Corynespora aspera and application thereof

Abstract

The invention discloses corynespora aspera, which is classified and named as corynespora aspera Y-3 in microbiology, has the Latin literature name of Clavipora lusitaniae Y-3, and is preserved in the China Center for Type Culture Collection (CCTCC) on March 14, 2024, the preservation address is Wuhan University, China, and the preservation number is CCTCC NO: M 2024473. The invention also discloses a method for separating and culturing the corynespora aspera Y-3 and application of the corynespora aspera Y-3 in fermenting tobacco leaves. A conventional fungus enrichment culture medium (YPD) is used for enriching strains, fermentation liquor has the faint scent characteristic, tobacco leaves are used for preparing a culture medium for enriching strains, the fermentation liquor has the fruit sweet aroma characteristic, and the tobacco aroma characteristic is softer and finer. After tobacco leaves are fermented and alcoholized by a bacterial liquid prepared from the strain, the aroma quality and the aroma amount of the tobacco leaves can be improved.

Description

Technical Field

[0001] The present invention belongs to the field of microbial fermentation technology, and relates to the field of microbial processing for improving tobacco leaf quality. Specifically, the present invention relates to a Portuguese coryneformis yeast. At the same time, the present invention also relates to a method for isolating the Portuguese coryneformis yeast and its application in fermenting tobacco leaves to improve the aroma quality of tobacco leaves. Background Art

[0002] The aroma characteristics of tobacco leaves are an important factor affecting the formation of quality. Poor quality aged tobacco leaves have less aroma, taste bland, too dark, insufficient aroma and poor aroma quality, and heavy irritation and foreign smell. The high content of macromolecular substances such as starch, protein, pectin and cellulose in aged tobacco leaves is the reason for the foreign smell when smoking. There are differences in the aroma characteristics of tobacco leaves of different qualities.

[0003] The principle of using microorganisms to improve the quality of tobacco leaves mainly includes improving the chemical composition and aroma characteristics of tobacco leaves through the fermentation process. Microbial fermentation is an effective tobacco leaf quality improvement technology that uses specific microbial strains to treat tobacco leaves to improve the quality of tobacco leaves. This process involves many aspects, including optimizing the chemical composition of tobacco leaves, increasing the types and contents of aroma substances, and reducing the production of harmful substances. By selecting suitable microbial strains and fermentation conditions, the basic chemical composition of tobacco leaves can be adjusted, such as adjusting the pH value and moisture content of tobacco leaves, so that tobacco leaves are more suitable for making tobacco products. For example, during the fermentation of Bacillus amyloliquefaciens and Bacillus subtilis, by controlling fermentation conditions such as the amount of inoculation, the concentration of sugar and salt solution, the fermentation temperature and time, the fermentation process of tobacco raw materials can be optimized, thereby improving the chemical composition of tobacco leaves. Microbial fermentation can promote the production and accumulation of aroma substances in tobacco leaves. Through the fermentation process, the types and relative contents of aroma substances such as aldehydes, ketones, and esters can be increased, while the production of irritating substances can be reduced, so that the aroma of tobacco leaves is more intense and harmonious, the irritation is reduced, and the overall quality of tobacco leaves is improved. Studies have shown that fermentation of tobacco leaves by Bacillus amyloliquefaciens increases 9 aroma substances and reduces 7 irritants, while fermentation of tobacco leaves by Bacillus subtilis increases 6 alcohols and ketones and reduces 5 substances, making the aroma of tobacco leaves more complex and strong, less irritating, and richer in taste. During the fermentation and aging process of tobacco leaves, the chemical composition inside the tobacco leaves can be regulated by artificially adding beneficial microorganisms and microbial enzymes, and the value of tobacco leaf microorganisms can be brought into play. For example, by adding specific microbial strains for fermentation treatment, the safety of tobacco leaves can be effectively improved.

[0004] At present, the application of microbial technology in improving tobacco leaf quality is mainly focused on bacteria, while fungi, as excellent strains for improving the quality of fermented products such as tea, cocoa, coffee, and alcohol, have strong growth activity and stable functional characteristics, but are less used in improving the quality of aged tobacco leaves. Therefore, screening a functional fungus that can effectively improve the aroma quality of tobacco leaves is of great significance for improving tobacco leaf quality.

