Chitin binding protein for detecting fungi, application of chitin binding protein and affinity molecule detection method for fungi

Abstract

The invention relates to the technical field of fungus detection, in particular to chitin binding protein for detecting fungi, application of the chitin binding protein and an affinity molecule detection method of the fungi. The invention provides a chitin binding protein used for detecting fungi. The chitin binding protein comprises ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1 or ScCBP-1, and the chitin binding protein can be used for detecting fungi. The chitin binding protein can be applied to fungus detection. The invention also provides an affinity molecule detection method of fungi, which is characterized in that the Candida albicans can be rapidly, accurately and quantitatively detected by combining the chitin affinity protein with RPA-CRISPR / Cas12a. The whole reaction can be completed within 120 min, and the detection sensitivity to candida albicans reaches 101 CFU / ml.

Description

Technical Field

[0001] The invention relates to the technical field of fungus detection, in particular to a chitin binding protein for detecting fungi and an application thereof, and a method for detecting fungi with affinity molecules. Background Art

[0002] To date, breakthroughs in the use of antibiotics, cancer treatment, transplant surgery, and invasive treatments, as well as the prevalence of HIV and SARS-CoV-2, have led to a substantial increase in the number of immunocompromised individuals. As a result, invasive fungal infections (IFIs) have transformed from a rare disease to a common cause of morbidity and mortality. Candida, Aspergillus, Cryptococcus, Pneumocystis, and Mucor are the main pathogens causing IFIs, among which Candida albicans is one of the common clinical pathogens. Existing technology has three main drug options for the treatment of invasive fungal infections: azoles, echinocandins, and polyenes, but all have the disadvantage of potential toxicity; the nonspecific symptoms of IFIs and the lack of timely diagnostic technology often lead to missed diagnosis, misdiagnosis, and treatment failure; at the same time, there is currently a lack of timely detection methods to timely evaluate the efficacy of antifungal treatment in patients, which increases the complexity of managing these infections.

[0003] The cell wall of fungi is composed of glycoproteins, glucans and chitin. Chitin is a polysaccharide synthesized by the chitin synthase (CHS) family enzyme system and covalently bound to glucans to form a complex polysaccharide network, which forms a strong structure and elastic basis for the fungal cell wall and forms an extracellular matrix to escape recognition and immune capture by phagocytes. In addition, chitin and CHS genes have not been found in mammals, plants and bacteria. Only rhizobia (α-proteobacteria) encode NodC proteins that have homology with chitin synthase. Therefore, chitin and CHS are considered to be specific targets for fungal diagnosis and antifungal treatment. Traditional fungal detection methods, including fungal culture, morphological detection, antigen and antibody detection, are widely used in clinical practice, but culture-based methods have problems such as long turnover cycle and low sensitivity. The sensitivity of blood culture for invasive candidiasis (IC) is about 50% to 90%. In an autopsy-confirmed IC patient, the sensitivity of antemortem blood culture was 21% to 71%; positive blood culture for invasive aspergillosis (IA) was rare, with a sensitivity of only 1% to 5%; the average time for positive blood culture for Candida was 2 to 3 days, with a maximum of 7 to 8 days. Morphological testing and antigen-antibody testing are invasive, subjective, and have low sensitivity and specificity. Molecular techniques such as PCR and MALDI-TOF mass spectrometry provide another effective option for identifying fungal pathogens. However, some disadvantages limit their clinical application: First, PCR testing requires highly pure nucleic acid samples. Commercial nucleic acid extraction kits use solid phase extraction columns, which may have low adsorption efficiency and insufficient elution leading to DNA loss; in addition, the kits are less efficient in blocking interference from the human genome. Second, both PCR and MALDI-TOF mass spectrometry methods require expensive equipment and skilled technicians, which limits their applicability in field or clinical settings. In contrast, isothermal amplification techniques, including loop-mediated amplification (LAMP) and recombinase polymerase amplification (RPA), allow nucleic acids to be amplified at a constant temperature, making them very suitable for low-resource environment applications and field diagnosis. Compared with LAMP, RPA simplifies the design of detection primers, and the reduction in the number of primers reduces the risk of primer interactions or cross-reactions. Nucleic acid amplification can be completed by incubating at 37-42°C for 10-20 minutes using a simple constant temperature device. Given these advantages, RPA has been widely used in the detection of a variety of pathogens. In addition, RPA is combined with the clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) system to enhance the sensitivity, specificity, programmability and visualization of diagnostic technology. Guided by CRISPR RNA (crRNA), the Cas12a protein specifically recognizes the target sequence protospacer adjacent motif (PAM) TTTN site and binds to double-stranded DNA.Subsequently, the cis-cleavage activity and trans-cleavage activity of the Cas12a enzyme are activated, and the target dsDNA is not specifically cleaved in the ssDNA reporter probe in the system. The fluorescence signal excited by this can be observed by naked eye under blue light or ultraviolet light, or the fluorescence intensity can be quantified in real time by a fluorescence detector. However, the combination of RPA and CRISPR / Cas12a faces challenges in practical applications, including interference between RPA and CRISPR / Cas12a systems; in addition, the high amplification efficiency of RPA introduces the potential risk of aerosol contamination, especially in the opening operation procedure. Current detection methods only focus on specific components of fungi such as fungal proteins, polysaccharides or nucleic acids, rather than considering a structurally complete fungal spore with infectious activity, and therefore cannot accurately reflect the presence of infectious fungi. Summary of the invention

[0004] The purpose of the present invention is to provide a chitin binding protein for detecting fungi and an application thereof. The chitin binding protein can be combined with a rapid amplification and one-pot detection method to detect fungi quickly and accurately.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a chitin-binding protein for detecting fungi, wherein the chitin-binding protein comprises ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1 or ScCBP-1;

[0007] The amino acid sequence of ChBD2 is shown in SEQ ID NO: 1, and the nucleotide sequence encoding the amino acid of ChBD2 is shown in SEQ ID NO: 2;

[0008] The amino acid sequence of ChBD3 is shown in SEQ ID NO: 3, and the nucleotide sequence encoding the amino acid of ChBD3 is shown in SEQ ID NO: 4;

[0009] The amino acid sequence of EfCBP-1 is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the amino acid of EfCBP-1 is shown in SEQ ID NO: 6;

[0010] The amino acid sequence of PfCBP-A is shown in SEQ ID NO: 7, and the nucleotide sequence encoding the amino acid of PfCBP-A is shown in SEQ ID NO: 8;

[0011] The amino acid sequence of PfCBP-B is shown in SEQ ID NO: 9, and the nucleotide sequence encoding the amino acid of PfCBP-B is shown in SEQ ID NO: 10;

[0012] The amino acid sequence of BcCBP-1 is shown in SEQ ID NO: 11, and the nucleotide sequence encoding the amino acid of BcCBP-1 is shown in SEQ ID NO: 12;

[0013] The amino acid sequence of the ScCBP-1 is shown in SEQ ID NO: 13, and the nucleotide sequence encoding the amino acids of ScCBP-1 is shown in SEQ ID NO: 14.

