Group of small RNAs, kit for diagnosing teratospermia and application

Abstract

The invention provides application of small RNA (Ribonucleic Acid) as a biomarker in preparation of a reagent or a kit for diagnosing teratospermia. The small RNA is one or a combination of rsRNA and tsRNA. The invention further provides application of the reagent for detecting the content of the small RNA in the sperm in preparation of a reagent or a kit for diagnosing the teratospermia and the kit for diagnosing the teratospermia. The expression change of rsRNA and tsRNA in sperms may be prior to the abnormality of traditional semen parameters, so that the kit is expected to realize the early diagnosis of male fertility. The method has the advantages that problems such as sperm malformation can be found early, intervention measures can be taken in time, the treatment success rate is increased, rtPCR is adopted for detection, and the method is easy and convenient to operate, rapid, relatively low in cost and the like. Complex instruments and equipment and professional technicians are not needed, popularization and application in medical institutions at all levels are facilitated, and the accessibility of detection is improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a group of small RNAs and a kit for diagnosing teratospermia and its application. Background Art

[0002] In routine clinical semen analysis, existing technical means mainly focus on detecting semen parameters, semen ROS value, sperm DNA fragmentation rate and other aspects to evaluate sperm quality (WHO manual). It is currently known that sperm contains a large amount of fragmented RNA (small RNA). There is now technology to sequence small RNA in sperm, and it is found that it contains rsRNA, tsRNA, piRNA, miRNA, etc., and has its own unique distribution characteristics. Under the stimulation of external nutrition "1" and aging "2", sperm may be damaged, and its small RNA spectrum changes. Some specific small RNA sequences change significantly. Therefore, the abundance of specific small RNA can be used as a standard for evaluating sperm quality.

[0003] The shortcomings or disadvantages of the existing technology are as follows: First, in clinical semen analysis, the existing methods only detect sperm-related parameters and cannot comprehensively, truly and accurately evaluate sperm quality. On the other hand, although there are methods to evaluate sperm quality by detecting small RNAs, they are mainly focused on miRNA probes and sequences and are relatively simple. Although tsRNA and rsRNA are actually present in high levels in sperm, their content is underestimated due to the limitations of traditional sequencing methods. Therefore, there are few effective tools with high correlation that can be used as molecular markers to evaluate sperm quality.

[0004] Chinese patent document CN117431308A discloses the use of IQCH gene and its mutant gene as molecular markers in the diagnosis and treatment of male infertility, belonging to the field of biomedical technology. The present invention first reveals that IQCH is a new pathogenic gene for human male infertility, and that IQCH loss-of-function mutations are associated with oligoasthenoteratospermia, which can lead to abnormal sperm mitochondrial sheath structure and exposure of the fiber ring, thereby causing tail breakage and bending. In addition, IQCH dysfunction can also lead to decreased sperm acrosome reaction activity, further damaging sperm function. The present invention aims to overcome the deficiencies of the prior art and provide new markers and targets for the preparation of diagnostic kits, prevention techniques and treatment techniques for male infertility.

[0005] However, there are no reports on a group of small RNAs, diagnostic kits and applications for teratospermia. Summary of the invention

[0006] The purpose of the present invention is to address the deficiencies in the prior art and screen out specific sequences through PANDORA-seq small RNA sequencing technology. The main purpose is to provide some rsRNA and tsRNA sequences (including but not limited to) that can effectively distinguish abnormal sperm from normal sperm. Figure 1 PCR, a simple and effective method, was used for detection, thus providing a better basis and solution for clinical evaluation of sperm quality.

[0007] In a first aspect, the present invention provides the use of small RNA as a biomarker in the preparation of a reagent or kit for diagnosing teratospermia, wherein the small RNA is one or a combination of rsRNA and tsRNA.

[0008] As a preferred example, the rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNA His(GTG) The sequence is shown in SEQ ID NO:17.

[0009] As a preferred example, the test sample of the reagent or kit for diagnosing teratospermia is sperm.

[0010] In a second aspect, the present invention provides the use of a reagent for detecting the content of small RNA in sperm in the preparation of a reagent or a kit for diagnosing teratospermia.

[0011] As a preferred example, the small RNA is rsRNA, tsRNA or a combination of several thereof.

[0012] As another preferred example, the rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNA His(GTG) The sequence is shown in SEQ ID NO:17.

[0013] As another preferred example, the 28S-rs2717-2738 primer sequence is shown in SEQ ID NO: 14, Inner'tsRNA His(GTG) The primer sequence is shown in SEQ ID NO:13.

