Bacillus for promoting mycoplasma antibody expression ability and application thereof

Abstract

The present invention discloses a bacillus for promoting the expression ability of mycoplasma antibodies and its application. The bacillus is Bacillus paramycoides ( Bacillus paramycoides ), which is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee, with the deposit number: CGMCC No.31476, and the deposit date is July 26, 2024. The Bacillus of the present invention can meet the safety requirements of biosafety strains, can promote the secretion of mycoplasma antibodies, has an inhibitory effect on pathogenic chicken synoviae mycoplasma disease, and can effectively inhibit the outbreak of potential mycoplasmas during chicken breeding, thereby reducing the losses caused by the disease. At the same time, the in vitro metabolism results show that the strain has a promoting effect on the ecological metabolism of chicken intestinal flora, and the use of it as a biosafety bacterial preparation can achieve the purpose of disease prevention and control by regulating the intestinal microecology.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a bacillus capable of promoting the expression ability of mycoplasma antibodies and an application thereof. Background Art

[0002] In recent years, with the rapid development of the livestock and poultry industry, the high-density, intensive breeding model and the proliferation of inputs have increased the burden on the ecological environment. Unscientific breeding methods will not only lead to the deterioration of the breeding environment, the continuous degradation of seedling quality, and a sharp decline in breeding output, but also cause the body's resistance to environmental stress and disease resistance to decline, and diseases caused by mycoplasma frequently break out.

[0003] Mycoplasma synoviae infection, also known as chicken mycoplasma, is a disease caused by Mycoplasma synoviae (MS) in chickens. The main symptoms of sick chickens are exudative synovitis, ciliary sheath synovitis or bursitis, with joint swelling and trepidation.

[0004] The use of antibiotics can effectively control the occurrence and spread of diseases, but it interferes with the normal growth and reproduction of microbial flora in the intestines of animals, leading to increased drug resistance of animals to pathogenic microorganisms. In addition, the use of antibiotics will also lead to their residues in animals, which will eventually endanger human health. At present, many countries have explicitly banned or restricted the use of antibiotics. In this case, it is urgent to seek alternatives to antibiotics. With the in-depth study of microbiology, the use of biosafety bacteria to regulate the microecological balance in animals is gradually becoming a hot topic worldwide. Since biosafety bacteria products will not produce drug resistance, the use of biosafety bacteria to replace antibiotics has broad application prospects. Summary of the invention

[0005] The purpose of the present invention is to provide a Bacillus spores with the ability to promote the expression of mycoplasma antibodies to solve the problems of drug resistance and interference with the normal growth and reproduction of microbial flora in the intestinal tract of animals in the prior art of antibiotic treatment of MS.

[0006] The second object of the present invention is to provide a culture of the Bacillus.

[0007] The third purpose of the present invention is to provide an application of the Bacillus.

[0008] The technical solution adopted to achieve the purpose of the present invention is:

[0009] In a first aspect, a bacillus, wherein the bacillus is Bacillus paramycoides ( Bacillus paramycoides), which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number: CGMCC No.31476 and the deposit date being July 26, 2024.

[0010] In some specific embodiments, the 16S rRNA nucleotide sequence of Bacillus paramycoides contains the RNA molecule shown in SEQ ID NO.1.

[0011] In a second aspect, a culture of the Bacillus is a substance obtained by culturing the Bacillus paramycoides in a microbial culture medium.

[0012] In a third aspect, a bacterial agent is provided, wherein the bacterial agent contains the Bacillus and / or the secretion of the Bacillus and / or the culture.

[0013] In a fourth aspect, a use of the Bacillus or / and the secretion of the Bacillus or / and the culture in inhibiting Mycoplasma synoviae.

[0014] A fifth aspect provides an application of the Bacillus or / and the secretion of the Bacillus or / and the culture in regulating the ecological metabolism of poultry intestinal flora.

[0015] In a sixth aspect, a drug for treating chicken synoviae mycoplasma disease comprises the Bacillus or / and the secretion of the Bacillus or / and the culture.

[0016] In a seventh aspect, a poultry feed comprises the Bacillus and / or the secretion of the Bacillus and / or the culture.

