Application of lncRNA MIR22HG / miR-597-3p / ARHGEF3 combination in rheumatoid arthritis

Abstract

The invention discloses an application of an lncRNA MIR22HG / miR-597-3p / ARHGEF3 combination in rheumatoid arthritis, and belongs to the field of molecular biology of rheumatoid arthritis. The LncRNA MIR22HG can be used for regulating and controlling the expression of ARHGEF3 by targeting miR-597-3p, so that the hypercoagulable state and inflammatory response of RA are promoted. Experiments prove that the lncRNA MIR22HG can play a spongy role and is competitively combined with miR-597-3p to lose use, so that the expression of a corresponding target gene ARHGEF3 is regulated and controlled, and the hypercoagulable state and inflammatory response of RA are promoted, thereby proving that the lncRNA MIR22HG can be used for treating the hypercoagulable state and inflammatory response of RA.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology of rheumatoid arthritis, and specifically relates to an application of a lncRNA MIR22HG / miR-597-3p / ARHGEF3 combination in rheumatoid arthritis. Background Art

[0002] Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease with symmetrical polyarticular lesions as the main clinical features, and synovitis, pannus formation, platelet activation, and abnormal coagulation and fibrinolysis system as the important pathological basis. The prevalence of RA in adults is 0.5%-1%, and the male-female ratio is about 1:3. RA clinical indicators also show abnormal coagulation and fibrinolysis, and a hypercoagulable state exists in the body.

[0003] Long noncoding RNA (lncRNA) is a type of RNA with a length greater than 200 nucleotides, which mainly exists in the cell nucleus. Similar to mRNA, lncRNA has lower stability and conservation, but stronger specificity. Due to the lack of an open reading frame, it has almost no protein encoding function. However, with the deepening of lncRNA research, it can regulate the recruitment of gene transcription machinery, post-transcriptional modification and expression, and epigenetics through certain complex relationships. In addition, lncRNA is involved in the immune response and cell differentiation of RA. It can be seen that abnormal expression of lncRNA is closely related to RA, which also means that lncRNA may serve as an important basis for the diagnosis or treatment of RA in the future.

[0004] LncRNA can competitively bind to miRNA to form a ceRNA (competingendogenous RNA, ceRNA) regulatory combination centered on lncRNA. lncRNA can act as ceRNA to compete for shared miRNA response elements and react with mRNA to regulate each other's expression levels. LncRNA / miRNA / mRNA can form a complex RNA molecular regulatory pattern and participate in the cell biological processes of RA, such as proliferation, apoptosis, inflammation and hypercoagulable state. Therefore, exploring the application of ceRNA combination in RA hypercoagulable state has great clinical practical value. Summary of the invention

[0005] The present invention obtains through experimental research that lncRNA MIR22HG plays a role as the ceRNA of miR-597-3p in RA, can target ARHGEF3, and participate in hypercoagulable state and inflammatory response. At the same time, through cell transfection, gene editing and rescue experiments, the present invention discovers a new ceRNA combination, namely lncRNA MIR22HG / miR-597-3p / ARHGEF3, as a new target for diagnosis and treatment of hypercoagulable state in RA.

[0006] The technical solution adopted by the present invention is:

[0007] The present invention proposes an application of a lncRNA MIR22HG / miR-597-3p / ARHGEF3 combination in the hypercoagulable state of RA, specifically, the lncRNA MIR22HG can target ARHGEF3 by competitively binding to miR-597-3p, thereby promoting the hypercoagulable state and inflammatory response of RA.

[0008] The present invention also proposes the use of a preparation for silencing lncRNA MIR22HG in the preparation of a RA therapeutic preparation. Specifically, silencing the lncRNA MIR22HG can target ARHGEF3 by competitively binding to miR-597-3p, thereby reducing the inflammatory response and improving the hypercoagulable state of RA.

[0009] The present invention detects the up-regulated expression of lncRNA MIR22HG in peripheral blood mononuclear cells (PBMCs) of RA patients by RT-qPCR technology. The ROC curve results show that the area under the curve of lncRNA MIR22HG is 93.91%, so it can be explained that lncRNA MIR22HG is a specific biomarker for RA. The results of correlation analysis show that the expression of lncRNA MIR22HG is positively correlated with age, disease course, ESR, CRP, IGA, IGG, IGM, C3, C4, DAS28, VAS, and SAS, and negatively correlated with PF, BP, GH, and SF. Logostic regression results show that ESR, IGG, C3, DAS28, and PF are risk factors for lncRNA MIR22HG. In RA synovial fibroblasts (FLS), the expression of lncRNA MIR22HG was increased. Silencing lncRNA MIR22HG reduced the expression of inflammatory and coagulation indicators, while overexpression of lncRNA MIR22HG1 increased the expression of inflammatory and coagulation indicators. Dual luciferase reporter experiments verified that there were binding sites between lncRNA MIR22HG and miR-597-3p, and between miR-597-3p and ARHGEF3, indicating that lncRNA MIR22HG / miR-597-3p / ARHGEF3 could form a ceRNA combination. Rescue experiments demonstrated that miR-597-3p inhibitors and overexpression of ARHGEF3 restored the effects of lncRNA MIR22HG on FLS inflammatory and coagulation indicators. Therefore, the ceRNA combination formed by lncRNA MIR22HG / miR-597-3p / ARHGEF can be used as a new target for the treatment of hypercoagulable state in RA.