[0005] In order to solve the above problems, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide a new Portuguese corynosporum yeast in view of the deficiencies of the prior art. The purpose of the present invention is also to provide the application of the Portuguese corynosporum yeast in cigarette production. The Portuguese corynosporum yeast Y-3 provided by the present invention is isolated for the first time and is identified as a new species of microorganism. There is currently no public report on the Portuguese corynosporum yeast Y-3 and related applications.

[0007] The present invention provides a yeast for improving the aroma quality of tobacco leaves and its application, relates to the field of microbial processing for improving the quality of tobacco leaves, and also relates to the application of yeast in fermenting tobacco leaves to improve the aroma quality of tobacco leaves. Specifically, the present invention provides a Portuguese coryspora yeast Y-3, as well as a method for isolating and culturing the Portuguese coryspora yeast Y-3 and its use for fermenting tobacco leaves. The strain is derived from Brazilian tobacco leaves, belongs to a recognized safe strain, and can be used for the preparation of biological preparations and cigarette processing. The single colony of the strain is milky white, with a smooth and opaque surface and neat edges, and the strain is easy to culture and preserve. The yeast species information is Portuguese coryspora yeast, named Clavispora lusitaniae Y-3, which was deposited in the China Center for Type Culture Collection (CCTCC) on March 14, 2024, and the deposit address is Wuhan University, China, and the strain deposit number is CCTCC NO: M 2024473. The strain was enriched using conventional fungal enrichment medium (YPD / PDA), and the fermentation liquid had a fresh aroma. The strain was enriched using tobacco leaves as the medium, and the fermentation liquid had a fruity sweet aroma, and the tobacco aroma was softer and more delicate. The fermentation liquid prepared by the strain can improve the aroma quality and aroma quantity of tobacco leaves after fermenting and mellowing tobacco leaves.

[0008] The present invention achieves the above-mentioned purpose through the following technical solutions.

[0009] The first aspect of the present invention relates to a Portuguese Clavispora yeast, which is named as Portuguese Clavispora yeast Y-3 in microbiological classification and has a Latin name of Clavispora lusitaniae Y-3. It has been deposited in the China Center for Type Culture Collection on March 14, 2024, and its deposit number is CCTCC NO: M 2024473.

[0010] The nucleotide sequence of the ITS gene of the Portuguese corynespora yeast Y-3 isolated by the present invention is shown in the sequence table.

[0011] The method for isolating and culturing the Portuguese corynespora yeast Y-3 according to the first aspect of the present invention comprises the following steps:

[0012] Weigh 30g of Brazilian flue-cured tobacco into 100ml of sterile water, place in a 30℃ shaker at 160r / min for 60min, so that the microorganisms in the tobacco leaves are fully dissolved in the sterile water to obtain a bacterial suspension. Dilute the obtained suspension by 10 times. -1 , 10 -2 , 10 -3 , 10 -4 4 gradients were set, and 200ul of liquid was drawn from the original solution and the four diluted centrifuge tubes, a total of 5 concentrations, and applied to the PDA solid medium. Then, the culture was placed in a 30℃ constant temperature incubator, and the colony growth was observed irregularly. Single colonies were selected and streaked until clean, single colonies were obtained. The colony morphology of the Y-3 strain is shown in the figure below. Figure 1 The single colony of this strain is milky white with a smooth and opaque surface.

[0013] The above-mentioned method for isolating and culturing Portuguese corynosporum Y-3 as described in the first aspect of the present invention, the PDA solid culture medium is composed of the following: 200g potato, 20g glucose, 15g agar, and 100ml distilled water.

[0014] The Y-3 strain was inoculated from the plate into a conventional PDA liquid medium and cultured in a 30°C constant temperature shaker. Samples were taken every 3 hours, 1 ml of the bacterial solution was pipetted into a centrifuge tube, and its OD was measured. 600 The strain growth curve was drawn to determine the time when the strain reached the logarithmic phase, stable phase, and decay phase during its growth process, so as to determine its growth characteristics.