[0017] In an eighth aspect, a method for culturing the Bacillus comprises the step of culturing the Bacillus paramycoides in a culture medium for culturing Bacillus paramycoides.

[0018] In a ninth aspect, a method for preparing the bacterial agent comprises using the Bacillus or / and the secretion of the Bacillus as an active ingredient to obtain the bacterial agent.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The bacillus of the present invention can meet the safety requirements of biosafety strains, can promote the secretion of mycoplasma antibodies, has an inhibitory effect on pathogenic chicken synoviae mycoplasma disease, and can effectively inhibit the outbreak of potential mycoplasmas during chicken breeding, thereby reducing the losses caused by the disease. At the same time, the in vitro metabolism results show that the strain has a promoting effect on the ecological metabolism of chicken intestinal flora, and the use of the strain as a biosafety bacterial preparation can achieve the purpose of disease prevention and control by regulating the intestinal microecology. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Shown is a phylogenetic tree diagram of Bacillus paramycoides of the present invention.

[0022] Figure 2 Shown is a photograph of a "fried egg"-like colony (1000×) after culture on MS solid plate.

[0023] Figure 3 Shown are the results of MS staining microscopy (1000×).

[0024] Figure 4 Shown is the PCR gel electrophoresis result of MS, in which 1, 2: MS; 3: blank control; M: DL2000 DNA Marker.

[0025] Figure 5 Shown is a graph of the CCU measurement results of MS.

[0026] Figure 6 Shown are the results of PCR detection of joint fluid. In the figure, 1-8: joint fluid samples of the challenge group; 9, 10: blank control group; 11: negative control group; M: DL2000 DNA Marker.

[0027] In the present invention, Bacillus paramycoides ( Bacillus paramycoides ) is deposited in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC, the address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is CGMCC NO.31476, and the deposit date is July 26, 2024. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] In this specific embodiment, the Mycoplasma synoviae MSCVCC-2960 is from the China Veterinary Microbial Culture Collection Center.

[0030] In the present invention, Bacillus paramycoides ( Bacillus paramycoides ) is deposited in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC, the address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is CGMCC NO.31476, and the deposit date is July 26, 2024.

[0031] In some embodiments, the 16S rRNA nucleotide sequence of Bacillus paramycoides contains the RNA molecule shown in SEQ ID NO.1.

[0032] In some embodiments, the gyrB gene sequence of Bacillus paramycoides is shown as SEQ ID NO.2.

[0033] In some embodiments, the Bacillus paramycoides of the present invention is obtained by the following method:

[0034] Based on the physiological and biochemical characteristics of soil flora, inhibitory bacteria are provided for AHPND, and the dominant strains in the soil are isolated and purified; pathogenic mycoplasma are used as targets, and antagonistic bacteria are screened from purified strains using the ELISA method; and the strains are identified through a comprehensive method of physiological and biochemical characteristics and 16S rRNA technology.

[0035] Under sterile conditions, take the soil in a centrifuge tube and grind it in an ice bath. Use 1% PBS solution to dilute the grinding solution 10 times in a gradient, take 100µL of each concentration gradient bacterial solution (including the original solution) and spread it on the NB solid culture medium, 3 parallels for each gradient, and invert and culture in a 28℃ constant temperature incubator for 24h to 48h. Pick single colonies with different morphologies for multiple streaking purification, and preserve them after confirming them as pure cultures. The isolated dominant bacteria were screened by ELISA, and the bacteria with the highest level of chicken synoviae Mycoplasma antibody detection were finally retained. The screened biosafety strain was finally determined as the target strain, and further research was carried out.

[0036] The results of physiological and biochemical experiments showed that the strain was Bacillus paramycoides ( Bacillus paramycoides ). After 16S rRNA technology detection, the strain has the highest homology with Bacillus paramycoides, with a similarity of up to 100.00%. Phylogenetic tree (such as Figure 1 ) also showed that the screened strains were most closely related to Bacillus paramycoides.

[0037] In a second aspect of the present specific embodiment, a culture of the Bacillus is provided, which is a substance obtained by culturing the Bacillus paramycoides in a microbial culture medium.

[0038] According to a third aspect of this specific embodiment, a bacterial agent is provided, wherein the bacterial agent contains the Bacillus and / or the secretion of the Bacillus and / or the culture.