[0010] Therefore, the present study suggests that lncRNA MIR22HG can be used as a biological marker and potential therapeutic target for the hypercoagulable state of RA. It was further identified that lncRNA MIR22HG plays a ceRNA role through the miR-597-3p / ARHGEF axis. This discovery improves the understanding of the mechanism of RA progression and provides a new molecular target for the diagnosis and treatment of RA. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The expression of LncRNAMIR22HG in RA patients.

[0012] Figure 2 This is the correlation analysis between LncRNAMIR22HG and clinical indicators of RA patients.

[0013] Figure 3 This is the logistic regression analysis of LncRNAMIR22HG.

[0014] Figure 4 The expression of LncRNAMIR22HG in RA-FLS.

[0015] Figure 5 To investigate the effects of interference and overexpression of lncRNA MIR22HG on coagulation and inflammatory indicators.

[0016] Figure 6 Dual luciferase reporter assay for the lncRNA MIR22HG / miR-597-3p / ARHGEF combination.

[0017] Figure 7 Rescue experiment—miR-597-3p and ARHGEF can reverse the effects of lncRNAMIR22HG on coagulation and inflammatory indicators. DETAILED DESCRIPTION

[0018] Example 1

[0019] Observe the expression of lncRNA MIR22HG in RA patients and its correlation with clinical indicators

[0020] After the project passed the ethics committee review, the applicant systematically studied new diagnostic and therapeutic targets for human RA by drawing peripheral blood from RA patients, extracting PBMCs, and detecting the expression of the long non-coding lncRNA MIR22HG gene by RT-qPCR.

[0021] In this example, 30 blood samples from RA patients with a clear diagnosis and 30 blood samples from healthy controls (HC) were collected, for a total of 60 samples (see Table 1 for sample characteristics).

[0022] Table 1 Clinical characteristics of 30 RA patients

[0023]

[0024] 1. Extraction of peripheral blood mononuclear cells (PBMCs) from RA patients

[0025] Use EDTA anticoagulant tubes to collect 5 mL of venous blood from RA patients, and mix PBS and anticoagulant blood in a 1:1 ratio gently; slowly drip the diluted sample onto the Ficoll-Paque separation solution in a 15 mL centrifuge tube, and centrifuge at 3000 rpm for 35 min; after centrifugation, layers appear, from top to bottom: plasma layer, PBMCs layer, Ficoll-Paque PLUS, red blood cell layer, and use a dropper to gently aspirate the PBMCs in the middle; add 3 times PBS, mix well, centrifuge at 1000 rpm for 10 min, and discard the supernatant; repeat twice, add 1 mL PBS to resuspend the cells, transfer to a 1.5 mL EP tube, and store for later use.

[0026] 2. RT-qPCR detection of lncRNA MIR22HG expression

[0027] RNA was extracted from PBMCs, and RT reaction and fluorescence quantitative PCR reaction were performed. The final analysis method used was Relative Quantification Study, and the calculation method was 2 -△△Ct , the expression of lncRNA MIR22HG gene was analyzed.

[0028] Table 2 lncRNA MIR22HG indicator primers

[0029]

[0030] 3. Collection of clinical laboratory indicators

[0031] The general information of the patients, such as age and course of disease, and the changes of laboratory indicators, such as erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), rheumatoid factor (RF), anti-cyclic guanidine peptide antibody (anti-CCP antibody), and immunoglobulin A (IGA), were collected.

[0032] 4. Correlation Analysis

[0033] Spearman correlation analysis was used to analyze the correlation between the expression of lncRNA MIR22HG and clinical indicators of RA patients

[0034] 5. Analysis of risk factors

[0035] Logistic regression analysis was used to analyze the risk factors affecting the expression of lncRNA MIR22HG in RA patients.

