SNP (Single Nucleotide Polymorphism) molecular marker related to weaning weight of Yondeng seven goat and application of SNP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to weaning weight of a Yondeng seven goat as well as a detection kit and application of the SNP molecular marker, and belongs to the technical field of SNP molecular markers. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the mutation site is the base of the 5343313 site on the No.3 chromosome of the international sheep genome Oarv4.0 version, the dominant allele of the site is selected by typing the site, and the high weaning weight character of the Yondon seven goat can be identified. On the basis of the SNP molecular marker, the invention further provides a method for identifying the weaning weight character of the Zondeng seven goats and screening or breeding the Zondeng seven goats with the high weaning weight character, and the method is high in accuracy, high in detection speed, low in cost and easy in result interpretation and has important application value in large-scale molecular precise breeding of the Zondeng seven goats.

Description

Technical Field

[0001] The invention relates to a molecular marker detection technology, and in particular to a SNP molecular marker associated with the weaning weight of Yongdeng 7 goats and an application thereof. Background Art

[0002] Yongdeng Seven Goats is a local sheep group located in Yongdeng County, Lanzhou City, Gansu Province. The group has a uniform appearance and stable genetic performance. They are good at climbing mountains and grazing far away, can tolerate roughage, and have strong disease resistance. The meat of Yongdeng Seven Goats is tender, fat and lean, rich in high levels of protein and unsaturated fatty acids, and rich in mineral elements. After the meat is cooked, the soup is clear and transparent, with a strong aroma. The meat is tender and refreshing, fat but not greasy, lean but not dry, and has a light smell of mutton, which has a good market prospect.

[0003] Weaning weight refers to the weight of the lamb when it stops breastfeeding (weaning). It is a key indicator for measuring sheep production performance. It not only reflects the level of early growth and development of lambs, but also is an important basis for evaluating their vitality and resistance. Lambs with higher weaning weight usually show faster growth and better meat production performance in the subsequent growth process.

[0004] At present, molecular experiments have proved that there is obvious genetic differentiation between Yongdeng Seven Goats and other breeds raised in the surrounding areas, such as Tan Sheep and Lanzhou Big-tailed Sheep. However, there are few reports on the mining of molecular markers related to the economic traits of Yongdeng Seven Goats. Therefore, providing SNP molecular markers related to the weaning weight of Yongdeng Seven Goats and using them to improve the production performance of Yongdeng Seven Goats plays an important role in Yongdeng Seven Goat breeding. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a SNP molecular marker related to the weaning weight of Yongdeng 7 goats, and to achieve the genotyping of the weaning weight of Yongdeng 7 goats by detecting the base type of the SNP molecular marker, and to further identify the weaning weight trait of Yongdeng 7 goats according to the genotype, and to screen or breed Yongdeng 7 goats with high weaning weight trait.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a SNP molecular marker associated with the weaning weight of Yongdeng 7 goats, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1.

[0008] Preferably, when the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, the Yongdeng 7 goats exhibit a high weaning weight trait.

[0009] The present invention also provides the use of the above-mentioned SNP molecular marker in any of the following:

[0010] (1) Identification of the weaning weight trait of Yongdeng 7 goats;

[0011] (2) Screening for Yongdeng 7 goats with high weaning weight traits;

[0012] (3) Breed Yongdeng 7 goats with high weaning weight traits.

[0013] The present invention also provides a primer pair for detecting the above SNP molecular marker, the sequence of the upstream primer is shown as SEQ ID NO: 2, and the sequence of the downstream primer is shown as SEQ ID NO: 3.

[0014] The present invention also provides a kit for identifying the weaning weight trait of Yongdeng 7 goats, comprising the above primer pair.

[0015] Preferably, the kit further comprises a standard positive template.

[0016] The present invention also provides the use of the above primer pair or the above kit in any of the following:

[0017] (1) Identification of the weaning weight trait of Yongdeng 7 goats;

[0018] (2) Screening for Yongdeng 7 goats with high weaning weight traits;

[0019] (3) Breed Yongdeng 7 goats with high weaning weight traits.

[0020] The present invention also provides a method for identifying the weaning weight of Yongdeng 7 goats using the above SNP molecular markers, comprising the following steps:

[0021] (1) Using the genomic DNA of the Yongdeng 7 goats to be tested as a template, PCR amplification was performed using the specific primers of the above-mentioned SNP molecular markers to obtain a PCR product;

[0022] (2) Sequencing the PCR products;

[0023] (3) Result judgment: When there is T at the 289th base of the PCR product and the genotype is TT or TC, it manifests as a high weaning weight trait; when there is C at the 289th base of the PCR product and the genotype is CC, it manifests as a low weaning weight trait.

