Method for improving high temperature tolerance and gray mold resistance of tomatoes, SlWRKY5 overexpression vector and its application
By overexpressing the SlWRKY5 gene in tomatoes, the problem of growth damage to tomatoes under high temperature and gray mold stress was solved, and the heat tolerance and disease resistance were significantly improved, and the resistance to gray mold was enhanced.
Patent Information
- Application Number
- CN202411655825.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-11-19
AI Technical Summary
Tomatoes show severe growth damage and disease under high temperature and gray mold stress, and existing technologies are difficult to effectively improve their heat tolerance and disease resistance.
By overexpressing the SlWRKY5 gene in tomatoes, regulating its expression using a SlWRKY5 overexpression vector, constructing a SlWRKY5 overexpression vector and transforming competent cells, the vector was then used to infect tomato plants to improve heat tolerance and resistance to gray mold.
It significantly improves the heat resistance of tomatoes and their resistance to gray mold, reduces the electrical conductivity and the generation of active oxygen at high temperatures, and enhances resistance to gray mold.
Smart Images

Figure CN119242702B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for improving the high temperature resistance and gray mold resistance of tomatoes, and a SlWRKY5 overexpression vector and application thereof. Background Art
[0002] Tomato (Solanum lycopersicum L.) is one of the important vegetable crops in my country, with an annual cultivation area of more than 1 million hectares. 2 , and China's fresh tomato production ranks first in the world. However, tomatoes are a crop that is sensitive to temperature and disease. In my country's tomato production facilities, they are often harmed by high temperatures and aggravated by diseases, causing serious economic losses to tomato production.
[0003] The ideal growth temperature for tomato seedlings during their growth period is approximately 24-26°C during the day and around 18°C at night. Typical varieties are damaged at daytime temperatures of 34°C and nighttime temperatures above 20°C. When temperatures rise to 38°C during the day or above 26°C at night, tomatoes are severely damaged. High temperatures during the flowering and fruiting period reduce pollen viability, expose stigmas, and reduce fruit set, resulting in a significant decrease in yield and quality. When temperatures rise, plant transpiration intensifies, leading to significant water loss and an imbalance in water balance within the plant, causing leaf wilting, hindered photosynthesis, and slowed growth. Under high temperature stress, cells produce large amounts of reactive oxygen species (ROS), causing peroxidation of membrane lipids and proteins. The resulting malondialdehyde further exacerbates cell membrane damage and, in severe cases, can even lead to cell death.
[0004] In high-temperature and high-humidity environments, tomatoes are also highly susceptible to gray mold, a necrotic fungus whose pathogen is Botrytis cinerea. It spreads primarily through its conidia, making it a common disease in greenhouse cultivation and difficult to prevent and control in production. When the environment is suitable, gray mold invades the host through young, weak tissues or wounds, achieving initial infection. A gray mold layer forms after the disease develops. As the pathogen progresses, leaves develop water-soaked, irregularly edged, light brown or yellowish-brown lesions. The skin of infected fruits turns grayish-white, the flesh becomes water-soaked and soft-rotted, and a fuzzy gray mold layer grows on the lesions. The losses caused by gray mold infection in tomatoes are very serious, causing serious damage from the initial seedling growth to the final fruit transportation and sales.
[0005] Using modern molecular biotechnology to identify heat- and disease-resistant tomato genes and modulate their expression is an important approach for breeding new stress- and disease-resistant tomato varieties. WRKY transcription factors participate in a variety of plant biological processes, playing a particularly important role in regulating biotic and abiotic stresses. The SlWRKY5 transcription factor, a member of the WRKY transcription factor family, warrants exploration of its functions to enhance heat tolerance and gray mold resistance in tomato cultivation. Summary of the Invention
[0006] To develop applications of the SlWRKY5 transcription factor for improving tomato heat tolerance and gray mold resistance in tomato cultivation, the present invention provides methods for improving heat tolerance and gray mold resistance in tomatoes, as well as SlWRKY5 overexpression vectors and applications. Overexpressing the SlWRKY5 gene significantly improves heat tolerance and enhances resistance to gray mold in tomatoes.
