DNA methylation marker for diagnosing colorectal cancer, method for detecting DNA methylation marker and application of DNA methylation marker

Abstract

The invention provides a DNA (deoxyribonucleic acid) methylation marker for diagnosing colorectal cancer, a method for detecting the DNA methylation marker and application of the DNA methylation marker. A methylation site cg16993043 is located at 200008026-200008027 nucleotides of a positive chain of a human No.1 chromosome (Hg19) and in a promoter region of an NA5A2 gene. The invention provides a reagent for detecting the methylation level of the CpG locus. The reagent comprises a primer and a probe group for amplifying the colorectal cancer methylation marker and a capture probe group for enriching a target DNA fragment in an excrement sample. The invention also provides application of the reagent for detecting the methylation level of the CpG site in preparation of a colorectal cancer diagnostic kit. The correlation between the methylation level of the CpG site and the colorectal cancer is determined for the first time, and a detection method for methylation of the CpG site in human excrement sample DNA is established. The detection method has high sensitivity and specificity, the detection method is noninvasive, and the methylation level of the CpG site of a colorectal cancer risk patient is detected, so that early diagnosis of the colorectal cancer is realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of colorectal cancer detection, and specifically relates to a methylation marker related to colorectal cancer, and also relates to a DNA methylation marker for diagnosing colorectal cancer, a method for detecting the same, and an application thereof. Background Art

[0002] Colorectal cancer is the third most common malignant tumor in the world and the second most common malignant tumor in terms of mortality. Its incidence in developed countries is three times higher than that in developing countries. In my country, colorectal cancer ranks fourth and fifth in the incidence and mortality of malignant tumors, and is on the rise year by year. The number of young patients is also increasing, posing a serious threat to the health of residents. Colorectal cancer is usually asymptomatic in its early stages, so patients are often diagnosed in the late stages. The five-year survival rate of stage IV colorectal cancer is less than 10%, while the survival rate of stage I can be as high as 90%. Therefore, early diagnosis is an effective measure to control colorectal cancer.

[0003] Currently, early screening for colorectal cancer mainly includes fecal occult blood test and colonoscopy. Fecal occult blood test is simple but has low sensitivity and specificity, poor patient compliance, and the results are affected by many factors. Colonoscopy is the current gold standard for diagnosis, but due to its high cost and invasiveness, it is not suitable for large-scale screening. Therefore, there is an urgent need to develop new, efficient, and non-invasive colorectal cancer screening methods.

[0004] There is a close relationship between the hypermethylation of CpG islands in gene promoter regions and the occurrence and development of colorectal cancer. Methylation of CG sites has potential application value in the discovery of new therapeutic targets, prognosis judgment and efficacy evaluation of colorectal cancer. Through the study of molecular markers such as abnormal methylation of gene promoter regions specific to colorectal cancer, the mechanism of tumor occurrence and development can be revealed at the molecular level, providing a theoretical basis for the early diagnosis, treatment, chemotherapy sensitivity assessment and prognosis evaluation of colorectal cancer. Summary of the invention

[0005] The purpose of the present invention is to provide a colorectal cancer methylation gene CpG site diagnostic marker and its application.

[0006] In order to achieve the above object, the present invention adopts the following technical means.

[0007] The present invention uses databases such as TCGA and GEO to analyze colorectal cancer tissue-specific methylation maps, and screens out the methylation of the CpG site cg16993043 in the NR5A2 promoter region as a marker for diagnosing colorectal cancer. Then, probes and primers for detecting the methylation level of the CpG site cg16993043 in the NR5A2 promoter region were designed based on digital PCR technology, and the reliability of the CpG site in distinguishing normal tissue from colorectal cancer tissue was verified in colorectal cancer tissue and adjacent tissue. Further, based on the tissue results, a method for detecting the methylation of the CpG site cg16993043 in the promoter region of the gene NR5A2 in human fecal samples based on TaqMan qPCR technology was proposed.