[0039] A fourth aspect of this specific embodiment provides a use of the Bacillus or / and the secretion of the Bacillus or / and the culture in inhibiting Mycoplasma synoviae.

[0040] The fifth aspect of this specific embodiment provides a use of the Bacillus or / and the secretion of the Bacillus or / and the culture in regulating the ecological metabolism of poultry intestinal flora.

[0041] A sixth aspect of this specific embodiment provides a drug for treating chicken synoviae mycoplasma disease, comprising the Bacillus and / or the secretion of the Bacillus and / or the culture.

[0042] A seventh aspect of this specific embodiment provides a poultry feed, comprising the Bacillus and / or the secretion of the Bacillus and / or the culture.

[0043] According to an eighth aspect of the present specific embodiment, a method for culturing the Bacillus is provided, comprising the step of culturing the Bacillus paramycoides in a culture medium for culturing Bacillus paramycoides.

[0044] A ninth aspect of this specific embodiment provides a method for preparing the bacterial agent, comprising using the Bacillus or / and the secretion of the Bacillus as an active ingredient to obtain the bacterial agent.

[0045] In this specific embodiment, the magnetic bead method Mycoplasma genomic DNA extraction kit was purchased from Thermo Fisher Scientific Inc.; modified Frey's medium was purchased from Zhonghai Biotechnology (Zaozhuang) Co., Ltd.; inactivated horse serum was purchased from Zhengzhou Jiulong Biological Products Co., Ltd.; Giemsa staining solution was purchased from Beijing Solebold Biotechnology Co., Ltd.; chicken synoviae Mycoplasma antibody (MS) ELISA kit, interleukin-6 (IL-6) ELISA, interleukin-10 (IL-10) ELISA kit, immunoglobulin G (IgG) ELISA detection kit, and MSAg ELISA kit were all purchased from Wuhan Aidikang Biotechnology Co., Ltd., and tylosin tartrate was a commercially available product.

[0046] A300PCR instrument was purchased from Hangzhou Langji Scientific Instrument Co., Ltd., SPX-100B-Z incubator was purchased from Shanghai Boxun Medical Biological Instrument Co., Ltd., HFsafe-1200LC biological safety cabinet was purchased from Shanghai Likang Medical Equipment Co., Ltd., 1L-161CT carbon dioxide incubator was purchased from Shidukai Instrument Equipment Co., Ltd., F50 microplate reader was purchased from Thermo Fisher Scientific Inc., and CX21 microscope was purchased from Olympus (China) Co., Ltd.

[0047] Example 1

[0048] Physical safety test:

[0049] The fermentation liquid of Bacillus paramycoides of the present invention was prepared for use, 40 7-day-old AA broilers were selected as experimental animals, 5 mL was gavaged once a day for 5 consecutive days, and no treatment was performed during the period, and the state of the experimental animals was observed.

[0050] By treating broiler chickens with high doses of the drug by oral gavage, no individuals showed signs of lying down, becoming listless or even dying during the trial and 10 days after the end of the trial. Therefore, it can be determined that Bacillus paramycoides poses no biosafety issue to broiler chickens.

[0051] MSCVCC-2960 culture expansion:

[0052] Liquid culture: Weigh 45g of modified Frey's medium, dissolve it in water to 1L, sterilize it by high pressure, add 100mL / L sterile horse serum and 1% MSCVCC-2960 to the medium, pH 7.8, and culture at 37℃ for 7 days. When the medium turns from rose red to yellow, subculture it immediately, and continue subculture for 3 to 4 times.

[0053] Solid culture: Spread the MS bacterial solution on modified Frey's solid medium, culture it in a 5% carbon dioxide incubator at 37°C for 7 days, and observe it under an inverted microscope.

[0054] After liquid culture, the colonies grew normally, and the culture medium changed from rose red to yellow on the 6th day of culture; Figure 2 As shown, after 7 days of solid culture, typical "fried egg"-like colonies can be seen.