[0007] The present invention provides an application of a preparation for overexpressing the SlWRKY5 gene in tomato cultivation. The preparation for overexpressing the SlWRKY5 gene improves the heat tolerance of tomatoes and enhances the resistance of tomatoes to gray mold through overexpression of the SlWRKY5 gene.
[0008] The present invention regulates the overexpression of the SlWRKY5 gene in tomatoes, thereby enhancing the heat resistance of tomatoes and improving the resistance to gray mold.
[0009] Furthermore, the preparation for overexpressing the SlWRKY5 gene is a SlWRKY5 overexpression vector. By constructing the SlWRKY5 overexpression vector, competent cells are transformed and then infected into tomato plants, thereby improving the heat tolerance of tomatoes and enhancing the resistance of tomatoes to gray mold.
[0010] Furthermore, the process of infecting tomato plants is: infecting tomato cotyledons with the Agrobacterium strain containing the SlWRKY5 overexpression vector.
[0011] Furthermore, the preparation for overexpressing the SlWRKY5 gene contains the SlWRKY5 overexpression vector as the only active ingredient.
[0012] Furthermore, the SlWRKY5 overexpression vector was constructed by recombining the SlWRKY5 gene fragment shown in SEQ ID NO. 1 with the linearized pHellsgate8 vector.
[0013] Furthermore, the primers for amplifying the SlWRKY5 gene fragment are the SlWRKY5-OE-FW primer shown in SEQ ID NO.2 and the SlWRKY5-OE-RV primer shown in SEQ ID NO.3.
[0014] The present invention also provides a method for constructing a SlWRKY5 overexpression vector, comprising the following steps:
[0015] Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO. 2 and SEQ ID NO. 3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment;
[0016] The PCR amplification reaction system is as follows: 1 μL of 1 U / μL Phanta Max Super-Fidelity DNA Polymerase; 25 μL of 2× Phanta Max Buffer; 2 μL of 10 μM upstream primer; 2 μL of 10 μM downstream primer; 1 μL of DNA template; 1 μL of dNTP Mix; and 50 μL of ddH2O.
[0017] The SlWRKY5 gene fragment and the linearized pHellsgate8 vector were recombined to obtain the SlWRKY5 overexpression vector;
[0018] The recombination system of SlWRKY5 gene fragment and linearized pHellsgate8 vector is as follows: 40 ng of linearized vector, 6 ng of SlWRKY5 gene fragment recovery product, 1 ul of ExnaseII, 2 ul of 2×CE II Buffer, and ddH2O supplemented to 10 ul.
[0019] The present invention also provides a SlWRKY5 overexpression vector obtained by the construction method.
[0020] The present invention also provides a method for improving the high temperature resistance and gray mold resistance of tomatoes, comprising the following steps:
[0021] Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO. 2 and SEQ ID NO. 3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment;
[0022] The SlWRKY5 overexpression vector was obtained by recombining the SlWRKY5 gene fragment and the linearized pHellsgate8 vector;
[0023] The SlWRKY5 overexpression vector was heat-shocked into competent Escherichia coli cells, and positive clones were screened and recombinant plasmids were extracted. The recombinant plasmids were then transformed into Agrobacterium C58 to obtain the Agrobacterium strain containing the SlWRKY5 overexpression vector.
[0024] Tomato cotyledons were infected with Agrobacterium strains containing the SlWRKY5 overexpression vector to construct transgenic tomato plants that were resistant to heat and gray mold.
[0025] Furthermore, the PCR amplification program was as follows: preliminary denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] The present invention improves heat tolerance and resistance to Botrytis cinerea in tomatoes by regulating overexpression of the SlWRKY5 gene. The SlWRKY5 transcription factor from tomatoes was cloned and overexpressed in tomatoes. Under high temperature stress, SlWRKY5-overexpressing plants exhibited significant heat tolerance compared to wild-type tomato varieties, including Ailsa Craig (AC). Stress-related indicators such as relative conductivity, malondialdehyde content, and reactive oxygen species were significantly lower than those of the AC variety. When SlWRKY5 transgenic plants were infected with Botrytis cinerea, the SlWRKY5-overexpressing plants exhibited enhanced resistance to the fungus.