[0008] Therefore, the present invention first proposes a methylation marker associated with colorectal cancer. According to the genome annotation information of the 450K chip, the CpG site cg16993043 in the promoter region of the gene NR5A2 is located at the 200008026-200008027 nucleotides of the positive strand of chromosome 1 of the human reference genome Hg19. The specific sequence is

[0009] GGGTGAAGAGGTTGGGGCAGGCCGGGGGACTGGAGCCTGAGCCTCATCCTTATTGGCTG G[CG]GCTAGTGTCCGACCTGAGTCCGGAACCCGCGTCCGCATTCACTGTCTTCACCCCTC AATC (SEQ ID NO. 13).

[0010] The first object of the present invention is to provide a CpG site associated with colorectal cancer, wherein the CpG site cg16993043 is located at nucleotides 200008026-200008027 of the positive strand of chromosome 1 of humans (Hg19).

[0011] The second object of the present invention is to provide a biomarker associated with colorectal cancer, comprising the aforementioned CpG site cg16993043 with different methylation levels.

[0012] The third object of the present invention is to provide a reagent for detecting the methylation level of the aforementioned CpG site cg16993043, the reagent comprising a primer and probe set for amplifying the colorectal cancer methylation marker as shown in SEQ ID NO.1 to SEQ ID NO.6:

[0013]

[0014] Among them, the primers are cg16993043-NR5A2-F shown in SEQ ID NO.1, cg16993043-NR5A2-R shown in SEQ ID NO.2, Control-F shown in SEQ ID NO.4, and Control-R shown in SEQ ID NO.5; the probes are cg16993043-NR5A2-P shown in SEQ ID NO.3, and Control-P shown in SEQ ID NO.6.

[0015] Furthermore, the primer and probe set for amplifying the colorectal cancer methylation marker is based on digital PCR detection technology or Taqman qPCR detection technology.

[0016] The digital PCR-based detection reagent provided by the present invention comprises a TaqMan PCR primer-probe combination for detecting the methylation level of the CpG site cg16993043 on the promoter region of the colorectal cancer-related gene NR5A2 and a TaqMan PCR primer-probe combination of an internal reference gene fragment that is not affected by sulfite conversion (i.e., shown in SEQ ID NO.1 to SEQ ID NO.6), wherein, preferably, the 5' end of the probe comprises a fluorescent reporter group, the fluorescent reporter group of the NR5A2-cg16993043-P is FAM, and the fluorescent reporter group of the internal reference gene-P is VIC.

[0017] Furthermore, when based on Taqman qPCR detection technology, the reagent also includes a capture probe set for enriching the colorectal cancer methylation marker as shown in SEQ ID NO.7 to SEQ ID NO.12:

[0018]

[0019]

[0020] In a specific embodiment, the probes shown in SEQ ID NO. 7 to SEQ ID NO. 12 are modified with biotin.

[0021] The capture probe set based on TaqMan PCR detection technology provided by the present invention is used to amplify the colorectal cancer methylation marker, which is used to capture the target DNA in the biological sample before TaqMan PCR detection, and then detect it using the primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6.

[0022] The fourth object of the present invention is to provide a reagent for detecting the methylation level of the aforementioned CpG site cg16993043 for use in the preparation of a colorectal cancer diagnostic kit.

[0023] Furthermore, the methylation level of CpG site cg16993043 in colorectal cancer patients was significantly higher than that in healthy people.

[0024] Furthermore, the methylation level of the CpG site cg16993043 is measured by determining the methylation level of CpG in the DNA of a biological sample, wherein the biological sample is selected from a human colorectal cancer tissue sample or a corresponding adjacent cancer tissue sample, feces, blood, or saliva sample, and the DNA is converted by sulfite.

[0025] Since on the CpG island, the cytosine of methylated DNA is modified by methyl, while the cytosine of unmethylated DNA is not so modified. After bisulfite conversion treatment, methylated cytosine remains as C base, and unmethylated cytosine is converted to U base. This leads to differences between methylated and unmethylated sequences with the same original sequence. In the TaqMan PCR system, the DNA after bisulfite conversion treatment is amplified by sequence-specific primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6, so that the sample containing the methylated target sequence generates a fluorescent signal in the amplification system. The primer and probe sets shown in SEQ ID NO.1 to SEQ ID NO.6 are respectively used to amplify the NR5A2 gene fragment containing the cg16993043 site after bisulfite conversion and the internal reference gene fragment that will not be affected by bisulfite conversion.