[0024] The present invention also provides a breeding method for high weaning weight Yongdeng 7 goats, the method comprising: using the molecular marker to select the high weaning weight trait from the 289th T / C mutation at the 5' end, and selecting individuals carrying the TT genotype or the TC genotype.

[0025] Further preferably, individuals carrying the TT genotype are used as breeding goats to breed high weaning weight Yongdeng 7 goat offspring.

[0026] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0027] The present invention proposes for the first time a SNP molecular marker associated with the weaning weight of Yongdeng 7 goats, and the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. When the 289th base of the SNP molecular marker is T and the genotype is TT or TC, the Yongdeng 7 goats show a high weaning weight trait, and when the 289th base of the SNP molecular marker is only C and the genotype is CC, the Yongdeng 7 goats show a low weaning weight trait. The mutation site of the SNP molecular marker of the present invention is located at the base of the 5343313th site on chromosome 3 of the international sheep genome Oar_v4.0 version. When the base T mutates to C, there are two genotypes, TC and CC, wherein the genotype TC shows high weaning weight, and the genotype CC shows low weaning weight. The present invention verified that the weaning weight of the Yongdeng 7 goats with genotypes TT and TC was significantly higher than that of the genotype CC (P<0.05), and there was no significant difference between the genotypes TT and TC (P>0.05), and both showed a high weaning weight trait.

[0028] The present invention further provides a method for identifying the weaning weight trait of Yongdeng Seven goats based on the SNP molecular marker, and screening or breeding Yongdeng Seven goats with high weaning weight trait, the method has high accuracy, fast detection speed, low cost, and easy result interpretation. The present invention uses PCR technology to detect nucleotide polymorphisms significantly associated with the weaning weight of Yongdeng Seven goats, which can realize rapid and automated detection of SNP site polymorphisms associated with weaning weight, retain Yongdeng Seven goat individuals with genotypes of TT and TC, and use them for early breeding selection, which has important application value in realizing large-scale molecular precision breeding of Yongdeng Seven goats. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Agarose gel electrophoresis was used to detect the amplification product results;

[0030] Figure 2 Sequencing of PCR products to obtain peak graphs and sequences;

[0031] Figure 3 The figure shows the typing results of genotypes according to sample clusters and fluorescence types. DETAILED DESCRIPTION

[0032] The invention provides a SNP molecular marker associated with the weaning weight of Yongdeng seven goats. The nucleotide sequence (632 bp) of the SNP molecular marker is: ACCTAGCTTGCCGACTGCTGGTGGGTGCATGCTCTCTGGTCGC CTGGGACCAGCCTGGGGGCTCCAGAGTCAGGCAGACGGGGGATGACCTGGGGCTCTGCCACCAACTAGCTGTAGGACCTCTAGCAAGTCACTTGGCCTCTCTGGGCTAGTCTGTTTTGTTTTTCCTCTTGTAACACAGGAATACTAGTGTCCACCTTCCAAGGGCTATTGTGAAGTCAGAGAGATGTTGTCTCACTGATGTACAATGCTGAGCAGGGTCCCTGCCACGTAGCGAGCCTTCAAGC T TCTGGGTTAGGAACTGGTCTTTTTTTACAAAGGCGGCAAAGACCTCTCTCCCTCTGAGTGACTCTTTCAGAAGCACCCACCTGCCCCCCTGAAGTCTGGCCCCTCCTCCATACCTGGCTGGTGAGAAGCCAGACCCCAGGAATCCTTAGTCTGGGGTTCCTTGTGGATTCCTGGCACTTCTCTTCCAGAATGTTCCACTCAGACCATGCAGCCACAGAGGAGGATGTCCCACACTGAGTCACATCCCACCTTCCCTGGGTGTGGCCATGGCGTGGCCCCACCCTGAACCTGGACGGATGCACGTGAAGTCGGGTGCAGAACGCACGGCGAGCAGGCATGTACC (the site in bold and underlined is the mutation site, which is the 289th position in the sequence).

