additive for broiler feed provided by the specific embodiment of the present invention and the feed added with the additive have the effect of improving the amino acid composition, intestinal health and inflammation of broilers. Specifically, on the one hand, it can increase the content of essential amino acids and flavor amino acids in broilers, and on the other hand, it can increase the diversity and richness of intestinal microorganisms and the relative content of beneficial and harmful bacterial genera. At the same time, it can also enhance intestinal nutrient transport (rBAT, EAAT3, PepT1 and APN) and reduce inflammatory response in the body (IL-1β, IL-6 and IFN-γ).

[0070] Although the disclosure is disclosed as above, the protection scope of the disclosure is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. A Chinese medicinal feed additive for improving the quality of broiler chicken meat, characterized in that: The raw material components of the feed Chinese medicine additive include, by weight: 10 to 30 parts of stems and leaves of Tripterygium wilfordii, 1 to 2 parts of pomegranate peels, 0.5 to 1 part of tangerine peels, and 0.5 to 1 part of liquorice.

2. A method for preparing a feed Chinese medicinal additive for improving the quality of broiler chickens according to claim 1, characterized in that: The following steps are involved: The stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel and liquorice are mixed and crushed, and then alcohol extraction is performed. After the alcohol extraction, the extract is collected and dried to obtain a feed Chinese medicine additive for improving the quality of broiler chicken meat.

3. The preparation method according to claim 2, characterized in that: The preparation method specifically comprises the following steps: S1. Crushing: Mix and crush the stems and leaves of Tripterygium wilfordii, pomegranate peel, tangerine peel and liquorice, and pass through a 100-200 mesh sieve to obtain a mixture; S2, alcohol extraction: add 70% ethanol in a volume ten times the weight of the mixture obtained in step S1, reflux for 1 to 2 hours, and obtain an extract a; S3, secondary alcohol extraction: add 70% ethanol in an amount of eight times the weight volume of the mixture to the remaining mixture in step S2, reflux for 1 to 2 hours, and obtain extract b; S4, drying: mixing the extract a and the extract b, freeze-drying, and obtaining a broiler feed Chinese medicine additive.

4. An application of the Chinese medicinal feed additive for improving the quality of broiler chicken meat according to claim 1, characterized in that: The feed Chinese medicinal additive for improving the quality of broiler chicken meat is used in the preparation of broiler feed.

5. The use according to claim 4, characterized in that The broiler feed includes the Chinese medicinal feed additive for improving the quality of broiler chicken meat as described in claim 1.

6. The use according to claim 5, characterized in that The added mass of the Chinese medicinal feed additive used to improve the quality of broiler chicken meat in broiler feed is 1 to 3% of the total mass.

7. The use according to claim 5, characterized in that Calculated by weight, the broiler feed also includes 60 to 65 parts of corn, 24 parts of soybean meal, 5 parts of bran, 1.5 parts of soybean oil, 1.5 parts of calcium hydrogen phosphate, 1.5 parts of stone powder, and 0.5 parts of sodium chloride.

Images