[0015] The above-mentioned method for isolating and culturing the Portuguese corynosporum Y-3 as described in the first aspect of the present invention, the conventional PDA liquid culture medium is composed of the following: 200g potato, 20g glucose, and 100ml distilled water.

[0016] The obtained strains are sent to Shanghai Paisonno Biotechnology Co., Ltd. for strain identification.

[0017] The second aspect of the present invention relates to a bacterial agent, the active ingredient of which is the Portuguese Corynespora yeast Y-3 described in the first aspect of the present invention.

[0018] The third aspect of the present invention relates to the use of the Portuguese Corynespora yeast Y-3 described in the first aspect of the present invention or the bacterial agent described in the second aspect of the present invention in cigarette production.

[0019] Preferably, the Portuguese Corynosporum Y-3 or the bacterial agent is used to ferment tobacco leaves to improve the aroma quality of the tobacco leaves and increase the aroma quality and aroma quantity of the tobacco leaves.

[0020] The present invention has the following beneficial effects:

[0021] 1. The present invention screened a new strain Y-3 from the pure culture strains isolated from Brazilian tobacco leaf samples. Morphological research, physiological and biochemical analysis, and molecular biological identification showed that the strain was a new species of microorganism, belonging to Portuguese Clavispora yeast, and was named Portuguese Clavisporalusitaniae Y-3 in microbiological classification. Its Latin name is Clavisporalusitaniae Y-3. It was deposited in the China Center for Type Culture Collection (CCTCC) on March 14, 2024, and the deposit address is Wuhan University, China, and the strain deposit number is CCTCC NO: M 2024473.

[0022] 2. The strain was enriched using conventional fungal enrichment medium (YPD), and the fermentation liquid had a fresh aroma. The strain was enriched using tobacco leaves as the medium, and the fermentation liquid had a fruity sweet aroma, and the tobacco aroma was softer and more delicate. The fermentation liquid prepared by the strain can improve the aroma quality and amount of tobacco leaves and reduce irritation and impurities after fermenting tobacco leaves.

[0023] 3. The strain of the present invention is derived from Brazilian tobacco leaves and is a recognized safe strain that can be used for the preparation of biological agents and cigarette processing.

[0024] 4. The strain of the present invention is easy to culture and preserve. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a colony morphology diagram of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0026] Figure 2 This is the growth curve of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0027] Figure 3 This is a comparison chart of different carbon sources during the cultivation of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0028] Figure 4 This is a comparison chart of different nitrogen sources during the cultivation of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0029] Figure 5 This is a comparison chart of different temperatures during the cultivation of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0030] Figure 6 This is a comparison chart of different pH values ​​during the cultivation of the Portuguese Corynespora yeast strain Y-3 of the present invention.

[0031] Figure 7 This is the identification result of the Portuguese Corynespora yeast Y-3 strain of the present invention. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0033] Example 1 Strain screening, separation and purification

[0034] Weigh 30g of Brazilian flue-cured tobacco into 100ml of sterile water, place in a 30℃ shaker at 160r / min for 60min, so that the microorganisms in the tobacco leaves are fully dissolved in the sterile water to obtain a bacterial suspension. Dilute the obtained suspension by 10 times. -1 , 10 -2 , 10 -3 , 10 -4 4 gradients were set, and 200ul of liquid was drawn from the original solution and the four diluted centrifuge tubes, a total of 5 concentrations, and applied to the PDA solid medium. Then, the culture was placed in a 30℃ constant temperature incubator, and the colony growth was observed irregularly. Single colonies were selected and streaked until clean, single colonies were obtained. The colony morphology of the Y-3 strain is shown in the figure below. Figure 1 The single colony of this strain is milky white with a smooth and opaque surface.