[0033] The SNP site of the present invention is located at the base of the 5343313th position on chromosome 3 of the international sheep genome Oar_v4.0 version, and the mutant base is T or C; when the base is T, it is a TT genotype; when the base mutates to C, there is a TC or CC genotype; the weaning weight of the Yongdeng 7 goat individuals with the genotype TT and TC is significantly higher than that of the genotype CC individuals (P<0.05), and there is no significant difference between the genotypes TT and TC (P>0.05), and both show a high weaning weight trait; the Yongdeng 7 goat individuals with the genotype CC show a low weaning weight trait.

[0034] The present invention also provides the use of the above-mentioned SNP molecular marker in any of the following:

[0035] (1) Identification of the weaning weight trait of Yongdeng 7 goats. The present invention can identify the genotype of the SNP site to determine at an early stage whether the weaning weight trait of Yongdeng 7 goats is high weaning weight or low weaning weight;

[0036] (2) Screening Yongdeng 7 goats with high weaning weight traits. The present invention can screen Yongdeng 7 goat individuals with high weaning weight traits at an early stage by detecting the genotype of the SNP site;

[0037] (3) Breeding Yongdeng 7 goats with high weaning weight traits. The present invention can select breeding goats with genotype TT or TC by detecting the genotype of the SNP site, and then breed Yongdeng 7 goat individuals showing high weaning weight traits.

[0038] The present invention also provides a primer pair for detecting the above SNP molecular marker, the upstream primer is F: 5'-AGCAGGTCCACAGACTCCCAAGGAC-3', the sequence is shown in SEQ ID NO: 2, and the sequence of the downstream primer is 5'-GAGAGACCACGGTACACTGCCTGCT-3', the sequence is shown in SEQ ID NO: 3. The present invention uses the genomic DNA of the Yongdeng 7 goats to be identified as a template, and uses the primer pair to amplify a sequence containing the above mutation site, including the sequence shown in SEQ ID NO.1, and the amplified fragment length is 632bp, which is used for subsequent sequencing to determine the genotype and weaning weight trait.

[0039] The present invention also provides a kit for identifying the weaning weight trait of Yongdeng 7 goats, comprising a DNA extraction kit, a PCR amplification kit and a sequencing kit; the PCR amplification kit comprises the above primer pair. Preferably, the kit also comprises a standard positive template, which can be a marker or a nucleotide shown in SEQ ID NO.1. The present invention does not limit the DNA extraction kit and sequencing kit, and conventional kits in the art can be used.

[0040] The present invention also provides the use of the above primer pair or the above kit in any of the following:

[0041] (1) Identification of the weaning weight trait of Yongdeng 7 goats. The present invention can identify the genotype of the SNP site to determine at an early stage whether the weaning weight trait of Yongdeng 7 goats is high weaning weight or low weaning weight;

[0042] (2) Screening Yongdeng 7 goats with high weaning weight traits. The present invention can screen Yongdeng 7 goat individuals with high weaning weight traits at an early stage by detecting the genotype of the SNP site;

[0043] (3) Breeding Yongdeng 7 goats with high weaning weight traits. The present invention can select breeding goats with genotype TC or TT by detecting the genotype of the SNP site, and then breed Yongdeng 7 goat individuals showing high weaning weight traits.

[0044] The present invention also provides a method for identifying the weaning weight of Yongdeng 7 goats using the above SNP molecular markers, comprising the following steps:

[0045] (1) Using the genomic DNA of the Yongdeng 7 goats to be tested as a template, PCR amplification was performed using the specific primers of the above-mentioned SNP molecular markers to obtain a PCR product;

[0046] (2) Sequencing the PCR products;

[0047] (3) Result judgment: When there is T at the 289th base of the PCR product and the genotype is TT or TC, it manifests as a high weaning weight trait; when there is C at the 289th base of the PCR product and the genotype is CC, it manifests as a low weaning weight trait.

[0048] The Yongdeng 7 goat genomic DNA to be tested in the present invention is preferably extracted from a blood sample.

[0049] The PCR amplification system of the present invention is preferably: 25 μL of 2×PARMS master mix, 1.5 μL of upstream and downstream primers, 5 μL of template, and ddH2O supplemented to 50 μL. The PCR amplification program: 94°C, 20 min, 1 cycle, 94°C, 20s, 58°C, 30s, 38 cycles, 72°C, 1 min. The PCR product obtained by the present invention is detected by agarose gel electrophoresis, and after the detection is qualified, it is sequenced, preferably by direct sequencing. The present invention analyzes the sequencing results. If the PCR product has T at the 289th base from the 5' end, its genotype can be expressed as TC or TT, and the individual shows a high weaning weight trait; the PCR product has only C at the 289th base from the 5' end, and its genotype is CC, and the individual shows a low weaning weight trait.

