A gene related to resistance to white rot of Dendrobium officinale and its application
By identifying and overexpressing the Dendrobium officinale white rot resistance gene Dof013141 and regulating the plant defense mechanism, the problem of white rot infection in Dendrobium officinale was solved, achieving efficient disease resistance and environmentally friendly prevention and control effects for the plant.
Patent Information
- Application Number
- CN202411571781.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-11-06
AI Technical Summary
In the existing technology, white rot has a strong ability to infect plants such as Dendrobium officinale, causing serious economic losses. In addition, the long-term use of chemical fungicides causes environmental pollution and drug resistance problems, and there is a lack of environmentally friendly and sustainable prevention and control measures.
Identify and overexpress the gene Dof013141 related to white rot resistance in Dendrobium officinale. By regulating the plant defense mechanism, construct an overexpression vector and transform the host cells to improve the plant's resistance to white rot.
It significantly enhanced the resistance of Dendrobium officinale to white rot, reduced dependence on chemical agents, provided green prevention and control measures, and improved the growth status and survival rate of plants.
Smart Images

Figure CN119242651B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of plant genetic engineering and agricultural biotechnology, and in particular to a gene related to resistance to white rot of Dendrobium officinale and its application. Background Art
[0002] White rot, also known as white silk disease or sclerotinia disease, is one of the major diseases that seriously threatens the health of plants such as Dendrobium officinale. Regarding the identification of the pathogen of the disease, existing studies have pointed out that the main pathogens causing white rot of Dendrobium officinale are from the subphylum Deuteromycota under the phylum Basidiomycota, specifically Sclerotium rolfsii Sacc. and Sclerotium delphinii Welch. The pathogen is a saprophytic fungus with a wide host range. It prefers high temperature and humid environments and is mainly distributed in grasslands and rainforests in tropical and subtropical regions. Under these hot and humid climatic conditions, the pathogen exhibits extremely strong infectivity and can cause serious damage to a variety of plants, including crops and flowers. For the cultivation industry of Chinese medicinal materials such as Dendrobium officinale, the outbreak of white rot is often accompanied by huge economic losses.
[0003] In the early stages of the disease, white mycelium appears at the base of the stem or on the growing medium. These mycelium gradually spreads to the stem and leaves, causing progressive leaf necrosis. As the disease progresses, the stem begins to rot, gradually bending, and eventually dying. As the disease worsens, hard sclerotia form on the dead leaves and stems, while the stem base and roots also show obvious signs of rotting. This process not only severely impacts plant growth but also causes devastating damage to key plant parts. During the cultivation process of Dendrobium officinale, especially during the hardening and acclimatization phase of tissue culture seedlings, white mycelium is highly susceptible to outbreaks, leading to widespread seedling mortality and heavy economic losses for growers. Due to its rapid spread and potent pathogenicity, white mycelium often severely impacts the entire growing environment in a short period of time, further complicating its prevention and control. This disease not only threatens the yield and quality of Dendrobium officinale but also increases cultivation costs, making it a pressing challenge in the cultivation of Dendrobium officinale.
[0004] Currently, the prevention and control of bacterial rot mainly relies on chemical fungicides. However, the long-term and extensive use of chemical fungicides may not only cause environmental pollution problems, but also promote the development of drug resistance in pathogens, resulting in reduced control effectiveness. Therefore, finding more environmentally friendly and sustainable control measures has become a key research focus. In this context, the study of plant disease resistance genes is particularly important. By screening and cloning genes that resist bacterial rot, it is hoped that new genetic resources will be provided for plant disease resistance breeding, thereby developing greener and safer control methods, reducing reliance on chemical agents, and providing stronger guarantees for the healthy cultivation of crops and Chinese medicinal materials. Summary of the Invention
[0005] Purpose of the Invention: To address the shortcomings of the existing technology, the present invention provides a gene associated with resistance to white rot in Dendrobium officinale. The present invention identifies a new gene, Dof013141, associated with white rot resistance in Dendrobium officinale. Overexpression of this gene in a plant material can significantly improve the plant's resistance to white rot. The Dof013141 gene of the present invention significantly improves the plant's resistance to white rot by regulating the plant's internal defense mechanisms. This provides an important genetic resource for the cultivation of disease-resistant plants and offers technical support for the selection and breeding of white rot-resistant Dendrobium officinale varieties.