[0035] Example 2 Identification of growth characteristics of Y-3 strain

[0036] The Y-3 strain was inoculated from the plate into a conventional PDA liquid medium and cultured in a 30°C constant temperature shaker. Samples were taken every 3 hours, 1 ml of the bacterial solution was pipetted into a centrifuge tube, and its OD was measured. 600 The strain growth curve was drawn to determine the time when the strain reached the logarithmic phase, stable phase, and decay phase during its growth process, so as to determine its growth characteristics. Figure 2 Figure 2 is a schematic diagram of the strain growth curve. Figure 2 It can be seen that the strain grew rapidly in the first 9 hours of enrichment, and the strain began to grow slowly after 24 hours of culture. Then the OD600 value of the strain maintained a small fluctuation and was basically stable. After 108 hours of culture, the strain began to die. It can be seen that the lag phase of the growth process of the Y3 strain is 0-3 hours, it enters the logarithmic phase after 3 hours, enters the stable phase at 12 hours, and begins to die at 108 hours.

[0037] Example 3 Optimization of the optimal growth conditions for Y-3 strain

[0038] Carbon source-free culture medium: (dipotassium hydrogen phosphate) K2HPO4 1g / L, (magnesium sulfate heptahydrate) MgSO4·7H2O 0.5g / L, (potassium chloride) KCl 0.5g / L, (sodium nitrate) NaNO3 3g / L, (ferrous sulfate heptahydrate) FeSO4·7H2O 0.01g / L.

[0039] Culture medium without carbon source and nitrogen source: K2HPO4 1g / L, MgSO4·7H2O 0.5g / L, KCl 0.5g / L, FeSO4·7H2O0.01g / L.

[0040] A carbon source-free culture medium was selected, and sucrose, maltose, glucose, lactose and fructose were added as carbon sources respectively. The initial pH value was adjusted to 7.0, and the fermentation medium was sterilized. The culture was carried out at 30°C and 150 r / min on a shaking incubator for 24 h. The optimal carbon source for the fermentation medium was selected by comparing the OD value of strain growth and cell dry weight under different carbon sources.

[0041] A carbon source and nitrogen source-free culture medium was selected. Under the conditions of optimal carbon source and its optimal mass concentration, NaNO3, (NH4)2SO4, peptone and urea were added as nitrogen sources respectively. The initial pH value was adjusted to 7.0, and the fermentation medium was sterilized. The culture was carried out at 30°C and 150 r / min on a shaking incubator for 24 h. The optimal nitrogen source for the fermentation medium was selected by comparing the OD values ​​of strain growth under different nitrogen sources.

[0042] A carbon source and nitrogen source-free culture medium was selected. Under the conditions of optimal carbon source, nitrogen source and their optimal mass concentrations, the initial pH value was adjusted to 7.0. The fermentation medium was sterilized and the strain was inoculated into the culture medium. The culture medium was placed in water baths at different temperatures. The growth characteristics of the strain under different temperature conditions were observed, and the optimal culture temperature was determined by comparing the OD values ​​of the strain growth.

[0043] PDA liquid culture medium with different pH values ​​was prepared, inoculated with Y-3 strain, cultured at 30°C and shaken at 150 r / min, and the appropriate pH environment was determined by comparing the OD values ​​of strain growth.

[0044] like Figure 3-Figure 6 Optimize the results for the optimal growth conditions of the strain, such as Figure 3-Figure 6 As shown, the optimal carbon source for the growth of Y-3 strain is sucrose, the optimal nitrogen source type and concentration are (NH4)2SO4, the optimal culture temperature is 50℃, and the optimal growth pH is 6.

[0045] Example 4 Identification of aroma production characteristics of Y-3 strain

[0046] Tobacco leaf culture medium for aroma identification: 0.45 g of different types of tobacco leaves sterilized for 10 min are added to 30 ml of sterile water, and the tobacco leaves are filtered out to prepare tobacco leaf liquid culture medium.

[0047] The Y-3 strain was inoculated into 5 different types of tobacco leaf culture media to verify its aroma production characteristics, as shown in Table 1. The aroma production test showed that the Y-3 strain produced a light aroma after being enriched in a liquid culture medium made from Shandong tobacco leaves, and produced a fruity sweet aroma in the liquid culture medium after being enriched and cultured in Dali tobacco leaves and Yuxi tobacco leaves. In addition, the strain produced a wine aroma when cultured in Dali tobacco leaves.