[0026] Furthermore, the application is based on digital PCR detection technology.

[0027] Digital PCR reaction system: 10uL of 2× digital PCR reaction premix, add primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6 to make their final concentrations reach 900nM and 250nM respectively, 5-8uL of template DNA with a concentration of 0.1ng / uL-20ng / uL, and add ultrapure water to 20uL;

[0028] The digital PCR reaction conditions are as follows:

[0029]

[0030]

[0031] Furthermore, the application is based on Taqman qPCR detection technology.

[0032] TaqMan qPCR reaction system: 10uL of 2×TaqMan PCR reaction premix; add primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6 to make their final concentrations reach 900nM and 250nM respectively, and make up to 2uL; 8uL of template DNA with a concentration of 0.1ng / uL-20ng / uL.

[0033] TaqMan qPCR reaction conditions are as follows:

[0034]

[0035] Furthermore, the kit also includes a target DNA enrichment reagent, which uses a biotin-labeled probe capture method to enrich and extract human genes at the cg16993043 site and nearby sites in human fecal samples.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. By analyzing the colorectal cancer methylation 450K high-throughput chip data in the TCGA and GEO databases, the present invention discovered for the first time that the CpG site cg16993043 on the NR5A2 promoter is a colorectal cancer-specific methylated CpG site, and used human colorectal cancer and adjacent tissue samples to verify the CpG site, and successfully established a methylation detection method for the site in human tissue DNA based on digital PCR.

[0038] 2. The present invention first determined the association between the methylation level of CpG site cg16993043 and colorectal cancer, and first detected the methylation level of CpG site cg16993043 in human fecal sample DNA, and successfully established a detection method for methylation of CpG site cg16993043 on NR5A2 in human fecal sample DNA using TaqMan PCR technology. The detection method of the present invention has high sensitivity and specificity, and can detect the methylation level of CpG site cg16993043 on NR5A2 in patients at risk of colorectal cancer through non-invasive examination, thereby achieving early diagnosis of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 .30 Methylation levels of cg16993043 site in colorectal cancer and adjacent adjacent tissues (based on digital PCR detection).

[0040] Figure 2 Methylation levels of cg16993043 in feces of colorectal cancer patients and healthy controls (based on Taqman qPCR detection).

[0041] Figure 3 ROC curve analysis of fecal cg16993043 site methylation in distinguishing colorectal cancer patients from healthy people. DETAILED DESCRIPTION

[0042] The present invention is described in detail below through specific embodiments so that those skilled in the art can easily implement the present invention according to the disclosure of this specification. The embodiments described below are only part of the embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] Example 1: Detection of methylation level of cg16993043 site in tissue samples based on digital PCR technology

[0044] The present invention adopts digital PCR (ddPCR) to detect colorectal cancer-specific methylation sites. By designing primers and probes for the methylation region near the CpG site cg16993043 on the specific human NR5A2 promoter, amplifying the DNA sample to be tested that has been converted by bisulfite and prepared by dropletization, the methylation level of the CpG site cg16993043 on the human NR5A2 promoter in the sample to be tested is determined according to the number of positive droplets amplified by PCR and the ratio to the total number of positive droplets, thereby judging whether the sample to be tested is derived from colorectal cancer tissue.