[0014] The invention also provides application of the chitin-binding protein in detecting fungi.

[0015] The present invention also provides a method for detecting fungal affinity molecules, comprising the following steps:

[0016] (1) mixing chitin binding protein with magnetic beads and incubating them to obtain MB-CBP complex;

[0017] (2) mixing and incubating the MB-CBP complex and the test sample to obtain a mixture;

[0018] (3) extracting genomic DNA from the mixture;

[0019] (4) Rapid amplification and one-pot detection of genomic DNA;

[0020] The chitin binding protein is the chitin binding protein.

[0021] Preferably, in step (1), the temperature of the mixed incubation is 20 to 30° C.; the time of the mixed incubation is 0.5 to 2.0 h;

[0022] The volume mass ratio of the chitin binding protein and the magnetic beads for mixed incubation is 0.002-0.04:1.

[0023] Preferably, in step (2), the test sample is blood and / or alveolar lavage fluid.

[0024] Preferably, in step (2), the volume ratio of the MB-CBP complex to the test sample is 0.04-0.06:0.5-1.5;

[0025] The temperature of the mixed incubation in step (2) is 20 to 30° C. and the time is 20 to 35 minutes.

[0026] Preferably, in step (3), the method for extracting genomic DNA from the mixture is a silicon hydroxy magnetic bead method.

[0027] Preferably, in step (4), the method for rapid amplification and one-pot detection of genomic DNA is RPA-CRISPR / Cas12a;

[0028] The specific steps are as follows:

[0029] 1) Perform RPA amplification on genomic DNA and collect the amplified RPA system;

[0030] 2) The amplified RPA system and CRISPR / Cas12a system are mixed and incubated for 5 to 20 minutes, and then tested to determine whether there are fungi based on the strength of the fluorescent signal.

[0031] Preferably, the CRISPR / Cas12a system comprises the following components: 10×NE buffer 2.1, crRNA, Cas12a, oligonucleotide probe;

[0032] The amount of 10×NE buffer 2.1 added is 0.1-0.6 μl;

[0033] The amount of crRNA added is 1 to 4 μl, and the initial concentration of crRNA is 1 to 3 μmol / L.

[0034] The added amount of Cas12a is 0.10-1.0 μl; the initial concentration of Cas12a is 4-5 μmol / L;

[0035] The amount of the oligonucleotide probe added is 0.5-1.5 μl, and the initial concentration of the oligonucleotide probe is 1-15 μmol / L;

[0036] The nucleotide sequence of the crRNA is shown in SEQ ID NO: 15;

[0037] The nucleotide sequence of Cas12a is shown in SEQ ID NO: 16;

[0038] The nucleotide sequence of the oligonucleotide probe is 5′-FAM-TTATTATT-BHQ1-3′.

[0039] Preferably, the temperature of the mixed incubation is 36-44°C.

[0040] Beneficial effects of the present invention:

[0041] The present invention designs a novel affinity molecule diagnostic method, which combines chitin affinity magnetic separation with RPA-CRISPR / Cas12a to quickly and accurately quantitatively detect Candida albicans. Chitin binding proteins (CBPs) are prepared and their binding affinity to chitin is evaluated; then, magnetic beads coupled to CBP are used to efficiently capture fungi from whole blood or bronchoalveolar lavage fluid samples; and fungal genomic DNA is further extracted and purified using silicon hydroxy magnetic beads, and nucleic acid rapid amplification and one-pot detection are performed using the RPA-CRISPR / Cas12a system. The entire reaction can be completed within 120 minutes, and the detection sensitivity of Candida albicans reaches 10 1 CFU / ml. This diagnostic platform is expected to provide low-cost, high-efficiency, rapid, accurate and immediate diagnosis for invasive fungal infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The figures are the cell wall structure of fungi, special components of fungi, chitin binding protein structure and the process of affinity molecule detection method of fungi, wherein Figure a is the cell wall structure of fungi, Figure b is the special components of fungi, Figure c is the structure of chitin binding protein, and Figures d and e are the process of affinity molecule detection method of fungi;

[0043] Figure 2 This is the electrophoresis diagram of the purified SgCBP-1 protein;

[0044] Figure 3 The electrophoretic diagram of the purification of chitin-binding protein and the affinity result of the chitin-binding protein binding to chitin, wherein a is the electrophoretic diagram of the purification of chitin-binding protein, and b is the affinity result of the chitin-binding protein binding to chitin;

[0045] Figure 4 The results of the evaluation coupling of 15% SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining in Example 3, wherein Figure a is the electrophoresis result of the magnetic bead-protein complex after 7 kinds of proteins were coupled to magnetic beads, and Figure b is the electrophoresis result of the supernatant corresponding to the 7 kinds of protein coupling;

[0046] Figure 5Figure 1 is the detection result of MB-CBP complex, wherein Figure a is the change of protein concentration detected by BCA method before and after carboxyl magnetic beads are coupled to chitin binding protein, Figure b is the particle size before and after carboxyl magnetic beads are coupled to protein by particle size analyzer, Figure c is the electrophoresis result of magnetic bead-protein complex and corresponding supernatant after different amounts (10μg, 20μg, 30μg) of protein PfCBP-A are coupled to 1mg magnetic beads, and the amount of protein required to saturate 1mg magnetic beads is detected, Figure d is the electrophoresis result of magnetic bead-protein complex after 7 proteins are coupled to magnetic beads in an unsaturated state, Figure e is the absorbance value of the supernatant of DNA in Example 4 at 260nm, Figure f is the purity detection result of genomic DNA of Candida albicans captured by MB-CBP, Figure g is the detection result of the genomic DNA content of Candida albicans captured by MB-CBP, and Figure h is the detection result of genomic DNA in A in Example 5. 260nm The absorbance value at