[0006] The present invention also provides application of the gene related to the resistance to white rot of Dendrobium officinale.
[0007] Technical solution: To achieve the above-mentioned purpose of the invention, the present invention provides a gene Dof013141 related to resistance to white rot of Dendrobium officinale, and the CDS sequence of the gene Dof013141 is shown in SEQ ID NO.1.
[0008] Among them, the genes also include genes encoding proteins with similar structural domains as SEQ ID NO. 1, which are highly similar to the Dof013141 gene in structure and function.
[0009] Among them, the primers used to amplify the full-length CDS sequence of the gene Dof013141 are:
[0010] Dof013141-F:ATGGAAGTACATGGAGGAGCA
[0011] Dof013141-R: CTATTGTTGTAATAGCAAAAATCTTCC.
[0012] The Dendrobium officinale white rot resistance-related gene Dof013141 overexpression vector pCAMBIA1301-35SN-Dof013141 of the present invention.
[0013] Wherein, the overexpression vector construction method is:
[0014] Primers for amplifying the CDS gene of the gene Dof013141 were designed, and the CDS gene of the gene Dof013141 was used as a template for amplification. The amplified product was ligated into the plant expression vector pCAMBIA1301-35SN, and then transformed and the plasmid was extracted to finally obtain the overexpression vector pCAMBIA1301-35SN-Dof013141.
[0015] The nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO.2.
[0016] The host cell of the present invention uses Agrobacterium as the starting strain, which contains the overexpression vector pCAMBIA1301-35SN-Dof013141.
[0017] The invention discloses an application of the gene Dof013141, the overexpression vector or the host cell in improving the resistance of Dendrobium officinale to white rot.
[0018] Among them, the resistance of Dendrobium officinale to white rot was improved by overexpressing the Dof013141 gene.
[0019] The invention relates to the use of the gene Dof013141, the overexpression vector or the host cell in cultivating Dendrobium officinale plants resistant to white rot.
[0020] The present invention verifies the overexpression of the Dof013141 gene in Dendrobium officinale and its anti-straight rot effect. The present invention verifies the effect of overexpressing the Dof013141 gene in Dendrobium officinale on improving resistance to straight rot and describes in detail the specific operating steps of the genetic engineering method.
[0021] 1. Acquisition of Dof013141 gene and vector construction
[0022] Firstly, total RNA was extracted from Dendrobium officinale, and the full-length cDNA sequence of Dof013141 gene was obtained by reverse transcription-PCR amplification.
[0023] The Dof013141 gene was cloned into the plant expression vector pCAMBIA130 and driven by the 35S promoter to express it efficiently. After the construction was completed, the recombinant vector was extracted using a plasmid extraction kit for use in transformation.
[0024] 2. Plant transformation and overexpression of Dof013141 gene
[0025] The Dof013141 gene was introduced into the leaves of Dendrobium officinale using the Agrobacterium-mediated method. The specific steps are as follows: Use a 1mL needle to gently make a small hole on the back of the Dendrobium officinale leaf (be careful not to puncture it), then use a syringe with the needle removed to absorb the bacterial solution and inject it into the leaf from the wound (press the front of the leaf with your finger to allow the bacterial solution to penetrate from the back of the leaf). Use a marker to mark the water-soaked area of the Dendrobium officinale leaf. The injected plants were placed in the dark for 12 hours, then cultured at around 26°C, and leaf samples were collected on the third day after introduction. PCR and qRT-PCR methods were used to verify the expression level of the Dof013141 gene in the leaves of Dendrobium officinale, confirming the high level of expression of the gene.
[0026] 3. Sclerotinia rot resistance test
[0027] In order to test the resistance effect of the Dof013141 gene to white rot, the control group (non-transgenic Dendrobium officinale plants) and the experimental group (Dof013141 transgenic plants) were placed under the same conditions for artificial inoculation experiments.
[0028] The specific steps are as follows:
[0029] An overexpression plasmid carrying the Dof013141 gene was introduced into leaves of Dendrobium officinale. Twenty-four hours later, the leaves were inoculated with neat, 5 mm diameter pieces of Sclerotium mycelium. Following inoculation, the plants were placed in a constant-temperature incubator to maintain appropriate humidity and temperature to monitor the onset and progression of the disease. Symptoms, including the number and area of lesions and the rate of disease progression, were recorded three days after inoculation.