[0048] Table 1 Aroma production characteristics of Y8 strain

[0049]

[0050] Example 5 Y-3 strain fermentation Shandong NC55 C4F tobacco strips

[0051] Tobacco leaf liquid culture medium: 0.45 g of Shandong NC55 grade C4F tobacco leaves sterilized for 10 minutes were added to 30 ml of sterile water, and the tobacco leaves were filtered out to prepare the tobacco leaf liquid culture medium.

[0052] The purified Y-3 strain was inoculated into tobacco leaf liquid culture medium, and cultured at 30°C with shaking at 150 r / min for 24-48 h to obtain a bacterial suspension.

[0053] Spread the prepared Shandong NC55 C4F tobacco leaves flat on the plastic film, and then spray the treated bacterial agent evenly on the tobacco leaves at a ratio of 4%. After spraying one side, mix it well and spray it again until the bacterial agent is sprayed. Mix it manually after spraying). At the same time, spray the tobacco leaves with an equal amount of sterile water, which is regarded as the control CK.

[0054] The tobacco leaf samples were stored in a constant temperature and humidity incubator in the tobacco leaf aging room (temperature 25°C, humidity 60%) for fermentation and storage for 48 hours, and rolled into cigarette samples using uniform tobacco materials, and the moisture was balanced according to the requirements of GB / T16447. Professional sensory evaluation experts were invited to evaluate and score the tobacco leaf quality according to YC / T 530-2015 "Sensory Evaluation Method for Quality, Style and Characteristics of Flue-cured Tobacco Leaves".

[0055] The results of the smoking test showed that Shandong NC55 C4F tobacco leaves were obviously burnt and had a small amount of nitrogen-containing impurities, with a slightly strong and irritating taste, and a slightly unclean mouth. After fermentation with the inoculant made from the enriched Y-3 strain, the style of the tobacco leaves changed slightly in the front part, the style was more prominent, the aroma quality and amount of the tobacco leaves were improved, the impurities were reduced, the smoke was more delicate and sweet, and the taste was significantly improved.

[0056] Table 4 Y-3 strain fermentation Shandong NC55 C4F tobacco strips

[0057]

[0058]

[0059] Example 6 Y-3 strain fermentation of Zhuzhou single tobacco strips

[0060] Tobacco leaf liquid culture medium: add 0.45 g of Zhuzhou single-cut tobacco leaves sterilized for 10 minutes into 30 ml of sterile water, and filter out the tobacco leaves to prepare the tobacco leaf liquid culture medium.

[0061] The Y-3 strain was inoculated into tobacco leaf culture medium for enrichment culture to obtain bacterial liquid.

[0062] Take 15 kg of Zhuzhou single-cut tobacco leaves after threshing and re-drying, spread all the tobacco leaves flat, and spray Y-3 bacterial solution at a ratio of 4% of the tobacco leaves. During the spraying process, turn the tobacco leaves continuously to ensure uniform spraying.

[0063] After spraying, the tobacco leaves are placed in an air-conditioned room to dry until the moisture content reaches 11%-12%, and then placed in a tobacco aging warehouse for aging. The tobacco leaves are then subjected to sensory evaluation to determine the quality improvement effect of the Y-3 strain on the tobacco leaves.

[0064] The results of sensory evaluation showed that the untreated Zhuzhou single-strand tobacco had residual particles in the mouth and a dry aroma. The tobacco leaves treated with the Y-3 strain had a more delicate and rounded aroma and a less dry and burnt smell.

[0065] Example 7 Y8 strain fermentation Hengyang mixed tobacco slices

[0066] Tobacco leaf liquid culture medium: add 0.45 g of Hengyang mixed tobacco leaves sterilized for 10 min into 30 ml of sterile water, filter out the tobacco leaves and prepare the tobacco leaf liquid culture medium.

[0067] The Y-3 strain was inoculated into tobacco leaf culture medium for enrichment culture to obtain bacterial liquid.

[0068] Take 15 kg of Hengyang mixed tobacco leaves after threshing and redrying, spread all the tobacco leaves evenly, and spray Y-3 bacterial solution at a ratio of 4% of the tobacco leaves. During the spraying process, turn the tobacco leaves continuously to ensure uniform spraying.