[0028] The present invention develops a new use of the SlWRKY5 gene in tomatoes. Overexpression of the SlWRKY5 gene significantly improves the heat tolerance of tomatoes and enhances the resistance of tomatoes to gray mold. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0030] Figure 1 The morphology, expression level and target detection of SlWRKY5 transgenic plants;
[0031] In the figure, a shows the morphology of SlWRKY5 transgenic plants;
[0032] b Detection of SlWRKY5 expression in SlWRKY5 transgenic plants;
[0033] c shows the target detection results of SlWRKY5 knockout plants;
[0034] d is the plant height statistics of SlWRKY5 transgenic plants.
[0035] Figure 2The morphology of AC and SlWRKY5 transgenic plants before and after high temperature treatment at 42℃.
[0036] Figure 3 These are the physiological indicators of AC and SlWRKY5 transgenic plants at different time points after high temperature treatment at 42℃;
[0037] In the figure, a is the electrical conductivity (REC) data of SlWRKY5 transgenic plants at different time points after high temperature treatment at 42°C;
[0038] b shows the malondialdehyde (MDA) data of SlWRKY5 transgenic plants at different time points after high temperature treatment at 42°C;
[0039] c is the DAB staining of the leaves of SlWRKY5 transgenic plants before and after high temperature treatment at 42°C;
[0040] d shows the NBT staining of the leaves of SlWRKY5 transgenic plants before and after high temperature treatment at 42°C.
[0041] Figure 4 The susceptibility of AC and SlWRKY5 transgenic plants to Botrytis cinerea 3 days after treatment. DETAILED DESCRIPTION
[0042] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.
[0043] Example 1: Application of overexpression of SlWRKY5 gene in tomato cultivation.
[0044] 1. Experimental Materials
[0045] The tomatoes used were common cultivated tomatoes Ailsa Craig (AC), purchased from the Tomato Genetic Resource Center (TGRC), website: https: / / tgrc.ucdavis.edu / .
[0046] Escherichia coli Trans1-T1 was purchased from Beijing Quanshijin Biotechnology Co., Ltd.
[0047] Agrobacterium strain C58 was purchased from Yangling Jinbairui Biotechnology Co., Ltd.
[0048] The backbone vector of the SlWRKY5 gene overexpression vector is pHellsgate8 vector, which is described in the literature “Li GB, Wang JF, Zhang CL, Ai G., Zhang DD, Wei J, Cai LY, Li CB, Zhu WZ, Robert ML, Zhang JH * .L2,a chloroplast metalloproteinase,regulates fruit ripening byparticipating in ethylene autocatalysis under the control of ERFs.Journal of Experimental Botany,2021,72(20):7035-7048".
[0049] The PTX041 and 043 vectors are described in the document “Deng, L., Wang, H., Sun, C., Li, Q., Jiang, H., Du, M., Li, C.-B., Li, C., Efficient generation of pink-fruited tomatoes using CRISPR / Cas9 system, Journal of Genetics and Genomics (2017), doi: 10.1016 / j.jgg.2017.10.002.”
[0050] 2. Construction of SlWRKY5 overexpression vector and SlWRKY5 knockout expression vector
[0051] 1. Construction of SlWRKY5 overexpression vector
[0052] (1) Cloning of the tomato SlWRKY5 gene
[0053] The cDNA sequence of the SlWRKY5 gene was found in the tomato genome database SNG website (http: / / solgenomics.net / ), as shown in SEQ ID NO. 1. Primers for amplification of the SlWRKY5 gene were designed using Snap Gene software. pHellsgate8 vector-specific homologous recombination arms were added to the 5' ends of the designed primers. The upstream and downstream primer sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.