[0036] The experimental results show that:

[0037] Figure 1 The RT-qPCR results showed that the expression of lncRNA MIR22HG was increased in RA patients (A). The ROC curve (B) showed that the area under the AUC curve of lncRNA MIR22HG in RA patients was 93.91%, indicating that lncRNA MIR22HG can be used as a clinical diagnostic marker for RA patients.

[0038] Figure 2 The results of spearman correlation analysis showed that the expression of lncRNA MIR22HG was positively correlated with age, disease course, ESR, CRP, IGA, IGG, IGM, C3, C4, DAS28, VAS, and SAS (AL); while lncRNA MIR22HG was negatively correlated with PF, BP, GH, and SF (MP).

[0039] Figure 3 The results of logistic regression analysis showed that ESR, IGG, C3, DAS28, and PF were risk factors for increased expression of lncRNA MIR22HG.

[0040] Example 2

[0041] A new ceRNA combination lncRNA MIR22HG / miR-597-3p / ARHGEF3 combined regulation of inflammation and its effect on RA hypercoagulable state and inflammatory response

[0042] 1. RA-FLS extraction and culture

[0043] Tissues of the knee joints of patients undergoing RA surgery were taken and soaked in 75% alcohol for about 2 minutes. The tissue blocks were cut into squares with a side length of about 0.1 cm, placed in 2 mL of fibroblast complete medium, infiltrated into tissue blocks, and placed in a 5% CO2 cell culture incubator. After the cells growing around the tissue blocks merged into a sheet, the cells were digested with trypsin. After the cells climbed the slice, 50 μL of primary antibody was taken on a waterproof membrane, and the secondary antibody (secondary antibody: PBS = 1:500) was incubated at room temperature in the dark for 2 hours, then washed with PBS 3×5 minutes / time, stained with DAPI (DAPI: PBS = 1:1000) for 5 minutes, washed with PBS 3×5 minutes / time, and 1 drop of Fluoromount-G was dropped on each slide, and the side with cells was covered to identify the cells as P1 generation cells. The cells were inoculated into a 6-well plate, and the number of cells per well was about 1×10 5 Fresh culture medium containing different concentrations of puromycin (1ug / mL, 2ug / mL, 3ug / mL, 4ug / mL, 5ug / mL, 6ug / mL, 7ug / mL) was added to a 24-well plate with cells to screen the lowest concentration. The result showed that the concentration of puromycin was 1ug / mL. The preparation of the RA-FLS immortalized cell line was completed, and the cells were allowed to fuse with a purity of more than 95% for subsequent experiments.

[0044] 2. Transfection of Overexpression Plasmids and Small Interfering RNA

[0045] The cells to be transfected were collected, inoculated into 6-well plates, added with DMEM medium, and incubated overnight in a cell culture incubator with 5% CO2 and 37°C; A: 4 μg of gene overexpression plasmid or 100 pmol of small interfering RNA was dissolved in 250 μl of serum-free medium; B: 10 μl of transfection reagent (Lipofectamine 2000) was dissolved in 20 μl of serum-free medium, mixed, and allowed to stand at room temperature for 20 min; A and B solutions were mixed, allowed to stand for 20 min, added to a 6-well plate, and the volume was supplemented to 2 ml; cells were collected after incubation at 37°C for 48 h, and RT-qPCR was performed to detect the expression level of the gene after reverse transcription.

[0046] 3. RT-qPCR detection of lncRNA MIR22HG, miR-597-3p, and ARHGEF3 expression

[0047] RNA was extracted from co-cultured cells according to the instructions of TRIzol Reagent (Invitrogen). After reverse transcription, RT-qPCR was performed using PrimeScript RT-PCR Kit (Takara). The operation was performed according to the instructions of the kit (β-actin and U6 were used as internal references). The PCR instrument reaction program was: Stage 1: 95°C 30s, Stage 2 (Cycle: 40): 95°C 15s, 60°C 30s. Primer information for each detection index:

[0048] Table 3 Primer information for each detection index

[0049]

[0050] 4.ELISA method to detect the expression of coagulation indexes PAF, PGI2, IL-6, and IL-10

[0051] The cell supernatant of each group was collected and centrifuged at 1000 rpm for 10 min. The precipitate was discarded and added to the ELISA plate (100 μl per well). The plate was incubated at 37°C for 1.5 h. The expression of IL-6 and IL-10 was detected in strict accordance with the instructions of each kit.