[0047] Figure 6 The clinical validation results of the affinity molecule detection method, where Figure a is the stability and specificity test results, Figure b is the fluorescence signal result observed by naked eyes, Figure c is the real-time fluorescence monitoring result of blood, Figure d is the real-time fluorescence monitoring result of BALF, Figure e is the positive sample test result, Figure f is the negative sample test result, and Figure g is the fungal fluorescence staining microscope test result;

[0048] Figure 7 Figure 1 is the result of qPCR test, where Figure a is the result of AMS-qPCR test on simulated blood and BALF samples, and Figure b is the result of qPCR test on simulated clinical samples without affinity magnetic bead capture and direct extraction of nucleic acid. DETAILED DESCRIPTION

[0049] The present invention provides a chitin-binding protein for detecting fungi, wherein the chitin-binding protein comprises ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1 or ScCBP-1;

[0050] The amino acid sequence of ChBD2 is shown in SEQ ID NO: 1, and the nucleotide sequence encoding the amino acid of ChBD2 is shown in SEQ ID NO: 2;

[0051] The amino acid sequence of ChBD3 is shown in SEQ ID NO: 3, and the nucleotide sequence encoding the amino acid of ChBD3 is shown in SEQ ID NO: 4;

[0052] The amino acid sequence of EfCBP-1 is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the amino acid of EfCBP-1 is shown in SEQ ID NO: 6;

[0053] The amino acid sequence of PfCBP-A is shown in SEQ ID NO: 7, and the nucleotide sequence encoding the amino acid of PfCBP-A is shown in SEQ ID NO: 8;

[0054] The amino acid sequence of PfCBP-B is shown in SEQ ID NO: 9, and the nucleotide sequence encoding the amino acid of PfCBP-B is shown in SEQ ID NO: 10;

[0055] The amino acid sequence of BcCBP-1 is shown in SEQ ID NO: 11, and the nucleotide sequence encoding the amino acid of BcCBP-1 is shown in SEQ ID NO: 12;

[0056] The amino acid sequence of the ScCBP-1 is shown in SEQ ID NO: 13, and the nucleotide sequence encoding the amino acids of ScCBP-1 is shown in SEQ ID NO: 14.

[0057] The invention also provides application of the chitin-binding protein in detecting fungi.

[0058] In the present invention, in view of the cell wall structure of fungi and the special components of fungi, the unique component chitin was selected as the target for capturing fungi. Chitin binding protein (CBP) belongs to the carbohydrate binding module family, and its crystal structure shows that its surface hydrophilic residues and aromatic residues form a groove with strong negative charge, which interacts with chitin.

[0059] The present invention also provides a method for detecting fungal affinity molecules, comprising the following steps:

[0060] (1) mixing chitin binding protein with magnetic beads and incubating them to obtain MB-CBP complex;

[0061] (2) mixing and incubating the MB-CBP complex and the test sample to obtain a mixture;

[0062] (3) extracting genomic DNA from the mixture;

[0063] (4) Rapid amplification and one-pot detection of genomic DNA;

[0064] The chitin binding protein is the chitin binding protein.

[0065] In the present invention, in step (1), the temperature of the mixed incubation is 20 to 30° C., preferably 25° C.; the time of the mixed incubation is 0.5 to 2 h, preferably 1.25 h;

[0066] The volume mass ratio of the chitin binding protein and the magnetic beads for mixed incubation is 0.002-0.04:1, preferably 0.021:1.

[0067] In the present invention, in step (2), the test sample is blood and / or alveolar lavage fluid.

[0068] In the present invention, in step (2), the volume ratio of the MB-CBP complex and the test sample is 0.04-0.06:0.5-1.5, preferably 0.05:1.0;

[0069] The temperature of the mixed incubation in step (2) is 20-30°C and the time is 20-35 min, preferably 25°C and 27.5 min.

[0070] In the present invention, in step (3), the method for extracting genomic DNA from the mixture is a silanol magnetic bead method.

[0071] In the present invention, in step (4), the method for rapid amplification and one-pot detection of genomic DNA is RPA-CRISPR / Cas12a;

[0072] The specific steps are as follows:

[0073] 1) Perform RPA amplification on genomic DNA and collect the amplified RPA system;

[0074] 2) The amplified RPA system and CRISPR / Cas12a system are mixed and incubated for 5 to 20 minutes, and then tested to determine whether there are fungi based on the strength of the fluorescent signal.

[0075] In the present invention, the incubation time is preferably 12.5 min;

[0076] In the present invention, the CRISPR / Cas12a system includes the following components: 10×NE buffer2.1, crRNA, Cas12a, oligonucleotide probe;

[0077] The amount of 10×NE buffer 2.1 added is 0.1-0.6 μl, preferably 0.35 μl;

[0078] The amount of crRNA added is 1 to 4 μl, preferably 2.5 μl, and the initial concentration of crRNA is 1 to 3 μmol / L, preferably 1.5 μmol / L;

[0079] The amount of Cas12a added is 0.10-1.0 μl, preferably 0.55 μl, and the initial concentration of Cas12a is 4-5 μmol / L, preferably 4.5 μmol / L;

[0080] The amount of the oligonucleotide probe added is 0.10-1.5 μl, preferably 0.8 μl, and the initial concentration of the oligonucleotide probe is 1-15 μmol / L, preferably 8 μmol / L;

[0081] The nucleotide sequence of the crRNA is shown in SEQ ID NO: 15: UAAUUUCUACUAAGUGUAGAUCAUAGAUUAUAAAUGGCAUGG;

[0082]

[0083] The nucleotide sequence of the oligonucleotide probe is 5′-FAM-TTATTATT-BHQ1-3′.

[0084] In the present invention, the temperature of the mixed incubation is 36-44°C, preferably 40°C.