[0054] SEQ ID NO.1:
[0055]
[0056] SlWRKY5-OE-FW (SEQ ID NO. 2):
[0057] CATTTGGAGAGGACACGCTCGAGATGGGGGAAAACTTCAAAGCT;
[0058] SlWRKY5-OE-RV (SEQ ID NO. 3):
[0059] TCTCATTAAAGCAGGACTCTAGACTACACTTGTATTTCACTGGTATGA.
[0060] Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO. 2 and SEQ ID NO. 3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment with a length of 1461 bp, namely the SlWRKY5 gene fragment.
[0061] The reaction system for PCR amplification is: 1 μL of Phanta Max Super-Fidelity DNA Polymerase (1 U / μL); 25 μL of 2× Phanta Max Buffer; 2 μL of upstream primer (10 μM); 2 μL of downstream primer (10 μM); 1 μL of DNA template; 1 μL of dNTP Mix; and up to 50 μL of ddH2O.
[0062] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min.
[0063] (2) Construction of SlWRKY5 overexpression vector
[0064] The amplified SlWRKY5 gene fragment with a length of 1461 bp shown in SEQ ID NO. 1 and the linearized pHellsgate8 vector were recombined using the homologous recombinase Exnase II (Novozymes, Nanjing) to obtain a recombinant vector.
[0065] The reaction system for recombination and ligation was as follows: 40 ng of linearized vector, 6 ng of recovered SlWRKY5 gene fragment, 1 ul of Exnase II, 2 ul of 2×CE II Buffer, and ddH2O added to 10 ul. The reaction conditions were: 37°C for 30 min.
[0066] The recombinant vector was heat-shock transformed into competent E. coli cells, and the bacterial solution PCR detection was performed. The primers used in the bacterial solution PCR detection were 35S shown in SEQ ID NO.4 and gat8-RV shown in SEQ ID NO.5.
[0067] SEQ ID NO.4(35S): ACGCACAATCCCACTATCCTTC;
[0068] SEQ ID NO. 5 (gat8-RV): CATAAAAATACGATAGTAACGGGTG.
[0069] For the detection of recombinant vector in Escherichia coli, the reaction system was: Taq enzyme (5U / μL) 0.1μL; 2×Taq Buffer 2μL; forward primer (10μM) 0.4μL; reverse primer (10μM) 0.4μL; DNA template 1μL; dNTPs 0.4μL; ddH2O to 20μL. The reaction procedure was: initial denaturation at 94℃ for 3min; denaturation at 94℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 1min 30s, 35 cycles; final extension at 72℃ for 10min.
[0070] Successfully transformed clones were identified by gel electrophoresis as fragments of 1690 bp (containing part of the vector fragment). Randomly selected single clones were incubated in liquid LB medium containing 100 mg / L spectinomycin (Spe) and shaken at 37°C for 5 h. The recombinant plasmids were identified by PCR and sequencing. Once identified, the recombinant plasmids were extracted and used to transform Agrobacterium tumefaciens C58. The specific transformation steps are as follows:
[0071] Take the competent culture and freeze-thaw on ice. Add 3μl of plasmid to the competent culture, mix well, and let it stand on ice for 5 minutes. Then, place the competent centrifuge tube in liquid nitrogen and freeze it for 5 minutes. Then, incubate the competent centrifuge tube at 37°C for 5 minutes. After the completion of the incubation at 37°C, place the competent culture on ice for 5 minutes. Then, add 500μl of blank liquid LB from a clean bench to the competent culture and resuscitate on a shaker at 28°C for 3 hours. Then, apply a plate with rifampicin (Rif) and Spe resistance, incubate at 28°C for 2 days, and perform PCR detection after the growth of a single colony. The detection primers are 35S and gat8-RV. The detection of a 1690bp fragment (including part of the vector fragment) by gel electrophoresis is a positive single clone, that is, the SlWRKY5 overexpression vector is obtained and stored for future use.