[0014] In a third aspect, the present invention provides a kit for diagnosing teratospermia, the kit comprising a reagent for detecting the content of small RNA in sperm, wherein the small RNA is one or a combination of rsRNA, tsRNA.

[0015] As a preferred example, the rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNAHis(GTG) The sequence is shown in SEQ ID NO:17.

[0016] As another preferred example, the 28S-rs2717-2738 primer sequence is shown in SEQ ID NO: 14, Inner'tsRNA His(GTG) The primer sequence is shown in SEQ ID NO:13.

[0017] The advantages of the present invention are:

[0018] 1. Clinical Value

[0019] 1. High accuracy and specificity: By detecting the rsRNA and tsRNA content in sperm to distinguish abnormal sperm from normal sperm, it provides a new and more targeted evaluation index for clinical use. Compared with traditional sperm quality testing methods, the detection based on specific RNA molecules has higher accuracy and specificity, and can more accurately reflect the functional status of sperm.

[0020] 2. Potential for early diagnosis: Changes in the expression of rsRNA and tsRNA in sperm may precede abnormalities in traditional semen parameters, so the present invention is expected to achieve early diagnosis of male fertility. Early detection of sperm abnormalities and other problems can allow timely intervention measures to improve the success rate of treatment.

[0021] 3. Simple and efficient detection method: rtPCR detection has the advantages of simple operation, rapidity and relatively low cost. It does not require complex instruments and professional technicians, which is convenient for promotion and application in medical institutions at all levels and improves the accessibility of detection.

[0022] Second, economic effects

[0023] 1. Reduce medical costs: Traditional assisted reproductive technologies such as in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) are expensive and have limited success rates. The present invention can reduce unnecessary assisted reproductive attempts and reduce medical expenses by accurately assessing sperm quality. At the same time, early diagnosis and treatment of male fertility problems can also avoid high medical expenses incurred later due to worsening of the disease.

[0024] 2. Improve the efficiency of medical resource utilization: Simple and efficient testing methods can reduce testing time and labor costs, improve the efficiency of medical resource utilization, enable medical institutions to better provide services to more patients, and alleviate the shortage of medical resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Analysis of validation results of RT-PCR.

[0026] Figure 2Human sperm tsRNA and rsRNA screening process.

[0027] Figure 3 Discrimination effect of different sperm samples.

[0028] Figure 4 The content of specific rsRNA and tsRNA sequences in normal and abnormal sperm is different. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0030] It should be noted that the XML file submitted for the sequence listing involved in the examples needs to replace all "U" in SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17 with "T" due to formatting issues. The specific details are subject to those shown in the examples.

[0031] Example 1

[0032] (1) Experimental materials:

[0033] 1) Sperm purification and RNA extraction: PBS; 70 μm cell sieve; cell lysis buffer (0.1% SDS, 0.5% TritonX-100, dissolved in sterile 1‰ DEPC water); centrifuge; Trizol reagent; 1 mL syringe; chloroform; isopropanol; glycogen; 75% ethanol; RNase-free water.

[0034] 2) Enzyme treatment: T4 PNK treatment reagent, including 10x PNK Buffer, 10mM ATP and NF H2O; Alkb treatment reagent, including 20x HEPES, 20x Fe2+, 10x aK, 10x SA, Alkb, RRI and NF H2O;

[0035] 3) Reverse transcription and PCR: poly (A) polymerase and buffer; Oligo dT; DTT, dATP, dTTP, dCTP, dGTP, reverse transcriptase; common PCR reagents; agarose gel, electrophoresis system.

[0036] (2) Methods:

[0037] 1) Collection of human semen samples

[0038] The present invention selects semen samples from men (aged 25-40 years old) who undergo semen analysis in an assisted reproductive center. All participants were required to abstain from sex for 2-7 days before sampling. Semen samples were collected and liquefied at 37 degrees Celsius for 30 minutes before semen analysis. The sperm parameters of each sample were analyzed within 200 sperm to generate a final semen analysis report. No white blood cells were present in all samples. According to the morphological parameter indicators of the "WHO Human Semen Examination and Processing Laboratory Manual, Fifth Edition", the samples were divided into normal sperm (NZS) with a deformity rate of no more than 96% and abnormal sperm (TZS) with a deformity rate of more than 96%.