[0085] In the present invention, during the CRISPR / Cas12a reaction process, a polytetrafluoroethylene capillary with an inner diameter of 1 mm needs to be fixed to the inside of an EP tube or an eight-tube cap to form a tube-in-tube structure, and the RPA system is added to the bottom of the tube during the reaction, and the CRISPR / Cas12a reaction system is placed in a capillary connected to the tube cap; after the RPA amplification reaction is completed by incubation at 42°C for 20 minutes, the CRISPR / Cas12a system and the RPA system are mixed at the bottom of the tube by instantaneous centrifugation to activate the cis-cleavage and trans-cleavage activities of the Cas12a-crRNA complex; the tube-in-tube structure reduces the mutual interference between the two reaction systems; the operation is convenient and no cover opening is required during the reaction, thereby avoiding the risk of aerosol contamination.

[0086] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0087] Example 1

[0088] In the present invention, in view of the cell wall structure of Candida albicans ( Figure 1 a) and chitin, a special component of fungi ( Figure 1 b), the unique component chitin was selected as the target for capturing fungi. Chitin binding protein (CBP) ( Figure 1 c) belongs to the carbohydrate binding module family, and its crystal structure shows that its surface hydrophilic and aromatic residues form a strongly negatively charged groove that interacts with chitin.

[0089] A method for detecting Candida albicans by affinity molecules comprises the following steps (eg Figure 1 d, 1e):

[0090] (1) 1 mg of carboxyl magnetic beads were washed three times with 500 μl of 15 mmol / L MES buffer, and then 20 μl of NHS (0.015 mol / L, pH = 5.5) and 20 μl of EDC (10 mg / ml) were added in sequence, vortexed for 30 s, and placed in a four-dimensional mixing device for incubation at 25°C for 30 min; the beads were separated with a magnetic stand and the supernatant was discarded, and the beads were washed twice with MES and resuspended to 10 mg / ml to obtain activated magnetic beads;

[0091] 20 μg of chitin binding protein and 1 mg of activated magnetic beads (1 μm particle size, 10 mg / ml) were placed in a four-dimensional mixing device and incubated at 25°C for 2.0 h to obtain MB-CBP complex;

[0092] The remaining carboxyl reactive esters on the magnetic beads were blocked with carboxyl magnetic bead blocking solution at 25°C for 1 h, and the MB-CBP complex was washed twice with 200 μl 15 mmol / L PBST pH 7.4 and resuspended to 10 mg / ml.

[0093] (2) 50 μl of MB-CBP complex and 1 ml of test sample were mixed and incubated at 25°C for 30 min to obtain a mixture;

[0094] (3) taking the test sample, centrifuging it at 12000 rpm for 10 min and gently discarding most of the supernatant and blood cells, leaving 200 μl of the precipitate, adding the MB-CBP complex and placing it in a four-dimensional mixing device for incubation at 25°C for 30 min to obtain a mixture;

[0095] The mixture was gently washed three times with 15mmol / L PBS, and the supernatant was discarded after magnetic separation to obtain precipitate 1;

[0096] Add 450 μl of recombinant cell fungal lysis buffer (1 mol / L guanidine hydrochloride, 37.5 ml 75% ethanol, 1 ml Triton-X-100, 5 mmol / L Tris-HCl, 5 mmol / L EDTA, 0.1 mg / ml proteinase K, pH 8.0) to the precipitate, lyse at 55°C for 5 min, then add 100 μl 50 mg / ml silicon hydroxy magnetic beads and 2 μl 10 mg / ml RNaseA, incubate at 25°C for 10 min, separate with a magnetic stand and discard the supernatant to obtain precipitate 2;

[0097] Add 500 μl of washing buffer 1 (1 mol / L guanidine hydrochloride, 37.5 ml 75% ethanol, 10 mmol / L Tris-HCl, 10 mmol / LEDTA, pH 8.0) to the precipitate 2 and wash twice; add 700 μl of washing buffer 2 (80% ethanol) and wash once; add 50 μl of DEPC water and incubate at 55°C for 5 min to elute the genomic DNA, separate and collect the supernatant containing DNA using a magnetic stand to obtain the genomic DNA;

[0098] (4) Add 1.25 μl of 280 mmol / L magnesium acetate initiator to the RPA system, mix well, and incubate at 42° C. for 20 min to obtain the amplified RPA system;

[0099] The amplification system was 25 μl of enzyme mixture, 0.5 μl of 30 μmol / L forward primer and reverse primer (as shown in Table 2), 1 μl of fungal genomic DNA, 15 μl of 2×RPAbuffer, and the mixture was made up to 28.5 μl with distilled water, mixed and centrifuged briefly (6000 rpm, 5 s);

[0100] Prepare RPA enzyme mixture: take out the protease from -80℃ and slowly thaw at 4℃, determine the protease concentration by BCA method, and prepare the enzyme mixture according to the 25μl reaction system; the final concentration of recombinant enzyme is 30ng / μl, the final concentration of recombinant enzyme loading factor is 50ng / μl, the final concentration of polymerase is 50ng / μl, and the final concentration of single-stranded binding protein is 50ng / μl;

[0101] (5) Prepare the CRISPR / Cas12a system: 10×NE buffer 2.10.5 μl, 3 μl 2.5 μmol / L crRNA (nucleotide sequence as shown in SEQ ID NO: 15), 0.75 μl 5 μmol / L Cas12a (nucleotide sequence as shown in SEQ ID NO: 16), 1 μl 15 μmmol / L oligonucleotide probe (nucleotide sequence is 5′-FAM-TTATTATT-BHQ1-3′), and add the system to the capillary of the reaction tube cover;

[0102] The amplified RPA system and CRISPR / Cas12a system were mixed and incubated at 42°C for 20 min, and then placed in a fluorescence detector to monitor the fluorescence intensity generated by the reaction system in real time, and the presence of Candida albicans was determined based on the strength of the fluorescence signal.

[0103] Example 2 Identification and screening of chitin binding protein affinity

[0104] Plasmid construction

[0105] (1) Preparation of target fragments: The amino acid sequences of the target proteins (ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1, ScCBP-1, ScCBP-2) were found on NCBI and converted into nucleotide sequences (the amino acid sequences and nucleotide sequences corresponding to the target proteins are shown in Table 1), and codon optimization was performed. The corresponding primers were designed (the primers are shown in Table 2). The bacterial cultures of Pyrococcus kodakar, Enterococcus faecalis, Trichococcus, Bacillus cereus and Streptomyces coli were used as templates for PCR amplification to obtain purified target fragments. The target fragments were amplified using a PCR instrument to obtain amplified products. The amplification system (20 μl) was 10 μl of 2× Taq DNA poLymerase, 0.5 μl of 10 μM forward primer and reverse primer, 1 μl of bacterial culture and 8 μl of enzyme-free water. The amplification program was 95°C for 2 min, 55°C for 30 s, 72°C for 2 min, and 34 cycles.