[0072] 2. Construction of SlWRKY5 knockout expression vector
[0073] (1) Design of sgRNA target sequence
[0074] The sgRNA target sequence was designed using the online software CCTop-CRISP R / Cas9 target online predictor, and two highly specific sequences on the first exon were screened as target site sequences (Target 1 and Target 2). The selected target site sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
[0075] Target 1 (SEQ ID NO.6): CCTAAAGACTCATTTTTTTGG;
[0076] Target 2 (SEQ ID NO. 7): GAATCGACCCATGAATCTAA.
[0077] (2) Primer design
[0078] Primers were designed for the target sites of the PTX041 vector and the target gene. The upstream and downstream primer sequences are shown in SEQ ID NO. 8 and SEQ ID NO. 9, respectively.
[0079] SlWRKY5-CR-FW (SEQ ID NO. 8):
[0080] GAATCTAACAGTGTAGTTTGCCTAAAGACTCATTTTTTGGGTTTAGA GCTAGAAATAG;
[0081] SlWRKY5-CR-RV (SEQ ID NO.9):
[0082] GCTATTTCTAGCTCTAAAACTTAGATTCATGGGTCGATTCCAAACTAC ACTGTTAGATTC.
[0083] (3) Construction of SlWRKY5 knockout expression vector
[0084] Using the phanta enzyme and intermediate vector 043 as a template, PCR amplification with the above-synthesized primers yielded a 600bp dual-sgRNA cloning cassette. The fragment was then recovered and homologously recombined with linearized pTX041 to construct the recombinant vector, the SlWRKY5 knockout expression vector. The PCR system, recombination method, and E. coli and Agrobacterium transformation procedures were similar to those used for constructing the SlWRKY5 overexpression vector. PCR detection of the knockout vector was performed using primers pTX-Fw and pTX-Rv.
[0085] pTX-Fw (SEQ ID NO. 10): AGCGGATAACAATTTCACACAGGA;
[0086] pTX-Rv (SEQ ID NO. 11): GCAGGCATGCAAGCTTATTGG.
[0087] 3. Agrobacterium-mediated genetic transformation of tomato and identification of pure plants
[0088] Using cultivated tomato AC as the experimental material, sterilized seeds were inoculated onto 1 / 2 MS medium. The cotyledons that emerged were cut into explants and cultured in the dark. The cotyledons were then infected with Agrobacterium tumefaciens strains containing SlWRKY5 overexpression and knockout vectors. After two antibiotic selection cycles, the explants grew into seedlings with growing points. These seedlings were then transferred to rooting medium for rooting. Finally, the rooted, resistant seedlings were transferred to plastic cups filled with nutrient soil and acclimatized in a plant growth chamber for one month. DNA from transgenic seedlings was extracted and tested for PCR. Primers 35S and SlWRKY5-OE-RV were used for overexpression detection, while primers PTX-FW and PTX-RV were used for knockout detection. SlWRKY5-OE transgenic plants were obtained, and positive T0 generation plants were transferred to a glass greenhouse for greenhouse culture. Seeds from these T0 generation positive transgenic plants were harvested after fruiting. Knockout plants require further testing for target site editing. The target site is amplified using SlWRKY5-CR-det-FW and SlWRKY5-CR-det-RV, sequenced, and compared to the reference gene sequence. Individual plants showing editing or doublets in sequencing are selected for self-pollination screening. Positive and edited T0 generation plants are transferred to a glasshouse for cultivation, and seeds from these T0 transgenic plants are harvested after fruiting. Knockout plants are further tested for target site editing in the T1 generation, and pure and edited plants are selected for seed production for subsequent phenotypic characterization.
[0089] After screening, pure SlWRKY5 transgenic plants ( Figure 1 a), the overexpression lines include SlWRKY5-OE-5, SlWRKY5-OE-7, and SlWRKY5-OE-19, abbreviated as OE-5, OE-7, and OE-19, respectively; the CRISPR / Cas9 knockout lines include SlWRKY5-CR-1, SlWRKY5-CR-8, and SlWRKY5-CR-15, abbreviated as CR-1, CR-8, and CR-15, respectively.