[0045] 1. Primer and probe design

[0046] ddPCR primers and probes were designed for the location of the CpG site cg16993043 on the chromosome of NR5A2 and the reference gene fragment that would not be affected by sulfite conversion. The 5' end of the probe contained a fluorescent reporter group. The fluorescent reporter group of the NR5A2-cg16993043-P was FAM, and the fluorescent reporter group of the reference gene-P was VIC. The fluorescent reporter group is optional and needs to refer to the fluorescence range of the digital PCR machine. The quencher group can select the MGB group that can increase the probe annealing temperature; the ddPCR reaction primer and probe sequences are as follows:

[0047] name 5‘-3’ cg16993043-NR5A2-F GGGTAGGTCGGGGGATTG SEQ ID NO.1 cg16993043-NR5A2-R ACGAACGCGAATTCCGAAC SEQ ID NO.2 cg16993043-NR5A2-P TTGGTTGGCGGTTAGTGT+MGB SEQ ID NO.3 Control-F TGTATGTATGTGAGTGTGGGAGAGAGA SEQ ID NO.4 Control-R TTTCTTCCACCCCTTCTCTTCC SEQ ID NO.5 Control-P CTCCCCCTCTAACTCTAT+MGB SEQ ID NO.6

[0048] The embodiments of the present invention adopt droplet digital PCR technology. First, the digital PCR mixture is added to the droplet generator to generate 10,000 to 20,000 micro-reaction droplets for PCR amplification. Each PCR plate includes a positive quality control (M), a negative quality control (U), RNase-free water and a blank control NTC. The positive quality control is fully methylated human genomic DNA treated with bisulfite, and the negative quality control is sulfurized non-methylated human genomic DNA. According to the threshold value set by the quality control and the blank control, it is determined whether the sample to be tested contains the CpG site cg16993043 on the methylated human NR5A2, and its quantity is determined. Finally, data analysis is performed using commercialized software (such as QuantDrop).

[0049] 2. Extraction and preparation of DNA samples

[0050] The DNA template detected by the present invention can be derived from DNA extracted from colorectal cancer and adjacent cancer tissues of the subject to be tested; the specific operation is described in detail as follows.

[0051] (1) Extraction of DNA from test samples

[0052] Take 30 pairs of colorectal cancer tissue samples and corresponding adjacent tissue samples that have been diagnosed by pathological histology, and use the commonly used commercial kits on the market to prepare DNA samples. The specific operation is carried out according to the kit operation manual. Use 50uL of elution buffer to elute the DNA to be tested from the centrifugal column, measure the concentration, and use it for sulfite conversion.

[0053] (2) Sulfite conversion of DNA samples to be tested

[0054] The extracted DNA samples were treated with bisulfite using a commercial kit commonly used on the market. The specific operation was carried out according to the kit manual. The DNA samples were eluted with 20uL of elution buffer for digital PCR detection.

[0055] 3. Digital PCR detection system for methylation of CpG site cg16993043 on human NR5A2

[0056] (1) Digital PCR reaction system: Divide the sample after sulfite conversion into three parts, and prepare the reaction system of three sites respectively. In a 20uL digital PCR reaction system, add 10uL of 2× digital PCR reaction premix, primers and probes to make their final concentrations reach 900nM and 250nM respectively, 5-8uL of template DNA with a concentration of 0.1ng / uL-20ng / uL, and fill up to 20uL with ultrapure water.

[0057] (2) Preparation and amplification of droplet PCR reaction system: Add 20ul of the configured system to the 8 wells in the middle row of the droplet generation chip (DG-20), add 5 microliters of sealant to the chip sample well, add 50 microliters of droplet generation oil to the upper chip oil well, pad with a rubber pad, and slowly transfer to the droplet generator (MicroDrop-400A, Guangzhou Yongnuo Biotechnology Co., Ltd.) to generate droplets. Droplets are generated within about 2 minutes. 55uL of the prepared droplets are slowly transferred to a 96-well plate. After sealing the film, the PCR reaction should be carried out within 30 minutes, or placed in a 4°C refrigerator for 4 hours. The PCR reaction should be carried out according to the set reaction conditions. The above PCR reaction conditions are:

[0058]

[0059]

[0060] (3) Fluorescence signal detection and result determination: After the PCR amplification reaction is completed, the sample is placed in a biochip analyzer (MicroDrop-100B) for analysis. The droplets of each sample are aspirated in the set order and the number of positive droplets and negative droplets is detected. The number of positive and negative droplets of CpG site cg16993043 on NR5A2 in the sample to be tested is calculated by QuantDrop software analysis.