[0030] 4. Experimental results
[0031] On the third day after inoculation, the Dendrobium officinale plants in the control group showed obvious symptoms of white rot, including lesions at the inoculated fungus blocks on the leaves, leaf wilting and necrosis, while the Dof013141 transgenic plants showed stronger disease resistance, with a significant reduction in the number and area of lesions and better plant growth.
[0032] 5. Summary
[0033] The experimental results showed that overexpression of the Dof013141 gene in Dendrobium officinale significantly improved the plant's resistance to white rot. This example demonstrates the effectiveness of the Dof013141 gene as a disease resistance gene in Dendrobium officinale and demonstrates its potential for application in disease resistance breeding.
[0034] The present invention isolates and identifies the gene Dof013141, which is associated with resistance to white rot in Dendrobium officinale. The CDS nucleotide sequence of this gene is shown in SEQ ID NO. 1. The Dof013141 gene significantly enhances Dendrobium officinale's resistance to white rot by regulating the plant's internal defense mechanisms, providing an important genetic resource for the cultivation of disease-resistant plants. The full-length CDS sequence of Dof013141 can be artificially synthesized by first synthesizing the encoding gene and then expressing it biologically. The present invention first chemically synthesizes the complete encoding gene and then achieves efficient gene expression in an organism using an appropriate expression system. This process provides a feasible technical path for the large-scale production and application of this gene, facilitating the synthesis and expression of disease-resistant proteins. Genes encoding proteins with similar domains in other plants also fall within the scope of protection of the present invention. These genes, although derived from different plants, share a high degree of structural and functional similarity with the Dof013141 gene and are capable of exerting disease resistance in related plants. Therefore, they also fall within the scope of protection of the present invention. The present invention also provides recombinant vectors or recombinant microorganisms containing the Dof013141 gene, and protects recombinant vectors or recombinant microorganisms containing the Dof013141 gene. These recombinants can express the gene in suitable hosts, thereby producing proteins associated with resistance to southern rot, and are suitable for genetic improvement, breeding, and other scientific research applications in plants. Recombinant vectors and microorganisms containing the gene can not only be used to improve plant disease resistance but also have broad application value in the field of plant biotechnology.
[0035] The Dof013141 gene of the present invention is used to regulate and enhance the resistance of Dendrobium officinale to white rot; specifically, overexpression of this gene enhances the resistance of Dendrobium officinale to white rot. Therefore, the gene of the present invention can be combined with a plant overexpression promoter, introduced into a suitable expression vector, and transformed into a host plant, thereby altering white rot resistance and regulating plant yield.
[0036] The present invention provides a novel Dendrobium officinale gene, Dof013141, for resistance to white rot and its wide application. Overexpression of this gene in Dendrobium officinale through genetic engineering significantly enhances the plant's resistance to white rot, greatly improving the plant's disease resistance and survival rate, thereby reducing yield losses caused by the disease. By isolating and screening the Dof013141 gene, the present invention successfully overcomes the environmental pollution and drug resistance issues associated with traditional chemical control methods. Gene overexpression not only effectively reduces reliance on chemical agents but also provides a new technical solution for green, sustainable agricultural disease prevention and control. The Dof013141 gene has broad application prospects. In addition to its successful performance in Dendrobium officinale, it can also be extended to disease-resistant breeding programs for other susceptible plants, further broadening its application in agricultural production and plant protection. This invention not only provides a strong guarantee for improving the yield and quality of Dendrobium officinale but also opens up new research directions for the development and utilization of plant disease-resistance genes, with great economic and social value.
[0037] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0038] The present invention identifies a novel gene, Dof013141, associated with resistance to white rot in Dendrobium officinale, providing a new genetic resource for molecular genetic improvement of white rot resistance. Furthermore, the present invention obtains new Dendrobium officinale germplasm with enhanced resistance to white rot. Through genetic transformation, the present invention obtains a mutant overexpressing the Dof013141 gene in Dendrobium officinale. Compared with the control, the overexpressing mutant exhibits significantly enhanced resistance to white rot.