[0106] Table 1 Amino acid sequence and nucleotide sequence corresponding to each target protein

[0107]

[0108]

[0109]

[0110]

[0111]

[0112] Table 2 Primer sequences

[0113]

[0114]

[0115] (2) Enzyme digestion of target fragment and vector: The amplified product (target fragment) in step (1) is subjected to agarose gel (1%) electrophoresis and gel recovery and purification; the enzymatic digestion is carried out using nucleases BamH1 and Xho1 at 37°C for 2h to obtain an enzyme digestion product; wherein the enzyme digestion system (20μl) is: BamH11μl, Xho11μl, buffer2μl, target fragment 5.5μl (1μg), enzyme-free water 10.5μl; the enzyme digestion product is purified by ethanol precipitation to obtain a purified enzyme digestion product;

[0116] (3) The purified digested product and T4 DNA ligase were connected at 16°C overnight to obtain a ligation product; the ligation system (20 μl) was: 1 μl (40 ng) of pET-28a(+) cloning vector, 4.2 μl (100 ng) of purified digested product, 0.8 μl of T4 DNA ligase, 2 μl of T4 buffer, and 12 μl of enzyme-free water;

[0117] (4) Screening of positive clones: The ligation product was transferred into Top10 competent cells and cultured at 37°C for 16 h in LB medium with kanamycin resistance (Kan 100 mg / ml, added to LB medium at a dilution of 1:2000). Single colonies were selected for sequencing verification to obtain the bacterial solution with successful sequencing.

[0118] Prokaryotic expression of target protein

[0119] (1) Add 50 μl of the successfully sequenced bacterial solution to 5 ml of LB culture medium (add 2.5 μl of 100 mg / ml kanamycin sulfate), culture at 37°C, 200 rpm for 16 h, and follow the instructions of the plasmid extraction kit (Omega Biotechnology) to obtain the extracted plasmid;

[0120] (2) Add 20 ng of the extracted plasmid to 100 μl of BL21 / Rosseta competent cells, let stand for 10 min, add to an electroporation cup (ice bath), add 200 μl of LB culture medium (without antibiotics) to resuspend the cells, pipette the cell suspension into a 1.5 ml EP tube, and culture at 37°C, 200 rpm for 45 min to obtain a resuscitated cell suspension; pipette 200 μl of the cell suspension onto a kanamycin sulfate-resistant solid culture medium, and culture at 37°C for 12 h to obtain colonies;

[0121] (3) Expansion of bacteria: Pick a single colony from the solid culture medium with kanamycin sulfate resistance in step (2) and place it in 3 ml of LB culture medium (with kanamycin sulfate resistance) and culture it at 37°C and 220 rpm for 6 h. 600 When the OD reaches 0.6, take 2 ml of the bacterial solution and add it to 200 ml of LB culture medium (kanamycin sulfate resistance) and continue to culture in a 37°C constant temperature shaker until the OD 600 When the pH was 0.5, 40 μl of 1 mol / L inducer IPTG was added, and the culture was continued at 16°C for 18 h to obtain a bacterial solution expressing the target protein.

[0122] Purification of target protein

[0123] (1) The bacterial solution expressing the target protein was centrifuged at 4000 rpm for 30 min at 4°C to collect the bacteria expressing the target protein, and 100 ml of Binding Buffer was added to resuspend the bacteria. The bacteria were disrupted by ultrasonication in an ice water bath (ultrasonication for 3 s, stop for 7 s, 200 cycles); after the disruption of the bacteria, the supernatant was collected by centrifugation at 12000 rpm and 4°C for 30 min, and filtered with a 0.22 μm sterilizing filter to obtain the protein supernatant;

[0124] Ni 2+ -His affinity chromatography: Ni 2+ After the agarose gel column is rinsed with Binding Buffer, the protein supernatant described in step (1) is passed through the column (1 ml / min). After completion, the column is buffered with Binding Buffer, and then a linear gradient of 0 to 100% Elution Buffer is set to elute the impurities. When the ultraviolet absorption peak (280 nm) reaches a peak value, the target protein is collected; samples of the protein supernatant, the washing solution, and the elution solution are subjected to SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining. The results are as follows: Figure 2 and Figure 3 As shown in a;

[0125] (2) Target protein concentration: Use a concentrating centrifuge tube to concentrate the target protein in step (2) to 2 ml, then add 10 ml of Binding Buffer and mix well, and continue to concentrate to 2 ml. Repeat 3 times and finally concentrate to 1 ml.

[0126] (3) Determination of concentration: glycerol is added to the concentrated protein to make the final concentration 10%. The protein concentration is determined by the BCA method. The protein is then labeled with a date and stored in aliquots.

[0127] Figure 2 This is the electrophoresis diagram of gCBP-1 protein purification. Figure 2 It can be seen that there are obvious target protein bands in the lysis solution, but there is no target protein in the supernatant channel after centrifugation. The concentration of the target protein collected in the end is extremely low (<0.3mg / ml), which is considered to be an insoluble inclusion body protein. The purified target protein cannot meet the needs of subsequent experiments, so it is excluded and no longer included in the screening range.

[0128] Isothermal titration (ITC) method to detect the binding affinity of chitin binding protein to chitin

[0129] At 25°C, ITC experiments were performed using a MicroCal PEAQ-ITC (Malvern) instrument according to the ITC instruction manual. Seven proteins (ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1, ScCBP-1) and chitin were dissolved in ultrafiltration buffer. For each ITC titration, a chitin solution with a concentration of 2.0 mmol / L was titrated into a cell pool containing 0.1 mmol / L chitin-binding protein. The titration was injected 13 times, with 0.4 μl injected for the first time and 3 μl injected for each of the remaining times. The data was analyzed using PEAQ-ITC analysis software, the first drop signal was removed, and the one set of sites fitting model was used for data analysis and fitting. The data results are shown in the figure. Figure 3 As shown in b.