[0050] The present invention also provides a breeding method for Yongdeng 7 goats with high weaning weight, the method comprising: using the above-mentioned molecular marker to select the high weaning weight trait from the 289th T / C mutation at the 5' end, and selecting individuals carrying the TT genotype or the TC genotype. That is, the present invention uses the above-mentioned method for identifying the weaning weight of Yongdeng 7 goats, judges the genotype of the individual according to the sequencing result, selects individuals carrying the TT genotype or the TC genotype as breeding goats, and most of the offspring obtained by breeding carry the TT genotype or the TC genotype, and the part of the offspring exhibits the high weaning weight trait. Further preferably, the present invention selects individuals carrying the TT genotype (homozygous) as breeding goats, and without considering the gene mutation, all the bred Yongdeng 7 goat offspring exhibit high weaning weight.

[0051] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0052] In a specific embodiment of the present invention, EDTA-K2 blood collection tubes were purchased from Gansu Shengruisi Biotechnology Co., Ltd.; blood genome extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer (ThermoFisher Scientific), DL2000Marker, agarose, and nucleic acid dyes were all from Beijing Solebold Technology Co., Ltd.; PARMS mix was purchased from Wuhan Jingpeptide Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Gansu Shengruisi Biotechnology Co., Ltd., and PCR instrument was purchased from BioRad.

[0053] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0054] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0055] Example 1

[0056] 1. Sample collection

[0057] A total of 107 samples of blood from Yongdeng Seven Goats with complete production records were collected from the Yongdeng Seven Goat Breeding Base in Qishan Township, Yongdeng County, Lanzhou City, Gansu Province. 5 mL of blood was collected from the jugular vein of all goats. The blood was collected in a blood collection tube containing EDTA-K2 anticoagulant, and the sample number was recorded. The blood was transported back to the laboratory within 24 hours and stored at -80°C for subsequent DNA extraction. The weaning weight data of each goat was provided by the Yongdeng Seven Goat Breeding Base.

[0058] 2. Methods

[0059] 2.1 DNA extraction

[0060] Blood DNA of all Yongdeng seven goat samples was extracted using a blood genome extraction kit, and then the concentration and purity were tested using an ultraviolet spectrophotometer. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -80°C for future use.

[0061] 2.2 Primer design

[0062] Based on the gene sequence of chromosome 3 of the sheep reference genome Oar_4.0 version, specific primers were designed using Primerpremier software. The upstream primer was F: 5'-AGCAGGTCCACAGACTCCCAAGGAC-3', the sequence is shown in SEQ ID NO: 2, and the sequence of the downstream primer was 5'-GAGAGACCACGGTACACTGCCTGCT-3', the sequence is shown in SEQ ID NO: 3, and the specific primer contains the g5343313T>C SNP site. The primers were synthesized by Wuhan Jingpeptide Biotechnology Co., Ltd.

[0063] 2.3 PCR amplification and sequencing

[0064] PCR amplification 50 μL: 2×PARMS master mix 25 μL, upstream and downstream primers 1.5 μL each, template 5 μL, ddH2O to 50 μL.

[0065] PCR amplification program: 94 °C, 20 min, 1 cycle, 94 °C, 20 s, 58 °C, 30 s, 38 cycles, 72 °C, 1 min.

[0066] 2.4 PCR product sequencing and result analysis

[0067] The PCR product was detected by 1.5% agarose gel electrophoresis. Figure 1 As shown in the figure, M is a marker, and lanes 1 to 10 are PCR amplification product bands of some samples. The results show that the PCR product bands are clear and bright, and the PCR product fragment size is 632bp, which is in line with the expected size and can be used for subsequent sequencing.

[0068] The PCR product was recovered and purified, and then sequenced by direct sequencing, which was completed by Wuhan Jingpeptide Biotechnology Co., Ltd. The peak diagram and sequence obtained by PCR product sequencing are as follows Figure 2 The PCR product sequencing results were compared using MEGA 11.0 software and the sequencing peaks were analyzed. Figure 2It can be seen that the g5343313T>C SNP site has a TC mutation, and there are three genotypes: TT, TC, and CC.