[0055] Staining identification of MSCVCC-2960:

[0056] Staining identification: After centrifuging the MS bacterial solution at 2500r / min for 5 minutes, discard the supernatant, evenly apply it on a slide, stain it according to the Giemsa staining method, and observe the bacterial morphology under an oil microscope for identification. Figure 3 As shown, a large number of spherical bacteria can be seen under the oil microscope.

[0057] PCR identification of MSCVCC-2960

[0058] PCR identification: PCR amplification, amplified fragment of 207bp, upstream primer sequence: GAGAAGCAA AATAGTGATATCA; downstream primer sequence: CAGTCGTCTCCGAAGTTAACAA (synthesized by Wuhan Jinkairui Bioengineering Co., Ltd.). After 1% agarose gel electrophoresis, the results were observed and recorded under ultraviolet light, and the positive amplified fragment was excised, recovered, sequenced, and nucleic acid alignment was performed on NCBI.

[0059] Depend on Figure 4 As shown, a target band of 207 bp appeared. After sequencing, the base sequence of the product matched with MS by 99%, indicating that MSCVCC-2960 was identified as MS.

[0060] Color Change Unit (CCU) Determination of MSCVCC-2960

[0061] The culture color change unit (CCU) of MS was determined using a 96-well plate. The first row was used as a blank control, and 200 μL of modified Frey's culture medium was added to each well. 180 μL of modified Frey's culture medium was added to the wells in the second and third rows, and MS bacterial solution was added to the first well of each row. After repeated pipetting and mixing, 20 μL was pipetted and added to the second well. After repeated pipetting and mixing, 20 μL was pipetted and added to the third well. This was repeated to the 12th well. The excess 20 μL in the 12th well was discarded and a 10-fold dilution was performed. The cell plate was sealed and cultured at 37°C for observation, and the highest dilution that caused the color change after the color no longer increased was taken as 1 CCU / mL.

[0062] like Figure 5 As shown in the figure, in the 96-well plate, the colors of columns 1 to 8 all change from red to yellow, so the MS CCU is 10 8 mL.

[0063] Determination of Minimum Inhibitory Concentration (MIC) of Bacillus paramycoides against MS

[0064] The bacterial agent in this example is a fermentation broth of Bacillus paramycoides. The number of live bacteria in the fermentation broth of Bacillus paramycoides is 2.7×10 8 CFU / mL, the designed dosage was 0.1mL, 0.2mL, 0.3mL, 0.4mL, 0.5mL, 0.6mL, 0.7mL, 0.8mL, 0.9mL, and 1.0mL for gavage and blood injection of chickens respectively, and the test period was three days. The colloidal gold detection card was tested 24 hours after the last administration, and the results showed that the dose of the gavage group (A) A≥0.5mL, and the dose of the blood injection group (B): 0.1mL≤B≤0.3mL.

[0065] The minimum inhibitory concentration (MIC) of Bacillus paramycoides to MS was determined by 96-well cell culture plates. After adding according to Table 1, the plate was covered and incubated at 37°C in a carbon dioxide incubator. After 7 days, the result was determined based on the color change: the minimum concentration of Bacillus paramycoides corresponding to the last well that did not change was the minimum inhibitory concentration (MIC). MIC≤7.81g / L was determined to be sensitive, 7.81<MIC≤250.00g / L was moderately sensitive, and MIC>250g / L was insensitive.

[0066] Table 1 Distribution of sample loading in 96-well plate

[0067]

[0068] Note: Solution A in the table: modified Frey's medium.

[0069] Liquid B: Dilute the MS liquid culture to 10 with modified Frey liquid medium. 4 CCU / mL, used as MS working bacterial solution.

[0070] Liquid C: Add 100 μL of Liquid A to each of the 2nd to 11th wells, add 100 μL of Bacillus paramycoides to the 2nd well, mix by pipetting, then pipette 100 μL of the mixture to the 3rd well, mix by pipetting, then pipette 100 μL of the mixture to the 4th well, and so on, dilute in multiple proportions to the 11th well, mix the 11th well, then pipette 100 μL of the mixture and discard it.

[0071] As shown in Table 2, 0.5 mL of Bacillus paramycoides showed the earliest antibacterial activity.

[0072] Table 2 Results of colloidal gold test card for Bacillus paramycoides

[0073]

[0074] Note: + represents a positive reaction, - represents a negative reaction, and v represents exceeding the reaction limit.