[0130] from Figure 2 It can be seen that these seven proteins have a moderate affinity for chitin, and the equilibrium constant K D =14.9~343μmol / L.

[0131] Example 3 Coupling of MB-CBP complex

[0132] The seven chitin-binding proteins (ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1, and ScCBP-1) screened in Example 2 were selected, and seven MB-CBP complexes (MB-ChBD2, MB-ChBD3, MB-EfCBP-1, MB-PfCBP-A, MB-PfCBP-B, MB-BcCBP-1, and MB-ScCBP-1) were prepared with reference to step (1) of Example 1.

[0133] The seven MB-CBPs and their corresponding protein supernatants were subjected to 15% SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining to evaluate the coupling effect. Uncoupled protein was used as a positive control. The results are shown in Figure 4 a and 4b, wherein Figure a shows the verification of the magnetic bead-protein complex after magnetic bead coupling with protein by electrophoresis, with uncoupled protein used as a positive control, and Figure b shows the electrophoresis results of the corresponding supernatant after 7 kinds of proteins were coupled with magnetic beads.

[0134] The results showed that for the same mass of activated carboxyl magnetic beads, large molecular CBP was more likely to saturate the activated carboxyl magnetic beads than small molecular CBP. Therefore, the CBP with the largest molecular weight, namely PfCBP-A, was selected to determine the saturation amount of 1 mg carboxyl magnetic beads.

[0135] Effective particle size analysis

[0136] (1) Sample preparation: 10 μl of activated carboxyl magnetic beads and the 10 mg / ml MB-PfCBP-A described above were taken, and the supernatant was separated by a magnetic rack. Then, 3 ml of pure water containing 1% Triton-X100 was added to resuspend the beads, and then ultrasonicated for 15 min until the solution was generally clear and transparent by naked eye observation, and the beads exhibited Brownian motion in the solvent, thereby obtaining the sample to be tested, and untreated carboxyl magnetic beads were used as a control;

[0137] (2) Using NanoBrook 90PLUS PALS particle size analyzer, set the detection parameters as follows: select Angle, Nanoparticles 10nm-250nm, temperature 10℃, single measurement time 2min, equilibrium time 3min, accept dust removal, and then load the sample to be tested into the sample cell for measurement. The measurement results are as follows Figure 5 As shown in a~5b.

[0138] The results showed that compared with the control, the MB-PfCBP-A complex 562nm The absorption peak at Figure 5 a), The effective particle size analysis showed that the average effective diameter of MB-PfCBP-A was twice that of the control ( Figure 5 b), demonstrating that PfCBP-A was successfully coupled to activated carboxyl magnetic beads.

[0139] Saturation concentration test

[0140] (1) Take 0.2 μg of the coupled complex (PfCBP-A) and separate the supernatant with a magnetic stand, then add 20 μl of PBS solution to resuspend it to obtain the sample to be tested, and use untreated carboxyl magnetic beads as a control;

[0141] (2) Add 10 μl of the test sample to each well of the 96-well plate, then add 200 μl of the reaction solution (solution A: solution B = 50:1), and incubate at 37°C in the dark for 25 min;

[0142] (3) Use a multifunctional enzyme marker to detect the A 562nm The absorbance value under Figure 5 As shown in c.

[0143] from Figure 5 As can be seen from c, the coupled carboxyl magnetic beads all have corresponding protein bands after electrophoresis, and the protein concentration in the separated supernatant gradually increases. The above results further prove that the carboxyl magnetic beads and proteins are successfully coupled and the minimum protein amount that can saturate 1 mg of carboxyl magnetic beads is 20 μg.

[0144] Coupling result detection

[0145] In order to make the magnetic beads coupled with all seven proteins in an unsaturated state, 1 mg of activated carboxyl magnetic beads were coupled with 15 μg of CBP to obtain MB-CBP. The coupling effect was then evaluated by SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining, and the corresponding CBP was used as a positive control. The results are shown in Figure 5 As shown in d.

[0146] The results showed that all seven MB-CBP channels had corresponding bands, indicating that all seven proteins were successfully coupled.

[0147] Example 4 Detection of the Capture Capability of MB-CBP Complex to Candida albicans

[0148] (1) Fungal culture: Take 5 μl of Candida albicans preservation solution (preserved in the Key Laboratory of Infectious Diseases of Chongqing Medical University) and inoculate it in four zones on an SDA culture plate. Incubate at 37°C for 48 h to grow a single colony. Pick a single colony and place it in 3 ml of SDA liquid culture medium. Place it at 37°C and shake at 220 rpm for 8 h until the OD 600 When it reaches 0.6, a fungal suspension is obtained;

[0149] (2) Preparation of simulated clinical samples: The fungal suspension was centrifuged at 12,000 rpm for 5 min to collect fungal cells, and the fungi were added to blood and bronchoalveolar lavage fluid samples (collected by the Laboratory Department of the First People's Hospital Affiliated to Chongqing Medical University) to prepare simulated clinical samples;

[0150] (3) MB-CBP complex capture and extraction of Candida albicans: 1 ml of the simulated sample was centrifuged at 12000 rpm for 10 min and most of the supernatant and blood cells were gently discarded, leaving 200 μl of the precipitate, adding 50 μl of MB-CBP complex and placing it in a four-dimensional mixing device and incubating at 25°C for 30 min to form MB-CBP-C.albicans complex;

[0151] (4) The MB-CBP-C.albicans complex was gently washed three times with 15 mmol / L PBS, separated by a magnetic rack, and the supernatant was discarded to obtain precipitate 1;

[0152] (5) Add 450 μl of recombinant cell fungal lysis buffer (1 mol / L guanidine hydrochloride, 37.5 ml medical ethanol, 1 ml Triton-X-100, 5 mmol / L Tris-HCL, 5 mmol / L EDTA, 0.1 mg / ml proteinase K, pH 8.0) to precipitate 1, lyse at 55°C for 5 min, then add 100 μl of 50 mg / ml silicon hydroxy magnetic beads and 5 μl of 10 mg / ml RNaseA, incubate at 25°C for 10 min, separate with a magnetic stand and discard the supernatant to obtain precipitate 2; add 500 μl of washing buffer 1 (1 mol / L guanidine hydrochloride, 37.5 ml medical ethanol, 1 ml Triton-X-100, 10 mmol / L Tris-HCl, 10 mmol / L EDTA, pH 8.0) Wash twice; Add 700 μl of washing buffer 2 (80% ethanol) and wash once; Add 50 μl of DEPC water and incubate at 55°C for 5 min to elute the genomic DNA, separate and collect the supernatant containing DNA using a magnetic stand. Detect the absorbance value of the DNA supernatant at 260 nm and quantify the result. Figure 5 As shown in e;

[0153] (6) qPCR was used to further evaluate the purity and content of the genomic DNA of Candida albicans captured by each MB-CBP. The results are as follows Figure 5 As shown in f~5g.