[0061] (4) Detection results and analysis: By analyzing the ddPCR results, it was found that the methylation level of the CpG site cg16993043 on human NR5A2 was significantly higher in colorectal tissue than in adjacent tissues ( Figure 1 ).

[0062] Example 2: Detection of methylation level of cg16993043 site in human fecal samples based on Taqman qPCR technology to assist in the diagnosis of colorectal cancer

[0063] The present invention adopts Taqman qPCR to detect colorectal cancer-specific methylation sites in human stool sample DNA. First, the target DNA is enriched by DNA capture probes and bisulfite conversion is performed. Then, methylation level detection primers and probes designed for the vicinity of the CpG site cg16993043 on the human NR5A2 promoter are used to perform PCR amplification on the converted and droplet-prepared DNA sample to be tested, and the methylation level of the CpG site cg16993043 in the sample to be tested is determined according to the CT value of PCR amplification.

[0064] 1. Fecal samples were collected from 42 patients with colorectal cancer diagnosed by pathological histology and 30 healthy volunteers. The sampling volume was between 5 and 10 g. The samples were stored at 4°C for a short term and -80°C for a long term. The fecal samples should be taken out from -80°C and thawed at 4°C before use.

[0065] 2. DNA capture probe design

[0066] DNA capture probes were designed for the chromosomal location of the CpG site cg16993043 on the NR5A2 promoter and for the reference gene fragment that would not be affected by sulfite conversion, and the probes were labeled with biotin. The DNA capture probe sequences used are as follows:

[0067]

[0068]

[0069] 3. DNA extraction and preparation of human fecal samples

[0070] (1) Extraction of DNA from stool samples

[0071] ① Vortex the human fecal sample in 15 ml of a buffer solution composed of 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, and 0.1% Tween-20 for 5 min, centrifuge at 14,000 rpm for 10 min at room temperature, and collect 10 ml of the supernatant;

[0072] ②Take 3.5 ml of the collected supernatant and incubate at 70°C for 5 minutes;

[0073] ③ Vortex for 30 seconds and centrifuge at 12000 rpm for 1 minute. Transfer about 3.2 ml of supernatant to a new 5 ml centrifuge tube, add 150 μL of proteinase K (1 mg / uL), and incubate at 56°C for 10 minutes.

[0074] ④ Add the capture probe shown in SEQ ID NO.7-12, incubate at 95°C for 10 minutes, and slowly return to room temperature;

[0075] ⑤ Add 100uL of streptavidin magnetic beads to ④, place the centrifuge tube on a rotating mixer, and rotate and mix at room temperature for 30 minutes;

[0076] ⑥ Place the centrifuge tube in ⑤ on a magnetic rack, perform magnetic separation, discard the supernatant, and wash the magnetic beads twice with a buffer prepared by 10mM Tris-HCl (pH7.5), 1mM EDTA, 2M NaCl, and 0.1% Tween-20; then add 1ml TE buffer to wash the magnetic beads twice, place the centrifuge tube on a magnetic rack, discard the supernatant after magnetic separation, and retain the magnetic beads;

[0077] ⑦ Add at least 30uL of elution buffer prepared with 10mM EDTA pH 8.2 and 95% formamide to the centrifuge tube in ⑥, vortex to fully resuspend the magnetic beads, and incubate at 95℃ for 10min;

[0078] ⑧ Centrifuge the centrifuge tube in ⑦ at 12000 rpm for 1 minute, and transfer the supernatant to a new centrifuge tube for subsequent sulfite conversion.

[0079] (2) Sulfite conversion of DNA to be tested

[0080] Use a commonly used commercial kit on the market to treat the extracted DNA sample with bisulfite. The specific operation is carried out according to the kit operation manual. Elute the DNA to be tested with 20uL elution buffer for Taqman qPCR detection.