[0039] 2) Somatic cell lysis and sperm purification

[0040] The collected semen was lysed according to the following steps to ensure the acquisition of high-purity sperm RNA. First, the liquefied semen was mixed with PBS in a 1:1 ratio and centrifuged at 200g for 5 minutes to remove the supernatant. 1mL PBS was added to resuspend and centrifuged again at 200g for 5 minutes to remove the supernatant. Then, the sperm was resuspended in 1mL PBS and filtered on ice into 4mL pre-cooled cell lysis buffer (0.1% SDS, 0.5% Triton X-100, dissolved in sterile 1‰ DEPC water) using a 70μm cell sieve. The centrifuge tube was gently inverted to ensure thorough mixing and placed on ice for 30 minutes. Subsequently, centrifuged at 600g for 5 minutes and the supernatant was discarded. After repeated centrifugation and resuspending, the centrifuge was centrifuged at 12000rpm for 5 minutes at 4 degrees. The white precipitate at the bottom of the tube is sperm RNA. In order to maximize the removal of RNA components in the lysate, the supernatant was carefully aspirated and discarded. Finally, 1mL Trizol reagent was added to the precipitate for RNA extraction.

[0041] 3) RNA extraction

[0042] Use a 1mL syringe to aspirate repeatedly to ensure that the precipitate can pass through the syringe needle smoothly. Then place the mixture on ice for 2 to 3 hours, add 0.2mL of chloroform and shake vigorously, and incubate at room temperature for 2-3 minutes. Centrifuge at 13000rpm at 4 degrees Celsius for 15 minutes, carefully collect the upper aqueous phase into a new EP tube, add 600μl isopropanol and 1-2μl glycogen. Gently invert the EP tube and slowly precipitate the mixture at -20 degrees Celsius overnight. Centrifuge the precipitate at 13000rpm and 4 degrees Celsius for 20 minutes, wash the precipitate with 75% ethanol and centrifuge it at 13000rpm at 4 degrees Celsius for 10 minutes. After drying, the precipitate is dissolved in 7.5-10μl RNase-free water for subsequent reverse transcription and rtPCR detection.

[0043] 4) Sperm RNA contaminants and purity testing

[0044] The dissolved RNA samples were treated with gDNA Eraser at 42 degrees Celsius for 2 minutes and then reverse transcribed at 37 degrees Celsius for 15 minutes. The generated cDNA was treated at 85 degrees Celsius for 5 seconds to terminate the reaction. Subsequently, RT-PCR was used to evaluate whether there was somatic cell contamination in the extracted sperm RNA. The somatic cell-specific gene mRNAs detected included cadherin-1 (CDH1), cadherin-2 (CDH2), CD4, and the germ cell-specific gene KIT. Sperm purity was also assessed using primers for the sperm-specific gene prospermone-2 (PRM2). PCR products were subjected to 1.5% agarose gel electrophoresis and then imaged using a gel system.

[0045] The primer sequences are as follows:

[0046]

[0047] The PCR program was set up as follows:

[0048]

[0049] 5) Enzyme treatment

[0050] The RNA of samples that passed the purity test and had no somatic cell contamination was treated with T4 PNK and incubated at 37°C for 20 min (system see the table below) and Alkb and incubated at 37°C for 30 min (system see the table below).

[0051] T4 PNK treatment system:

[0052]

[0053] Alkb treatment system:

[0054]

[0055] 6) rsRNA and tsRNA reverse transcription

[0056] Add Trizol-LS (3:1) to the enzyme-treated RNA, then add chloroform to mix thoroughly, let stand and centrifuge at 13000g for 15min, add isopropanol-80 to precipitate for 30min, centrifuge at 13000g for 15min, remove the supernatant, open the lid and dry, then dissolve the precipitated RNA in NF water. Each 2μg RNA is used as a reaction system for 3' end polyadenylation, and incubate at 37℃ for 30min.

[0057] The reaction system is as follows:

[0058]

[0059] Add 0.5 μL Oligo-dT to the product for adapter annealing, react at 70°C for 5 minutes and immediately place on ice. Perform reverse transcription reaction, add the product to the following system, incubate at 42°C for 60 minutes, then at 95°C for 5 minutes, and then place at 4°C. At this time, the product is cDNA.

[0060] The reverse transcription reaction system is as follows:

[0061]

[0062] 7) PCR and electrophoresis detection PCR was performed using cDNA as a template, and the primers were inner'tsRNA His(GTG) :ATAGTGGTTAGTACTCTGCGTTG (SEQ ID NO: 13); 28S-rs2717-2738: GTCCGGTGAGCTCTCGCTG (SEQID NO: 14); mir34C was used as an internal reference at the same time. Based on its basically consistent expression in normal / disease samples, the mir34C sequence was: AGGCAGUGUAGUUAGCUGAUUGC (SEQ ID NO: 15).