[0039] This invention uses molecular biological methods to clone a gene, Dof013141, and demonstrates its function in regulating resistance to white rot in Dendrobium officinale. The Dof013141 gene has broad application prospects. In addition to its successful demonstration in Dendrobium officinale, it can also be applied to disease-resistant breeding programs in other susceptible plants, further broadening its application in agricultural production and plant protection. This invention not only provides a strong guarantee for improving the yield and quality of Dendrobium officinale, but also opens up new research directions for the development and utilization of plant disease-resistance genes, with great economic and social value. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] Figure 1 Agarose gel electrophoresis was performed to verify the recombinant plasmid.
[0041] Figure 2 This is a bar graph of the expression level of gene Dof013141.
[0042] Figure 3 This is a picture of the plant overexpressing gene Dof013141.
[0043] Figure 4 Statistical graph of resistance data.
[0044] Figure 5 To overexpress the disease resistance of Dendrobium officinale. DETAILED DESCRIPTION
[0045] The present invention will be further described below with reference to the accompanying drawings and examples.
[0046] Unless otherwise specified, the reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.
[0047] The cultivated Dendrobium officinale seedlings used in the present invention were collected from Anhui, China and were identified as conventional cultivated Dendrobium officinale. The cultivated Dendrobium officinale seedlings were preserved and provided by the Institute of Plant Resources and Environment, School of Life Sciences, Nanjing Normal University.
[0048] The plant expression vector pCAMBIA1301-35SN was purchased from Shanghai Hewu Biotechnology Co., Ltd., and its sequence is shown in SEQ ID NO.2.
[0049] Example 1
[0050] Cloning of gene Dof013141 and construction of overexpression vector
[0051] 1. Standard molecular biology techniques were used for gene cloning and vector construction. First, total RNA was extracted from healthy, one-year-old tissue-cultured Dendrobium officinale seedlings using the EASY SpinPlant RNA Kit (Aidlab, China). The extracted RNA was then transcribed into cDNA using reverse transcription to provide a template for subsequent gene amplification. The full-length CDS sequence of the Dof013141 gene was amplified using PCR. The primer design used is detailed in Table 1, and the PCR cycle reaction system and parameters are shown in Table 2.
[0052] Table 1: Primers used for PCR amplification of the full-length cDNA of the Dof013141 gene
[0053] Primer name Primer sequence 5' to 3' Dof013141-F ATGGAAGTACATGGAGGAGCA Dof013141-R CTATTGTTGTAAATAGCAAAAATCTTCC
[0054] Table 2: PCR Cycling System
[0055]
[0056] The PCR amplification product was recovered and purified, and sequenced. The nucleotide sequence encoded by the Dof013141 gene of the present invention is shown in SEQ ID NO. 1, and its size is 843 bp.
[0057] 2. The amplified Dof013141 gene was subsequently cloned into the plant expression vector pCAMBIA1301-35SN, selected as a tool for gene overexpression. The 35S promoter in the vector efficiently drives target gene expression. The nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO. 2. During vector construction, XbaⅠ and BamHI endonucleases were used for restriction digestion to ensure that the Dof013141 gene was correctly inserted into the vector's multiple cloning site. The restriction digestion reaction system for the linearized vector is shown in Table 3. Through homologous recombination, an overexpression vector was successfully constructed and will be used in subsequent experiments with Dendrobium officinale to verify the Dof013141 gene's function in resisting white rot.