[0075] As shown in Table 3, 0.49 mL of Bacillus paramycoides ( Bacillus paramycoides ) Inhibition of MS belongs to the sensitive category.

[0076] Table 3 MIC determination results of Bacillus paramycoides against MS Unit: mL

[0077]

[0078] Note: “—” indicates that the positive control well did not change color.

[0079] Therefore, the subsequent dose of Bacillus paramycoides was selected as 0.5 mL.

[0080] Example 2

[0081] Establishment of MS attack model:

[0082] Forty 7-day-old AA broiler chickens were selected, and 20 of them were injected with MS culture (10 8 CCU / mL) was injected into the left paw pads of 20 mice, which served as the experimental group; the other 20 mice were injected with 0.5 mL of sterile saline solution on their left paw pads, which served as the blank control group.

[0083] (1) During the experiment, the broiler chickens’ limb condition, mobility, feeding and drinking habits, and mental state were observed.

[0084] (2) Blood samples were collected on the 7th, 14th, and 21st days, and the serum was separated and tested for MS antibodies according to the kit instructions.

[0085] (3) Perform an autopsy at 21 days.

[0086] (4) Collect synovial fluid from the joint cavity for PCR amplification and sequencing, and compare the nucleic acid with NCBI.

[0087] Seven days after the infection, some of the chickens' tarsal joints were swollen, with decreased appetite and mental fatigue; 14 days after the infection, the chickens were slow to move and lame; 21 days after the infection, the chicken leg joints were obviously swollen, with a sense of fluctuation when pinched, and pale combs and wattles. The blank control group did not show any abnormality, and the diet, drinking water and mental state were good. The autopsy showed purulent exudation in the joint cavity of the chicken leg in the infection group, while the autopsy of the blank control group was asymptomatic.

[0088] As shown in Table 4, 7 days after infection, up to 21 days, the serum MS antibody test results were positive; the blank control group never showed a positive test result.

[0089] Table 4 Serum MS antibody test results

[0090]

[0091] Note: “+” indicates a positive result; “-” indicates a negative result.

[0092] like Figure 6 As shown, the joint fluid samples of the chickens in the challenge group were amplified to obtain a target band of 207 bp, and the matching degree with MS after sequencing reached 99%; no bands appeared in the blank control group and the negative control group.

[0093] The successful construction of the MS infection model was determined by clinical symptoms, autopsy symptoms, MS antibody detection, and PCR test results.

[0094] Verification of antibacterial effect of Bacillus paramycoides:

[0095] AA broilers were randomly divided into 4 groups, 20 chickens in each group. The blank control group was fed normally; the challenge group was challenged with MS at 7 days old; the positive drug group was challenged with MS at 7 days old, and the drug tylosin tartrate was selected at 8 days old, and fed continuously for 3 days according to the drug instructions; the experimental group was challenged with MS at 7 days old, and Bacillus paramycoides fermentation liquid was used from 8 days old, with an addition of 1% of the drinking water, 3 times a day, and fed continuously for 3 days.

[0096] Five broilers were randomly selected from each group for blood sampling at 0, 7, 14, and 21 days after challenge, and serum immunoglobulin G (IgG) antibody levels and interleukin-6 (IL-6) and interleukin-10 (IL-10) levels were detected. The observation period was 21 days. The chickens were weighed at 0, 7, 14, and 21 days after challenge. After the observation period, the broilers in each group were euthanized, and the foot pad thickness and joint diameter were measured.

[0097] All experiments were repeated 3 times, and SPSS statistical software was used to perform one-way analysis of variance on the experimental data. The results were expressed as "mean ± standard deviation", and P < 0.05 indicated a significant difference.

[0098] As shown in Table 5, samples were taken immediately after the attack, and there was no significant difference in the weight of broiler chickens in each group (P>0.05). After 7 days, the blank control group and the experimental group were significantly higher than the attack control group (P<0.05). After 14 days, the experimental group and the blank control group were significantly higher than the attack control group and the positive drug group (P<0.05). After 21 days, there was no significant difference between the experimental group and the blank control group (P>0.05), but it was significantly higher than the positive drug group (P<0.05).