[0154] from Figure 5 e, it can be seen that all seven MB-CBP complexes can effectively capture Candida albicans, and the genomic DNA concentrations of samples captured by MB-PfCBP-A and MB-PfCBP-B were significantly higher than those of other complexes (P < 0.001);

[0155] from Figure 5 As can be seen from Figures f to g, the threshold cycle (Cq) of the sample captured by the MB-PfCBP-A complex is significantly lower than that of the other samples. The difference between the two methods may be due to the nonspecific adsorption of non-target substances by the MB-PfCBP-B complex. Therefore, the PfCBP-A protein was identified as a candidate protein for subsequent detection.

[0156] Example 5 MB-PfCBP-A capture specificity detection

[0157] The method described in Example 4 was used to detect the capture specificity of MB-PfCBP-A for fungi, except that in Example 5, the fungal strains to be captured and separated included: standard strain C.albicans ATCC60193 (deposited in the Key Laboratory of Molecular Diagnosis of Infectious Diseases, Chongqing Medical University), clinical isolate C.albicans1 (Laboratory of the First People's Hospital Affiliated to Chongqing Medical University), clinical isolate C.albicans2 (Laboratory of the First People's Hospital Affiliated to Chongqing Medical University), clinical isolate C.glabrata (Laboratory of the First People's Hospital Affiliated to Chongqing Medical University), clinical isolate C.neoformans (Laboratory of the First People's Hospital Affiliated to Chongqing Medical University), clinical isolate E.coli (deposited in the Key Laboratory of Molecular Diagnosis of Infectious Diseases, Chongqing Medical University), clinical isolate K.pneumoniae (deposited in the Key Laboratory of Molecular Diagnosis of Infectious Diseases, Chongqing Medical University) and clinical isolate S.aureus (deposited in the Key Laboratory of Molecular Diagnosis of Infectious Diseases, Chongqing Medical University). 10 6 CFU was captured, and then the cells were lysed and genomic DNA was extracted and purified using silicon hydroxy magnetic beads to detect its A 260nm The absorbance value at Figure 5 h.

[0158] The results showed that the genomic DNA concentrations of C.albicans and C.glabrata were significantly higher than those of C.neoformans, E.coli, K.pneumoniae and S.aureus strains (P<0.0001). This indicates that MB-PfCBP-A has an affinity for chitin on the fungal cell wall and can specifically capture intact fungal cells, and that the thick-capsulated Clostridium neoformans with a thick capsule and bacterial cells without chitin cannot be recognized and captured by affinity magnetic beads.

[0159] Example 6 Clinical Validation of Affinity Molecule Detection Method

[0160] Stability and specificity testing

[0161] Healthy human blood samples and bronchoalveolar lavage fluid (BALF) were used to prepare simulated clinical samples, simulating 3 CFU / ml and 10 5 CFU / ml C.albicans samples; different interferences (10 3 CFU Candida glabrata (collected by the Laboratory Department of the First People's Hospital Affiliated to Chongqing Medical University), 10 3CFU Klebsiella pneumoniae (collected by the Laboratory Department of the First People's Hospital Affiliated to Chongqing Medical University) and 10 5 Copy the genome DNA of Candida albicans), take 1ml of each sample for detection, and the cultured C. aLbicans liquid is used as a blank control. The test results are as follows Figure 6 As shown in a.

[0162] It can be seen from the figure that for low concentration samples (10 3 CFU / ml) and high concentration (10 5 CFU / ml) samples, the capture and separation efficiency of affinity magnetic beads was similar to that of the blank control when various interfering substances were added, indicating that the AMS technology can specifically identify and capture C.albicans and has strong anti-interference ability against unrelated pathogens and genomes.

[0163] Sensitivity test

[0164] Add serial dilutions of C.albicans ATCC60193 to the blood and BALF to a final concentration of 3 × 10 0 CFU / ml, 3×10 1 CFU / ml, 3×10 2 CFU / ml, 3×10 3 CFU / ml, 3×10 4 CFU / ml, 3×10 5 CFU / ml, 3×10 6 CFU / ml. The linear range of the affinity molecule method was evaluated by observing the fluorescence signal under blue light by naked eyes and real-time fluorescence monitoring. The results are shown in Figure 6 b~d.

[0165] As can be seen from the figure, the concentration of Candida albicans is 3×10 1 to 3×10 6 There is an obvious linear relationship between the fluorescence intensity and the negative logarithm of the concentration of Candida albicans when the concentration is between 1.0 and 2.0 CFU / ml. 2 The values ​​are 0.99231 and 0.99231 respectively.

[0166] Simulated clinical sample validation

[0167] Affinity molecule analysis was used to detect 80 simulated positive samples of Candida albicans (including 40 blood samples and 40 BALF samples) and 40 simulated negative samples (20 blood samples and 20 BALF samples) (the above samples were collected from the First People's Hospital of Chongqing Medical University and bronchoalveolar lavage fluid samples, which were simulated clinical samples prepared by adding Candida albicans); the test results of positive samples are shown in Figure 2. Figure 6e, the detection of negative samples is as follows Figure 6 f.

[0168] The cut-off value was determined by constructing the receiver operating characteristic (ROC) curve. The area under the curve (AUC) values ​​of blood and BALF samples were 0.976 and 0.998, respectively. The fluorescence intensity corresponding to the maximum Youden index was used as the cut-off value, which was 156.695 for blood and 151.276 for BALF samples. At this time, the sensitivity of the affinity molecule method for blood samples and bronchoalveolar lavage fluid samples was 92.5% and 97.5%, respectively, and the specificity was 100%. The sensitivity of whole blood detection was 90%, while that of BALF detection was 95%. This difference may be due to the fact that the genomic DNA concentration was lower than the detection threshold.