[0058] Table 3: Enzyme digestion system
[0059] Components volume pCAMBIA1301-35SN 2 μg 10×rCutSmart 5μL XbaⅠ 1 μL Bam HI 1 μL <![CDATA[ddH2O]]> Make up to 50 μL
[0060] Specific method for constructing overexpression vector:
[0061] Primers for vector construction were designed based on the CDS region of the Dof013141 gene. The designed primer sequences were used to amplify the CDS sequence with the vector homology fragment:
[0062] CZDof013141-F: TGGCGGCCGCTCTAGATGGAAGTACATGGAGGAGCACZDof013141-R: GCAGCCCGGGGGATCCTATTGTTGTAAATAGCAAAAA TCTTCC
[0063] First, the CDS sequence of the Dof013141 gene was used as a template for PCR amplification using PrimerSTAR high-fidelity enzyme to obtain the product. The reaction system was 50 μL, including 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture, 1 μL of CZDof013141-F primer, 1 μL of CZDof013141-R primer, 32.5 μL of ddH2O, 1 μL of template, and 0.5 μL of PrimerSTAR high-fidelity enzyme. The reaction procedure was 95°C for 5 min; 95°C for 15 sec, 55°C for 15 sec, and 72°C for 15 sec, for 35 cycles; and 72°C for 5 min. The homologous recombination kit ( The purified PCR product was recombined and ligated with the linearized vector containing XbaⅠ and BamHI endonucleases using the Ⅱ One Step Cloning Kit. To 10μL of the recombination and ligation system, 2μL of 5×CE II Buffer, 1μL of the purified PCR product, 1μL of the pCAMBIA1305.4 vector fragment digested with BamHI, 1μL of the recombinase Exnase II, and 5μL of sterile water were added. The mixture was mixed and ligated at 37℃ for 30min.
[0064] Remove competent E. coli DH5α cells from a -80°C freezer and thaw naturally on ice to ensure viability. Once the cells are completely thawed, carefully add 10 μL of the recombinant plasmid to 100 μL of competent E. coli. Be careful not to pipette during this procedure to avoid damaging the cells. Let the mixture sit on ice for 30 minutes to allow the plasmid to fully enter the competent cells. Next, heat shock the tube in a 42°C water bath for 45 seconds. This step briefly increases cell membrane permeability, facilitating plasmid entry. After the heat shock, immediately transfer the tube to ice and let it cool for 2 minutes to restore cell stability. Then, add 900 μL of antibiotic-free LB medium to the tube and mix gently to ensure rapid cell growth without selective pressure. Incubate the tube on a shaker at 37°C, 230 rpm, for 1 hour to promote cell recovery and initial plasmid amplification. After recovery is complete, the culture is centrifuged at 5000rpm for 5 minutes, 900μL of supernatant is discarded, and only 100μL of culture medium is retained. Use the remaining culture medium to resuspend the cells, and then evenly spread them on LB solid culture medium containing kanamycin, and use the selective pressure of kanamycin to screen the successfully transformed strains. Invert the culture dish and place it in a 37°C incubator for 12-16 hours until single colonies appear. Pick up individual colonies from the culture dish and transfer them to 2mL centrifuge tubes containing 800μL LB liquid culture medium and kanamycin (one tube for each colony). Place the centrifuge tube on a shaker at 37°C and 230rpm and culture for 24 hours to expand the amount of bacterial solution. After the culture is completed, 2μL of bacterial solution is aspirated from each centrifuge tube for PCR verification of amplification. The specific PCR cycle system is shown in Table 2, and the primer sequences used are shown in Table 4. The PCR products were then sequenced to ensure the correctness of the recombinant vector. The agarose gel electrophoresis diagram for recombinant plasmid verification is shown below. Figure 1 After successful sequencing verification, the bacterial suspension was added to 60% glycerol, quickly frozen using liquid nitrogen, and stored in an ultra-low temperature freezer at -80°C for long-term storage.
[0065] Through the above steps, the E. coli transformation, amplification, verification and preservation of the recombinant plasmid were successfully completed, providing a reliable bacterial solution resource for subsequent experiments.
[0066] Table 4: Verification primer sequences
[0067] Primer name Primer sequence 5' to 3' OX-F1 GAGAACACGGGGGACTCTAG OX-R1 GCCAAATGTTTGAACGATCTGC
[0068] Example 2
[0069] The recombinant vector was transformed into competent Agrobacterium to introduce the constructed vector into the leaves of Dendrobium officinale. In this example, Agrobacterium competent cells were used for transformation to introduce the recombinant plasmid for subsequent experiments. The operation steps are as follows:
[0070] First, take about 1 μg of the recombinant plasmid DNA constructed in Example 1 and add it to 200 μL of Agrobacterium competent EHA105, mix gently and place it on ice for 30 minutes. In order to ensure the repeatability of the experiment, prepare 4 tubes of competent Agrobacterium for parallel operation. Subsequently, place the cells in a 37°C air bath and heat them for 5 minutes to promote the entry of plasmid DNA. Next, quickly place the centrifuge tube on ice to cool for a moment, and then perform liquid nitrogen quick freezing for 10 seconds. This step helps to enhance the efficiency of plasmid transformation. After quick freezing, place the centrifuge tube back in the 37°C air bath and heat it for 5 minutes, then immediately place it back on ice to cool.