[0099] Table 5 Effect of Bacillus paramycoides on body weight of broilers infected with MS Unit: g / chicken

[0100]

[0101] Note: Data in the same column with different letters on their shoulders indicate significant differences ( P <0.05, the same letter or no letter indicates no significant difference ( P >0.05); the same as in the table below.

[0102] As shown in Table 6, the pad thickness of the experimental group was significantly lower than that of the positive drug group (P<0.05), and there was no significant difference from the blank control group (P>0.05); the joint diameter of the experimental group was significantly smaller than that of the attack drug control group (P<0.05), and there was no significant difference from the blank control group (P>0.05).

[0103] Table 6 Effects of Bacillus paramycoides on foot pad thickness and joint diameter of broilers infected with MS Unit: mm

[0104]

[0105] After the virus attack, the serum IgG antibody levels, IL-6 and IL-10 contents increased in all groups except the blank control group, indicating that when the body has inflammation, antibodies and anti-inflammatory factors begin to play a role.

[0106] As shown in Table 7, 7 days after the attack, the experimental group and the positive drug group were significantly higher than the attack control group (P<0.05), and significantly lower than the blank control group (P<0.05); 14 days after the attack, there was no significant difference between the experimental group and the blank control group (P>0.05), and the positive drug group was significantly lower than the blank control group (P<0.05); 21 days after the attack, the experimental group was significantly higher than the positive drug group (P<0.05), and there was no significant difference between the experimental group and the blank control group (P>0.05).

[0107] Table 7 Effect of Bacillus paramycoides on serum IgG antibody levels in broiler chickens infected with MS Unit: mg / L

[0108]

[0109] As shown in Table 8, 7 and 14 days after the challenge, the serum IL-6 level in the experimental group was significantly lower than that in the challenge control group ( P <0.05); after 21 days, the test group was significantly lower than the positive drug group, and there was no significant difference with the blank control group ( P >0.05).

[0110] Table 8 Effect of Bacillus paramycoides on serum IL-6 levels in broilers infected with MS Unit: ng / L

[0111]

[0112] As shown in Table 9, 7 days after the challenge, the serum IL-10 levels in the positive drug group and the test group were significantly higher than those in the blank control group ( P <0.05), there was no significant difference between the test group and the positive drug group ( P >0.05); 14 and 21 days after the attack, the experimental group was significantly higher than the positive drug group ( P <0.05, and significantly higher than the blank control group ( P <0.05).

[0113] Table 9 Effect of Bacillus paramycoides on serum IL-10 levels in broiler chickens infected with MS Unit: ng / L

[0114]

[0115] The results of this study showed that Bacillus paramycoides ( Bacillus paramycoides ) can significantly improve the body's immunity, reduce joint damage, reduce the inflammatory response caused by MS infection, and has a certain preventive and therapeutic effect on synoviae mycoplasma disease.

[0116] The above is only a preferred embodiment of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Bacillus, characterized in that The bacillus is Bacillus paramycoides ( Bacillus paramycoides ), which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number: CGMCC No.31476 and the deposit date being July 26, 2024.

2. A culture of the Bacillus according to claim 1, characterized in that The present invention is a substance obtained by culturing the Bacillus paramycoides described in claim 1 in a microbial culture medium.

3. A bacterial agent, characterized in that: The bacterial agent contains the Bacillus described in claim 1 or the culture described in claim 2.

4. Use of the bacillus as claimed in claim 1 or the culture as claimed in claim 2 in the preparation of a drug for inhibiting Mycoplasma synoviae.

5. A drug for treating chicken synoviae mycoplasma disease, characterized in that: Comprising the Bacillus as claimed in claim 1 or the culture as claimed in claim 2.

6. A poultry feed, characterized in that: It comprises the bacillus as claimed in claim 1 or the culture as claimed in claim 2.

7. A method for culturing the Bacillus according to claim 1, characterized in that: The method comprises the step of culturing the Bacillus paramycoides in a culture medium for culturing Bacillus paramycoides.

8. A method for preparing the bacterial agent according to claim 3, characterized in that: The bacterial agent is obtained by using the Bacillus described in claim 1 and the secretion of the Bacillus described in claim 1 as active ingredients.

Images