[0090] The expression level of SlWRKY5 in SlWRKY5 overexpressing plants was detected. The results showed that the expression level of SlWRKY5 in the three lines increased by about 50-90 times, and was significantly overexpressed ( Figure 1b). Target sites of SlWRKY5 knockout plants were detected. The results showed that the second target site of SlWRKY5-CR-1 was edited, with a deletion of 4 bases; the second target site of SlWRKY5-CR-8 was also edited, with a deletion of 2 bases; and both target sites of SlWRKY5-CR-15 were edited, with a deletion of 6 bases in the first target and 1 base in the second target ( Figure 1 c). Further measurement of the plant height of SlWRKY5 transgenic plants revealed that SlWRKY5 overexpression resulted in a compact and dwarfed tomato plant ( Figure 1 d).
[0091] 4. Evaluation of heat tolerance of SlWRKY5 transgenic materials
[0092] AC (wild type) and SlWRKY5 transgenic plants were grown in an artificial plant growth chamber to further characterize the SlWRKY5 transgenic plants' tolerance to high temperatures. Tomato seedlings, approximately 40 days old and with five leaves and one heart, were placed in a light incubator set at a constant temperature of 42°C and 16 hours of light / 8 hours of darkness for high-temperature treatment. The plants were observed for damage caused by the high temperature and photographed 24 hours after the high-temperature treatment. Figure 1 ) and samples were taken at 0h, 6h, 12h, and 24h of high temperature treatment to measure the conductivity and malondialdehyde of different strains, and perform DAB and NBT staining to determine the damage of different strains. The methods of conductivity, malondialdehyde, and DAB and NBT staining refer to the reference "Wang PJ, Xu ZJ, Zhang Y, Ma YB, Yang JY, Zhou F, Gao Y, Li GB*, Hu XH * "Over-expression of spermidine synthase 2(SlSPDS2) in tomato plants improves saline-alkali stress tolerance by increasing endogenous polyamines content to regulate antioxidant enzyme system and ionic homeostasis. Plant Physiology and Biochemistry, 2022, 192(2022): 172-185."
[0093] After testing, it was found that the electrical conductivity of tomato plants began to increase gradually after 12 hours of high temperature treatment, and increased rapidly after 24 hours of high temperature. However, the electrical conductivity of SlWRKY5 overexpression plants after 24 hours of high temperature was significantly lower than that of AC and knockout plants ( Figure 3 (a), which also shows that the degree of damage to the SlWRKY5 overexpressing plants under high temperature is less than that of the AC plants. We further measured the malondialdehyde content in the leaves of AC and SlWRKY5 transgenic plants after high temperature treatment for 0h, 6h, 12h, and 24h. We found that the malondialdehyde content in AC and knockout plants increased rapidly after 12 and 24h of high temperature treatment, while the malondialdehyde content in SlWRKY5 overexpressing plants increased only slightly ( Figure 3 b) DAB staining and NBT staining were used to detect the H2O2 and O2· - It was found that the leaves of SlWRKY5 overexpressing plants accumulated H2O2 and O2· - The content was significantly lower than that in AC plants and SlWRKY5 knockout plants ( Figure 3 c and Figure 3 d). This indicates that SlWRKY5-overexpressing plants are less damaged under high temperature stress, and overexpression of the SlWRKY5 gene significantly improves the heat tolerance of tomatoes.
[0094] 5. Evaluation of gray mold resistance of SlWRKY5 transgenic materials
[0095] Inoculate the gray mold stored in a -80℃ refrigerator onto the PAD medium and culture it in an incubator for about 14 days. At this time, sclerotia are produced in the medium, and the gray mold spores are relatively mature and easy to infect. Use a medicine spoon to gently scrape the mycelium on the surface of the culture medium, wash as many spores as possible in sterile water, and then use a pipette to transfer the sterile water containing spores to a 15ml centrifuge tube pre-laid with filter paper. Centrifuge at 600g for 10 minutes, pour off the supernatant, and add sterile water to resuspend the gray mold spores. Use a hemocytometer to count the spore concentration and dilute the gray mold spore suspension to 10 5 / ml, used for inoculation experiments.