[0071] Next, add 1 mL of antibiotic-free LB medium to each tube of competent cells. After gentle mixing, incubate at 30°C for 3 hours to allow cells to recover and plasmid expression. After recovery, centrifuge the culture at 4°C and 5000 rpm for 5 minutes. Discard 1 mL of supernatant, retaining only a small amount of medium. Gently resuspend the cells in the remaining medium and then plate onto solid LB medium supplemented with rifampicin and kanamycin. Incubate the culture dish in a 30°C incubator for 3 days until a single colony appears. Pick a single colony from the LB solid medium and transfer it to a 2 mL centrifuge tube containing liquid LB medium supplemented with rifampicin and kanamycin. Incubate the culture medium on a shaker at 30°C and 230 rpm for 36 hours to obtain a sufficient number of Agrobacterium cells. After incubation, aspirate 2 μL of the culture medium from each tube for PCR verification. The PCR reaction system is shown in Table 2, and the verification primer sequences used are shown in Table 4. The amplified PCR products are sequenced to confirm the authenticity of the plasmid DNA. Once the bacterial suspension is confirmed to be correct, it will be added to 50% glycerol, snap-frozen in liquid nitrogen, and stored in a -80°C freezer for subsequent experiments. PCR reaction system: 25 μL 2× Rapid Taq Master Mix, 22 μL double-distilled water, 1 μL each primer, and 2 μL bacterial suspension.
[0072] Through this step, the Agrobacterium transformation, amplification and preservation of plasmid DNA were successfully achieved, providing a stable and reliable strain resource for subsequent plant transgenic experiments.
[0073] Use a 1mL needle to gently poke a small hole on the back of a healthy, about 3-year-old Dendrobium officinale leaf (be careful not to puncture it), then use a syringe with the needle removed to draw up the bacterial solution and inject it into the leaf from the wound (press the front of the leaf with your finger to allow the bacterial solution to penetrate from the back of the leaf). Use a marker to mark the water-soaked area on the Dendrobium officinale leaf. Figure 3 The injected plants were placed in the dark for 12 hours and then cultured at around 26°C. Leaf samples were collected on the third day after injection. PCR and qRT-PCR were used to verify the expression level of the Dof013141 gene in the leaves of D. officinale, confirming the high expression level of the gene.
[0074] (1) Select healthy, approximately three-year-old leaves for injection. Young or shrunken leaves are difficult to inject, and expression efficiency is lower in older leaves. Injection is easier when the leaves' stomata are open, so injection is best done during the day. (2) The concentration of the Agrobacterium solution should be OD600 = 1.0. Higher concentrations may cause leaf death or affect fruiting.
[0075] Then, use qPCR was performed using III RT SuperMix (Vazyme, China). Primers were designed using Snapgene software. qRT-PCR was performed on an ABI-7500 real-time fluorescence quantitative PCR detection system. The reaction mixture contained 1 μL template, the final volume was 20 μL, and the cDNA was diluted to 200 ng. Each experiment was repeated three times. The PCR amplification conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and finally an extension at 60°C for 15 s. The expression data were calculated using the 2^-ΔΔCT method. GAPDH was the internal reference gene. The expression level of the Dof013141 gene in overexpressed plant tissues was quantitatively analyzed using qRT-PCR technology, as shown in Figure 5. Figure 2 The results show that the gene is significantly up-regulated when the plant is infected by Sclerotium rolfsii. The primer sequences are listed in Table 5.