[0069] After spraying, the tobacco leaves are placed in an air-conditioned room to dry until the moisture content reaches 11%-12%, and then placed in a tobacco aging warehouse for aging. The tobacco leaves are then subjected to sensory evaluation to determine the quality improvement effect of the Y-3 strain on the tobacco leaves.

[0070] The sensory evaluation results show that the untreated Hengyang mixed tobacco has a slightly sweet burnt taste, a slightly heavier woody flavor, a slightly less comfortable feel, and a dry feeling in the mouth. The tobacco leaves treated with the Y-3 strain have a more velvety feel, a more delicate smoke, a lighter smell, a slightly increased sweetness, and a coating feel.

[0071] Example 8 Identification and nucleotide sequence of Y-3 strain

[0072] Y-3 strain detection experimental process

[0073] 1. Extraction of Fungal Genomic DNA

[0074] 1. Scrape a certain amount of sample from the plate and place it in a 2 ml centrifuge tube. Add 200 μl of buffer GA and shake until the bacteria are completely suspended.

[0075] 2. Add 20 μl Proteinase K solution to the tube and mix well.

[0076] 3. Add 220 μl of buffer GB, shake for 15 seconds, and place at 70°C for 10 minutes. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0077] 4. Add 220 μl of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0078] 5. Add the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0079] 6. Add 500 μl of buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in the collection tube.

[0080] 7. Add 600 μl of rinse solution PW to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, pour out the waste liquid, and place the adsorption column CB3 in a collection tube.

[0081] 8. Repeat step 7.

[0082] 9. Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm (~13,400 × g) for 2 min, and discard the waste liquid. Leave the adsorption column CB3 at room temperature for several minutes to completely dry the rinsing liquid remaining in the adsorption material.

[0083] Note: The purpose of this step is to remove the residual rinsing solution in the adsorption column. The residual ethanol in the rinsing solution will affect the subsequent enzyme reaction (enzyme digestion, PCR, etc.) experiments.

[0084] 10. Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μl of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm (~13,400×g) for 2 minutes, and collect the solution into the centrifuge tube.

[0085] 2. Fungal genome PCR amplification

[0086] 1. Primer name sequence

[0087] ITS1 TCCGTAGGTGAACCTGCGG

[0088] ITS4 TCCTCCGCTTATTGATATGC

[0089] 2. PCR amplification reaction system: Add the following components into a 0.2 ml centrifuge tube:

[0090] Table 2 PCR amplification reaction system

[0091] Genomic DNA (20 ng / ul), 1.0 ul; 10× Buffer (containing 2.5 mM Mg 2+ )5.0ul; Taq polymerase (5u / μL), 1.0ul; dNTP (10mM), 1.0ul; ITS1 primer (10uM), 1.5ul; ITS4 primer (10uM), 1.5ul; ddH2O, 39.0ul. Total volume 50.0ul. Gently flick to mix, centrifuge to collect droplets on the tube wall to the bottom of the tube, and perform PCR reaction on a PCR amplification instrument.

[0092] PCR amplification reaction program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 7 min, 35 cycles.

[0093] After the reaction is completed, take 3ul of PCR product and perform 1% agarose gel electrophoresis to confirm the PCR amplified fragment.

[0094] 3. Recovery of PCR Products

[0095] The PCR products were recovered using the AxyPrep DNA Gel Recovery Kit.

[0096] 1. Cut the agarose gel containing the target DNA under ultraviolet light, put it into a clean centrifuge tube, and weigh it.

[0097] 2. Add 3 gel volumes of Buffer DE-A, mix well and heat at 75°C until the gel is completely melted.

[0098] 3. Add 0.5 volume of Buffer DE-B to Buffer DE-A and mix well. When the separated DNA fragment is less than 400 bp, add 1 gel volume of isopropanol.

[0099] 4. Transfer the mixture to a DNA preparation tube and centrifuge at 12,000×g for 1 min. Discard the filtrate.