[0096] Tomato seedlings were grown in a plant growth incubator for about 40 days. When they reached five leaves and one heart, they were infected with gray mold. The gray mold spore suspension was evenly sprayed on the back of the third and fourth leaves from the top to the bottom of the plant. The plants continued to be cultured in the growth chamber with a relative humidity of 95% and a temperature of 25℃ / 18℃ (day / night). The gray mold infection was observed after 3 days. The observation results showed that the leaves of the SlWRKY5 knockout plants were all infected and wilted, while the leaves of the SlWRKY5 overexpression plants were only susceptible to the infection and wilted on the leaves sprayed with the gray mold spore suspension, and the other leaves were not infected. This shows that SlWRKY5 overexpression significantly improves the resistance of tomatoes to gray mold ( Figure 4 ).
[0097] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.
[0098] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.
Claims
1. Overexpression SlWRKY5 The application of a gene preparation in tomato cultivation is characterized by: The application is through overexpression SlWRKY5 Genes that improve heat tolerance and resistance to gray mold in tomatoes SlWRKY5 The cDNA sequence of the gene is shown in SEQ ID NO.
1.
2. The overexpression according to claim 1 SlWRKY5 The application of a gene preparation in tomato cultivation is characterized by: Overexpression SlWRKY5 Gene preparations are SlWRKY5 Overexpression vector, by constructing SlWRKY5 The overexpression vector is used to transform competent cells and then infect tomato plants to improve the heat tolerance of tomatoes and enhance the resistance of tomatoes to gray mold.
3. Overexpression according to claim 2 SlWRKY5 The application of a gene preparation in tomato cultivation is characterized by: The process of infecting tomato plants is as follows: SlWRKY5 Agrobacterium strain overexpressing the vector was used to infect tomato cotyledons.
4. The overexpression according to claim 2 SlWRKY5 The application of a gene preparation in tomato cultivation is characterized by: described SlWRKY5 The overexpression vector was transformed into the SlWRKY5 The gene fragment was recombined with the linearized pHellsgate8 vector.
5. The overexpression according to claim 4 SlWRKY5 The application of a gene preparation in tomato cultivation is characterized by: Amplify the SlWRKY5 The primer for the gene fragment is shown in SEQ ID NO.2 SlWRKY5 -OE-FW primer and SEQ ID NO.3 SlWRKY5 -OE-RV primer.
6. A method for improving the heat resistance and gray mold resistance of tomatoes, characterized in that: The steps include: SlWRKY5 Amplification of gene fragments: Using tomato cDNA as template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as primers, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely SlWRKY5 gene fragment; SlWRKY5 The cDNA sequence of the gene is shown in SEQ ID NO. 1; Will SlWRKY5 The gene fragment and the linearized pHellsgate8 vector are recombined to obtain the SlWRKY5 Overexpression vector; SlWRKY5 The overexpression vector was heat-shocked and transformed into Escherichia coli competent cells. Positive clones were screened and recombinant plasmids were extracted. The recombinant plasmids were transformed into Agrobacterium C58 to obtain SlWRKY5 Agrobacterium strain overexpressing the vector; Use containing SlWRKY5 Agrobacterium strains overexpressing the vector were used to infect tomato cotyledons to construct transgenic tomato plants that were resistant to high temperature and gray mold.
7. The method for improving high temperature tolerance and gray mold resistance of tomatoes according to claim 6, characterized in that: The PCR amplification program was as follows: initial denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min.
Citation Information
Patent Citations
Application of SlBBX20 gene in regulating and controlling resistance of tomatoes to botrytis cinerea
CN112195186A
Application of gene to enhancement of tomato gray mold resistance
CN112646819A