[0063] The PCR system is as follows:

[0064]

[0065] The PCR program was set up as follows:

[0066]

[0067] Prepare 3% agarose gel, load the PCR product, and run electrophoresis at 200V for about 20 minutes. Take photos and test with a UV exposure device. The inner'tsRNA of normal sperm samples His(GTG) The PCR band intensity of 28S-rs2717-2738 was lower than that of teratospermia samples. His(GTG) Derived from tRNA His(GTG) The middle segment of 28S-rs2717-2738 is derived from the base sequence of position 2717 to 2738 of rRNA. Figure 1 : PANDORA-seq analysis revealed ( Figure 1 Its content in abnormal sperm samples is higher than that in normal sperm samples; rt-PCR verification also shows the same trend (see the strips), that is, inner'tsRNA His(GTG) The contents of 28S-rs2717-2738 in abnormal sperm samples were higher than those in normal sperm samples. Mir34C was used as an internal reference and control, and its content was consistent in sperm of different pathological states.

[0068] This result indicates that inner'tsRNA His(GTG) 28S-rs2717-2738 can be used as sperm-specific molecular markers to distinguish abnormal sperm from normal sperm and evaluate sperm quality, thereby providing a reliable scientific basis and personalized treatment ideas for the clinical diagnosis of male infertility.

[0069] The tsRNA and rsRNA sequences protected in the present invention (28S-rs2717-2738 sequence: GCGUCCGGUGAGCUCUCGCUGGCCCU (see SEQ ID NO: 16)

[0070] Inner'tsRNA His(GTG) The sequence: AUAGUGGUUAGUACUCUGCGUUG (shown in SEQ ID NO: 17) was screened and verified by the following process ( Figure 2 ). This screening process uses PANDORA-Seq, an innovative small RNA sequencing technology, which overcomes the disadvantages of traditional small RNA sequencing that the sncRNA to be detected cannot be completely and effectively reverse transcribed into cDNA due to RNA modifications (such as 3' end modifications (3'-P and 2', 3'-cP) will hinder adaptor connection, and RNA methylation (such as m1A, m3C, m1G and m2G) will hinder the smooth progress of reverse transcription).

[0071] Through this screening process and analysis, different types of samples can be clearly grouped according to their differential expression of sncRNA ( Figure 3 ); and in certain sequences of specific rsRNA and tsRNA, significant differences were found ( Figure 4 ) The sequences protected by this patent are 28S-rs2717-2738 and Inner'tsRNA His(GTG) , and the levels were increased in teratosperm samples.

[0072] References:

[0073] 1. Zhang Y, Zhang X, Shi J, Tuorto F, Li

[0074] 2. Guo Y, Bai D, Liu W, Liu Y, Zhang Y, et al. Altered sperm tsRNAs in agedmale contribute to anxiety-like behavior in offspring. Aging Cell [Internet] 2021 [cited 2023Oct 30]; 20:e13466.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. Use of small RNA as a biomarker in the preparation of a reagent or kit for diagnosing teratospermia, characterized in that: The small RNA is one or a combination of rsRNA and tsRNA.

2. The use according to claim 1, characterized in that: The rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNA His(GTG) The sequence is shown in SEQ ID NO:

17.

3. The use according to claim 1 or 2, characterized in that: The test sample of the teratospermia diagnosis reagent or kit is sperm, and rtPCR is used for detection.

4. Use of a reagent for detecting the content of small RNA in sperm in the preparation of a reagent or kit for diagnosing teratospermia, characterized in that: The small RNA is one or a combination of rsRNA and tsRNA.

5. The use according to claim 4, characterized in that: The rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNA His(GTG) The sequence is shown in SEQ ID NO:

17.

6. The use according to claim 5, characterized in that: The 28S-rs2717-2738 primer sequence is shown in SEQ ID NO: 14, Inner'tsRNA His(GTG) The primer sequence is shown in SEQ ID NO:

13.

7. A kit for diagnosing teratospermia, characterized in that: The kit comprises a reagent for detecting the content of small RNA in sperm, and the small RNA is one or a combination of rsRNA and tsRNA.

8. The kit according to claim 7, characterized in that The rsRNA is 28S-rs2717-2738, the sequence is shown in SEQ ID NO: 16, and the tsRNA is Inner'tsRNA His(GTG) The sequence is shown in SEQ ID NO:

17.

9. The kit according to claim 8, characterized in that The 28S-rs2717-2738 primer sequence is shown in SEQ ID NO: 14, Inner'tsRNA His(GTG) The primer sequence is shown in SEQ ID NO: 13, and rtPCR was used for detection.

Images