[0100] 5. Place the preparation tube back into a 2 ml centrifuge tube, add 500 μl Buffer W1, centrifuge at 12,000 × g for 30 seconds, and discard the filtrate.

[0101] 6. Place the preparation tube back into a 2 ml centrifuge tube, add 700 μl Buffer W2, centrifuge at 12,000 × g for 30 seconds, and discard the filtrate. Use the same method to add 700 μl Buffer W2 and centrifuge at 12,000 × g for 1 minute.

[0102] 7. Place the preparation tube back into a 2 ml centrifuge tube and centrifuge at 12,000 × g for 1 min.

[0103] 8. Place the preparation tube in a clean 1.5 ml centrifuge tube (provided in the kit), add 25-30 μl of deionized water to the center of the preparation membrane, let stand at room temperature for 1 min. Centrifuge at 12,000 × g for 1 min to elute the DNA.

[0104] 4. Sequence determination: Take the purified PCR products of each strain and use the sequencer ABI3730-XL for DNA sequencing.

[0105] 5. Sequence analysis: Use the NCBI Blast program to compare the spliced ​​sequence file with the data in the NCBI nucleic acid database to obtain the species information with the greatest sequence similarity to the species to be tested, which is the identification result.

[0106] The identification results of Portuguese Corynespora yeast Y-3 are as follows Figure 7 shown.

[0107] Part of the sequence is as follows:

[0108] ATCACCGGGAGTCTACCTGATTTGAGGGCGAAATGTCGTGCTGTAAACGTGTTTGACAGCGCGGTTTGATATTTCGGAGCAACGCCTAACCGGGGGTTAGAGGGGATGCGACGCTCAAACAGGCATGCCTCGAGGAATGCCTCGAGGCGCAATGTGCGTTCAAAGATTCGATGATTCACG TCTGCAAGTCATACTACGTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTAGTTTGTTAGAATAAAAAAATTTTATTTTTTTGTTCGCAAAAACAATGGGTAATGGATTTTTTAATGATCCTTCCGCAGGTTCCCCTACGGAAGGG

[0115] Example 9Y-3 Physiological and biochemical function identification

[0116] The Y3 strain was subjected to physiological and biochemical identification tests, and the results are shown in Table 5.

[0117] Table 5 Physiological and biochemical identification of Y3 strain

[0118]

[0119] As shown in Table 5, the Y3 strain participates in glucose fermentation to produce pyruvate, is able to utilize citrate and participate in starch hydrolysis.

[0120] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

[0121] List of attached documents:

[0122] The ITS partial sequence of Portuguese coryneformis Y-3 is as follows:

[0123] ATCACCGGGAGTCTACCTGATTTGAGGGCGAAATGTCGTGCTGTAAACGTGTTTGACAGCGCGGTTGATATTTCGGAGCAACGCCTAACCGGGGGTTAGAGGGGATGCGACGCTCAAACAGGCATGCCTCGAGGAATGCCTCGAGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGTCTGCAAGTCATACTACGTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTAGTTTGTTAGAATAAAAAAATTTATTTTTTTGTTCGCAAAAACAATGGGTAATGGATTTTTTAATGATCCTTCCGCAGGTTCCCCTACGGAAGGG

Claims

1. A Portuguese corynespora yeast, characterized in that Its microbiological classification is named Portuguese Clavispora Y-3, and its Latin name is Clavispora lusitaniae Y-3. It was deposited in the China Center for Type Culture Collection on March 14, 2024, and its preservation number is CCTCC NO: M 2024473.

2. The Portuguese corynespora yeast according to claim 1, characterized in that The ITS sequence of the Portuguese corynespora yeast Y-3 is shown in the sequence table SEQ ID NO.

1.

3. A bacterial agent, characterized in that: The active ingredient is the Portuguese corynespora yeast Y-3 described in any one of claims 1-2.

4. Use of the Portuguese coryneformis Y-3 according to any one of claims 1 to 2 or the bacterial agent according to claim 3 in cigarette production.

5. The use according to claim 4, characterized in that: The Portuguese corynosporum yeast Y-3 or the bacterial agent is used for fermenting tobacco leaves to improve the aroma quality of the tobacco leaves.

Images