[0052] 5. Dual luciferase reporter assay verifies the targeted binding relationship between lncRNA MIR22HG and miR-597-3p, and between miR-597-3p and ARHGEF3

[0053] The 293T cells and target plasmids for transfection were plated in a 96-well plate until the cell density reached 80%. (1) Solution A: Add 0.16 μg of h-lncRNA MIR22HG-3UTR and h-ARHGEF3-3UTR target plasmids, as well as 5 pmol of hsa-miR-597-3p and Negative control (NC) to 10 μl DMEM medium, mix thoroughly and place at room temperature for 5 min; Solution B: Mix 0.3 μL of transfection reagent (Lip 2000) with 10 μl DMEM medium and place at room temperature for 5 min. (2) Mix solution A (i.e., target plasmid) and solution B (i.e., transfection agent) thoroughly and place at room temperature for 20 min. (3) Add the transfection mixture to the cells, mix thoroughly and place in a 5% CO2 incubator; aspirate the culture medium 6 hours after transfection, wash twice with PBS, centrifuge, aspirate PBS, add fresh DMEM culture medium, and collect the cells 48 hours after transfection in the incubator. Follow the instructions of the dual luciferase reporter assay kit to measure and record the Renilla luciferase value, which is the luciferase activity. (4) Constructed gene sequence:

[0054] Construction of lncRNA MIR22HG-WT gene promoter luciferase reporter gene sequence:

[0055]

[0056] Construction of lncRNA MIR22HG-Mut gene promoter luciferase reporter gene sequence:

[0057]

[0058]

[0059] Construction of ARHGEF3-WT gene promoter luciferase reporter gene sequence:

[0060]

[0061] Construction of ARHGEF3-MUT gene promoter luciferase reporter gene sequence:

[0062]

[0063] hsa-miR-597-3p sequence gene sequence: UGGUUCUCUUGUGGCUCAAGCGU

[0064] The experimental results show that:

[0065] Figure 4The RT-qPCR results in A showed that the expression of lncRNA MIR22HG was increased in RA-FLS; the results in 4B showed that after overexpression of lncRNA MIR22HG, the expression of lncRNA MIR22HG was increased; the results in 4C showed that after interference with lncRNA MIR22HG, the expression of lncRNA MIR22HG was decreased.

[0066] Figure 5 The ELISA results of A showed that overexpression of lncRNA MIR22HG increased the expression of coagulation index PAF, and after interfering with lncRNA MIR22HG, the expression of PAF decreased; 5B. Overexpression of lncRNA MIR22HG decreased the expression of coagulation index PGI2, and after interfering with lncRNA MIR22HG, the expression of PGI2 decreased; 5C. Overexpression of lncRNA MIR22HG increased the expression of proinflammatory factor IL-6, and after interfering with lncRNA MIR22HG, the expression of IL-6 decreased; 5.D. Overexpression of lncRNA MIR22HG decreased the expression of anti-inflammatory factor IL-10, and after interfering with lncRNA MIR22HG, the expression of IL-10 decreased.

[0067] Figure 6 A is a schematic diagram of the binding site of lncRNA MIR22HG and miR-597-3p; 6B. Dual luciferase reporter experiment of lncRNA MIR22HG and miR-597-3p; 6C. Schematic diagram of the binding site of miR-597-3p and ARHGEF; 6D. Dual luciferase reporter experiment of miR-597-3p and ARHGEF.

[0068] Figure 7 The results of A showed that overexpression of lncRNA MIR22HG increased the expression of the coagulation index PAF, and after miR-597-3pmimic or si-ARHGEF, the expression of the coagulation index PAF decreased; B. Overexpression of lncRNA MIR22HG decreased the expression of the coagulation index PGI2, and after miR-597-3p mimic or si-ARHGEF, the expression of the coagulation index PGI2 increased; C. Overexpression of lncRNA MIR22HG increased the expression of the proinflammatory factor IL-6, and after miR-597-3p mimic or si-ARHGEF, the expression of the proinflammatory factor IL-6 decreased; D. Overexpression of lncRNA MIR22HG decreased the expression of the anti-inflammatory factor IL-10, and after miR-597-3p mimic or si-ARHGEF, the expression of the anti-inflammatory factor IL-10 increased.

[0069] The above contents are merely examples and explanations of the concept of the present invention. The technicians in this technical field may make various modifications or additions to the specific embodiments described or replace them in a similar manner. As long as they do not deviate from the concept of the invention or exceed the scope defined by the claims, they should all fall within the protection scope of the present invention.

Claims

1. Application of lncRNA MIR22HG / miR-597-3p / ARHGEF3 combination in rheumatoid arthritis, characterized in that: lncRNAMIR22HG can target ARHGEF3 by competitively binding to miR-597-3p, promoting the hypercoagulable state and inflammatory response in RA.

2. Use of a preparation for silencing lncRNA MIR22HG in preparing a preparation for treating RA, characterized in that: Silencing the lncRNA MIR22HG can target ARHGEF3 by competitively binding to miR-597-3p, thereby reducing the inflammatory response and improving the hypercoagulable state of RA.

Images