[0081] 3. Taqman qPCR detection system for methylation level of CpG site cg16993043 on human NR5A2

[0082] (1) Taqman qPCR reaction system

[0083] The sulfite-converted sample was divided into three parts, and the reaction system of three sites was configured respectively. In the 20uL TaqmanqPCR reaction system, 10uL of 2×TaqMan PCR reaction premix was used; the primers and probes were adjusted to a final concentration of 900nM and 250nM respectively (the primers and probe sequences used in the Taqman qPCR reaction are consistent with those used in the above-mentioned digital PCR reaction, i.e., the primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6), and the final concentration was supplemented to 2uL; 8uL template DNA. The configured system was subjected to PCR reaction according to the set conditions. The TaqMan qPCR reaction conditions are as follows:

[0084]

[0085] (2) Detection results and analysis: Analysis of Taqman qPCR results showed that the methylation level of CpG site cg16993043 on human NR5A2 was significantly higher in the feces of colorectal patients than in healthy control samples ( Figure 2 ), the AUC values ​​of diagnosing colorectal cancer by detecting the methylation of this site were 0.8754 ( Figure 3 ).

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A CpG site associated with colorectal cancer, characterized in that: The CpG site cg16993043 is located at nucleotides 200008026-200008027 of the positive strand of chromosome 1 of the human reference genome Hg19.

2. A biomarker associated with colorectal cancer, characterized in that: The CpG site cg16993043 of claim 1 comprising different methylation levels.

3. A reagent for detecting the methylation level of the CpG site cg16993043 according to claim 1, characterized in that: The reagents include primers and probe sets for amplifying the colorectal cancer methylation markers shown in SEQ ID NO.1 to SEQ ID NO.6: Among them, the primers are cg16993043-NR5A2-F shown in SEQ ID NO.1, cg16993043-NR5A2-R shown in SEQ ID NO.2, Control-F shown in SEQ ID NO.4, and Control-R shown in SEQ ID NO.5; the probes are cg16993043-NR5A2-P shown in SEQ ID NO.3, and Control-P shown in SEQ ID NO.

6.

4. The reagent according to claim 3, characterized in that The primer and probe set for amplifying the colorectal cancer methylation marker is based on digital PCR detection technology or Taqman qPCR detection technology.

5. The reagent according to claim 4, characterized in that When based on Taqman qPCR detection technology, the reagent also includes a capture probe set for enriching the colorectal cancer methylation marker as shown in SEQ ID NO.7 to SEQ ID NO.12: ， Preferably, the probes shown in SEQ ID NO.7 to SEQ ID NO.12 are modified with biotin.

6. Use of a reagent for detecting the methylation level of the CpG site cg16993043 according to claim 1 in the preparation of a colorectal cancer diagnostic kit, preferably, the reagent is the reagent according to any one of claims 3 to claim 5.

7. The use according to claim 6, characterized in that: The methylation level of CpG site cg16993043 in colorectal cancer patients was significantly higher than that in healthy people.

8. The use according to claim 6, characterized in that: The methylation level of the CpG site cg16993043 is measured by determining the methylation level of CpG in the DNA of a biological sample, wherein the biological sample is selected from a human colorectal cancer tissue sample or a corresponding adjacent cancer tissue sample, feces, blood, or saliva sample, and the DNA is converted by sulfite.

9. The use according to claim 6, characterized in that: The application is based on digital PCR detection technology, and the digital PCR reaction system is: 2×10uL of digital PCR reaction premix, adding primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6, so that the final concentration of primers is 900nM, the final concentration of probes is 250nM, 5-8uL of template DNA with a concentration of 0.1ng / uL-20ng / uL, and supplementing with ultrapure water to 20uL; The digital PCR reaction conditions are as follows:

10. The use according to claim 6, characterized in that: The application is based on Taqman qPCR detection technology, TaqMan qPCR reaction system: 10uL of 2×TaqMan PCR reaction premix; primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6, with a final concentration of 900nM for primers and 250nM for probes, and the total concentration is 2uL; 8uL of template DNA with a concentration of 0.1ng / uL-20ng / uL. TaqMan qPCR reaction conditions are as follows:

Images