[0169] Comparative test

[0170] Currently, fungal fluorescence staining microscopy based on chitin and chitin-binding protein reactions is widely used in clinical samples. This experiment directly compared the detection limit (LOD) between the affinity molecule method and the staining technique; the detection results of the staining method are as follows Figure 6 g shows that the LOD of the staining method is 3×10 3 CFU / mL; this indicates that the sensitivity of fungal fluorescence staining microscopy is at least 100-fold lower than that of the affinity molecule method.

[0171] AMS-qPCR was performed on simulated blood and BALF samples, and the test results were as follows: Figure 7 As shown in a, the results showed that the qPCR detection limit (LOD) was 3×10 1 CFU / ml, LOD is similar to the affinity molecule method. At the same time, 1 ml of each simulated clinical sample was taken without MB-PfCBP-A capture (uncapture), and the cells were directly lysed after centrifugation and the genomic DNA was extracted by silicon hydroxy magnetic beads and tested by qPCR. The test results are shown in Figure 7 As shown in b, it is found that there is no linear relationship between the Cq value of the uncaptured sample and the concentration of Candida albicans, especially for the simulated blood sample, the Cq has no significant difference with the negative sample.

[0172] The above experimental results show that the affinity molecule method can capture and enrich Candida albicans from clinical specimens such as blood and bronchoalveolar lavage fluid and is not interfered by non-target bacteria, human cells, antibodies and other substances. It emphasizes the superiority of the affinity molecule method for detecting low-concentration samples and shows that it is a faster, easier to operate and more sensitive method than AMS-qPCR.

[0173] It can be seen from the above embodiments that the present invention provides a chitin binding protein for detecting fungi and its application, and a fungal affinity molecule detection method. The entire reaction of the detection method can be completed within 120 minutes, and the detection sensitivity of Candida albicans is 10 1 CFU / ml. This diagnostic platform is expected to provide low-cost, high-efficiency, rapid, accurate and immediate diagnosis for invasive fungal infections.

[0174] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A chitin binding protein for detecting fungi, characterized in that The chitin binding protein includes ChBD2, ChBD3, EfCBP-1, PfCBP-A, PfCBP-B, BcCBP-1 or ScCBP-1; The amino acid sequence of ChBD2 is shown in SEQ ID NO: 1, and the nucleotide sequence encoding the amino acid of ChBD2 is shown in SEQ ID NO: 2; The amino acid sequence of ChBD3 is shown in SEQ ID NO: 3, and the nucleotide sequence encoding the amino acid of ChBD3 is shown in SEQ ID NO: 4; The amino acid sequence of EfCBP-1 is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the amino acid of EfCBP-1 is shown in SEQ ID NO: 6; The amino acid sequence of PfCBP-A is shown in SEQ ID NO: 7, and the nucleotide sequence encoding the amino acid of PfCBP-A is shown in SEQ ID NO: 8; The amino acid sequence of PfCBP-B is shown in SEQ ID NO: 9, and the nucleotide sequence encoding the amino acid of PfCBP-B is shown in SEQ ID NO: 10; The amino acid sequence of BcCBP-1 is shown in SEQ ID NO: 11, and the nucleotide sequence encoding the amino acid of BcCBP-1 is shown in SEQ ID NO: 12; The amino acid sequence of ScCBP-1 is shown in SEQ ID NO: 13, and the nucleotide sequence encoding the amino acids of ScCBP-1 is shown in SEQ ID NO:

14.

2. Use of the chitin binding protein according to claim 1 in detecting fungi.

3. A method for detecting fungal affinity molecules, characterized in that: The steps include: (1) mixing chitin binding protein with magnetic beads and incubating them to obtain MB-CBP complex; (2) mixing and incubating the MB-CBP complex and the test sample to obtain a mixture; (3) extracting genomic DNA from the mixture; (4) Rapid amplification and one-pot detection of genomic DNA; The chitin binding protein is the chitin binding protein according to claim 1.

4. The affinity molecule detection method according to claim 3, characterized in that: In step (1), the temperature of the mixed incubation is 20 to 30° C.; the time of the mixed incubation is 0.5 to 2.0 h; The volume mass ratio of the chitin binding protein and the magnetic beads for mixed incubation is 0.002-0.04:

1.

5. The affinity molecule detection method according to claim 4, characterized in that: In step (2), the test sample is blood and / or bronchoalveolar lavage fluid.

6. The affinity molecule detection method according to claim 5, characterized in that: In step (2), the volume ratio of the MB-CBP complex to the test sample is 0.04-0.06:0.5-1.5; The temperature of the mixed incubation in step (2) is 20 to 30° C. and the time is 20 to 35 minutes.

7. The affinity molecule detection method according to claim 6, characterized in that: In step (3), the method for extracting genomic DNA from the mixture is a silicon hydroxy magnetic bead method.

8. The affinity molecule detection method according to claim 7, characterized in that: In step (4), the method for rapid amplification and one-pot detection of genomic DNA is RPA-CRISPR / Cas12a; The specific steps are as follows: 1) Perform RPA amplification on genomic DNA and collect the amplified RPA system; 2) The amplified RPA system and CRISPR / Cas12a system are mixed and incubated for 5 to 20 minutes, and then tested to determine whether there are fungi based on the strength of the fluorescent signal.

9. The affinity molecule detection method according to claim 8, characterized in that: The CRISPR / Cas12a system includes the following components: 10×NE buffer 2.1, crRNA, Cas12a, and oligonucleotide probes; The amount of 10×NE buffer 2.1 added is 0.1-0.6 μl; The amount of crRNA added is 1 to 4 μl, and the initial concentration of crRNA is 1 to 3 μmol / L; The added amount of Cas12a is 0.10-1.0 μl, and the initial concentration of Cas12a is 4-5 μmol / L; The amount of the oligonucleotide probe added is 0.10-1.5 μl, and the initial concentration of the oligonucleotide probe is 1-15 μmol / L; The nucleotide sequence of the crRNA is shown in SEQ ID NO: 15; The nucleotide sequence of Cas12a is shown in SEQ ID NO: 16; The nucleotide sequence of the oligonucleotide probe is 5′-FAM-TTATTATT-BHQ1-3′.

10. The affinity molecule detection method according to claim 9, characterized in that: The temperature of the mixed incubation is 36-44°C.

Images