[0069] The typing results were checked using SNPviewer2 software (LGC Genomics). Figure 3 As shown. Figure 3 The results show that the genotypes are divided into three types: TT, TC, and CC according to the sample clusters and fluorescence types.

[0070] According to the genotyping results, the number of individuals with different genotypes at the site was counted.

[0071] Popgen software was used to calculate the g5343313T>C gene frequency, genotype frequency, effective number of alleles (Ne), and site heterozygosity (He), and PIC calculation software was used to calculate the polymorphism information content. The results are shown in Table 1.

[0072] Table 1 Polymorphism of the g5343313T>C SNP locus on chromosome 3 of Yongdeng seven goats

[0073]

[0074] Through the analysis of the genotype and allele frequency of the g5343313T>C SNP site on chromosome 3 of Yongdeng 7 goats, it was found that the genotype TC had the highest frequency at this site, which was the dominant genotype, and the T allele frequency was 51.4%, which was the dominant allele. The He of this site was 0.499, Ne was 1.998, and PIC was 0.375, which was a moderate polymorphism.

[0075] The correlation between different genotypes and weaning weight of Yongdeng seven goats was analyzed by IBM SPSS Statistic 27 software. The results were expressed as “mean ± standard error” and are shown in Table 2.

[0076] Table 2 Association analysis between different genotypes and weaning weight of Yongdeng seven goats

[0077]

[0078] Note: Data in the same row marked with different lowercase letters indicate significant differences (P<0.05).

[0079] The association between different genotypes and weaning weight of Yongdeng 7 goats was analyzed by general linear model in IBM SPSS Statistic 27 software. The results showed that the weaning weight of Yongdeng 7 goats with TT and TC genotypes was significantly higher than that of individuals with CC genotype (P<0.05), and there was no significant difference between individuals with TT and TC genotypes (P>0.05). By detecting the bases of the SNP site on chromosome 3 of Yongdeng 7 goats, the weaning weight trait of Yongdeng 7 goats can be determined.

[0080] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the weaning weight of Yongdeng 7 goats, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1.

2. The molecular marker according to claim 1, characterized in that When the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, the Yongdeng 7 goats show a high weaning weight trait.

3. Use of the SNP molecular marker according to claim 1 or 2 in any of the following: (1) Identification of the weaning weight trait of Yongdeng 7 goats; (2) Screening for Yongdeng 7 goats with high weaning weight traits; (3) Breed Yongdeng 7 goats with high weaning weight traits.

4. A primer pair for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The sequence of the upstream primer is shown in SEQ ID NO:2, and the sequence of the downstream primer is shown in SEQ ID NO:

3.

5. A kit for identifying the weaning weight trait of Yongdeng 7 goats, characterized in that: It comprises a DNA extraction kit, a PCR amplification kit and a sequencing kit; the PCR amplification kit comprises the primer pair according to claim 4.

6. The kit according to claim 5, characterized in that The PCR amplification kit also includes a standard positive template.

7. Use of the primer pair according to claim 4 or the kit according to any one of claims 5 to 6 in any of the following: (1) Identification of the weaning weight trait of Yongdeng 7 goats; (2) Screening for Yongdeng 7 goats with high weaning weight traits; (3) Breed Yongdeng 7 goats with high weaning weight traits.

8. A method for identifying the weaning weight of Yongdeng seven goats, characterized in that: The following steps are involved: (1) using the genomic DNA of the Yongdeng 7 goat to be tested as a template, and performing PCR amplification using the specific primers of the SNP molecular marker described in claim 4 to obtain a PCR product; (2) Sequencing the PCR products; (3) Result judgment: When there is T at the 289th base of the PCR product and the genotype is TT or TC, it manifests as a high weaning weight trait; when there is C at the 289th base of the PCR product and the genotype is CC, it manifests as a low weaning weight trait.

9. A method for breeding high weaning weight Yongdeng 7 goats, characterized in that: The method comprises: using the genomic DNA of the Yongdeng 7 goats to be tested as a template, performing PCR amplification using the specific primers of the SNP molecular markers of claim 4 to obtain PCR products; sequencing the PCR products; and selecting individuals carrying the TT genotype or the TC genotype.

10. The method according to claim 9, characterized in that Individuals carrying the TT genotype were used as breeding goats to breed high weaning weight Yongdeng 7 goat offspring.

Images