[0076] Table 5: qRT-PCR primer sequences
[0077] Primer name Primer sequence 5' to 3' Dof013141-F AGCGAGGAGGAGATGGAGCT Dof013141-R GGAGATAGTTCAGCCACCGAAG GAPDH-F TTCGGAAGGATTGGAAGGCTTGTAG GAPDH-R GAGATGATAACCTTCTTGGCACCGC
[0078] Example 3
[0079] To test the resistance of the Dof013141 gene to white rot, a control group (non-transgenic Dendrobium officinale plants) and an experimental group (Dof013141 transgenic plants) were placed under the same conditions for an artificial inoculation experiment. The specific steps are as follows:
[0080] The overexpression plasmid carrying the Dof013141 gene successfully constructed in Example 2 was introduced into the leaves of Dendrobium officinale, and cultured in the dark in an incubator for 24 hours at a temperature of 25°C to fully express the gene in the leaf cells. Subsequently, neat blocks of Sclerotium mycelium with a diameter of 5 mm were used as pathogens and inoculated on the surface of the transformed Dendrobium officinale leaves to observe their disease resistance. After inoculation, the plants were placed in a constant temperature incubator at a temperature of 28°C. A small amount of water was sprayed on the leaf surface every day to maintain a certain humidity in order to observe the occurrence and development of the disease. The symptoms of the plants were recorded on the third day after inoculation, including the number and area of lesions and the speed of disease progression. The experimental results showed that on the third day after inoculation, the lesion area of the leaves of Dendrobium officinale that overexpressed the Dof013141 gene was significantly smaller than that of the leaves of the control group (WT) after inoculation with the pathogen. The Dendrobium officinale plants in the control group showed obvious symptoms of white rot, including lesions at the inoculated bacteria block on the leaves, leaf wilting and necrosis, while the Dof013141 transgenic plants showed stronger disease resistance, with a significant reduction in the number and area of lesions and better plant growth. This shows that the overexpression of this gene significantly enhanced the resistance of Dendrobium officinale to white rot. This result further verified the important role of the Dof013141 gene in regulating plant disease resistance. The specific experimental data and lesion area comparison are shown in Table 6. Figure 4 and Figure 5 . The experimental results showed that after the Dof013141 gene was overexpressed in Dendrobium officinale, the plant's resistance to white rot was significantly improved. This example demonstrated the effectiveness of the Dof013141 gene as a disease-resistant gene in Dendrobium officinale and demonstrated its potential for application in disease-resistant breeding. This experiment provides strong evidence for the Dof013141 gene as a functional gene for resistance to white rot, highlights its potential in improving the disease resistance of Dendrobium officinale, and provides a scientific basis for future variety improvement and disease resistance mechanism research.
[0081] The white rot resistance gene Dof013141 provided by the present invention has demonstrated its potential for wide application in Dendrobium officinale and other susceptible plants, opening up a new path for disease-resistant breeding. Through the application of this gene, not only can the resistance of plants to white rot be significantly improved, but also a more environmentally friendly and efficient solution is provided for the green prevention and control of plant diseases. As an important tool in plant disease resistance research, the Dof013141 gene not only helps to deeply analyze the disease resistance mechanism of plants, but also can promote its genetic improvement in a variety of economic crops. In the future, this gene is expected to be widely used in agricultural production, not only to improve the disease resistance of crops, but also to reduce the use of chemical pesticides and achieve the goal of sustainable agricultural development. This invention provides innovative genetic resources and research directions for the fields of plant breeding and disease control.
[0082] Table 6: Statistics of the lesion area of Dendrobium officinale leaves
[0083]
Claims
1. A gene related to resistance to white rot in Dendrobium officinale Dof013141 , characterized in that, The gene Dof013141 The CDS sequence is shown in SEQ ID NO.
1.
2. A gene containing the Dendrobium officinale white rot resistance gene according to claim 1 Dof013141 Overexpression vector pCAMBIA1301-35SN- Dof013141 The nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO.
2.
3. A host cell, characterized in that The host cell is Agrobacterium as the starting strain, which contains the overexpression vector pCAMBIA1301-35SN- Dof013141 .
4. A gene according to claim 1 Dof013141 Or the use of the overexpression vector according to claim 2 or the host cell according to claim 3 in improving the resistance of Dendrobium officinale to white rot, by overexpressing Dof013141 Genes to improve the resistance of Dendrobium officinale to white rot.
5. A gene according to claim 1 Dof013141 Or use of the overexpression vector according to claim 2 or the host cell according to claim 3 in cultivating Dendrobium officinale plants resistant to white rot.
Citation Information
Patent Citations
Dendrobium officinale Dc4CLL8 gene and application thereof in enhancing southern blight resistance of plants
CN117004627A
Dendrobium officinale gene for regulating and controlling plant southern blight resistance and application thereof
CN117417942A