KASP molecular marker linked with wheat stripe rust resistance gene Yr85 and application of KASP molecular marker

Abstract

The invention relates to a KASP molecular marker linked with a wheat stripe rust resistance gene Yr85 and application of the KASP molecular marker. The KASP molecular marker comprises XK1B-63 and / or XK1B-65, the KASP molecular marker and a wheat stripe rust resistance gene Yr85 are co-localized on a wheat 1BS chromosome, the nucleotide sequence of XK1B-63 is as shown in SEQ ID NO.1, and the polymorphism of XK1B-63 is C / G; the nucleotide sequence of the XK1B-65 is as shown in SEQ ID NO. 2, and the polymorphism of the XK1B-65 is A / G. The KASP molecular marker is closely linked with the stripe rust resistant gene Yr85, can accurately identify wheat stripe rust resistant plants, and is of great significance to wheat germplasm resource stripe rust resistant gene screening, wheat stripe rust resistant material creation or molecular assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat gene detection, and specifically relates to a KASP molecular marker linked to a wheat stripe rust resistance gene Yr85 and an application thereof. Background Art

[0002] Wheat is an important food crop in my country, and its production is closely related to national food security. Wheat stripe rust is one of the important airborne leaf diseases caused by Puccinia striiformis f.sp.tritici (Pst), which often causes a 5-25% loss in wheat yield, and in years with severe stripe rust, it may even lead to 100% crop failure. At present, there are two main methods for the prevention and control of wheat stripe rust: chemical control and planting disease-resistant varieties. However, chemical control often causes serious pollution to the environment, and planting disease-resistant varieties is the most effective, economical and environmentally friendly strategy.

[0003] At present, 86 stripe rust resistance genes and more than 380 QTLs have been located and reported, but most of them are in the initial positioning stage, with problems such as inaccurate positioning intervals and linkage drag, and few have been successfully applied in production. In addition, stripe rust fungi also have toxic variation, which will lead to the emergence of new physiological races, which often cause the loss of rust resistance in disease-resistant varieties. For example, with the emergence of strong pathogenic races such as CYR32, CYR33 and CYR34, the disease resistance genes Yr9, Yr26 and YrZH84 widely used in my country have successively lost their disease resistance. Therefore, there is an urgent need to explore and utilize new disease resistance gene resources and molecular markers of corresponding genes to further accelerate the process of molecular-assisted breeding for disease resistance in wheat.

[0004] The wheat stripe rust resistance gene Yr85 is an ASR gene, which was first discovered in the American winter wheat variety Tres. It has broad-spectrum resistance to the main stripe rust physiological races prevalent in my country, such as CYR32, CYR33 and CYR34, and has maintained a high degree of disease resistance under natural field conditions. It has great application potential in wheat disease resistance breeding in my country. Up to now, there are few studies on Yr85, which limits the application of this gene in breeding. Therefore, the development of a KASP molecular marker co-segregated with the wheat stripe rust resistance gene Yr85 is of great significance for promoting the application of the Yr85 gene in molecular breeding. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects in the prior art and provide a KASP molecular marker linked to the wheat stripe rust resistance gene Yr85 and its application. The KASP molecular marker is tightly linked to the stripe rust resistance gene Yr85 and can accurately identify wheat stripe rust resistance plants. It is of great significance for the screening of wheat germplasm resources for the stripe rust resistance gene Yr85, the creation of wheat stripe rust resistance materials or molecular assisted breeding of wheat stripe rust resistance.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A KASP molecular marker linked to a wheat stripe rust resistance gene Yr85, the KASP molecular marker comprising XK1B-63 and / or XK1B-65; the nucleotide sequence of XK1B-63 is shown in SEQ ID NO.1, and the polymorphism of XK1B-63 is C / G; the nucleotide sequence of XK1B-65 is shown in SEQ ID NO.2, and the polymorphism of XK1B-65 is A / G.

[0008] As a further technical solution, the KASP molecular marker and the wheat stripe rust resistance gene Yr85 are co-localized on the wheat 1BS chromosome.

[0009] A primer set for amplifying the KASP molecular marker, comprising an XK1B-63 amplification primer set and an XK1B-65 amplification primer set; wherein the XK1B-63 amplification primer set comprises: a disease resistance site forward primer XK1B-63-HEX with a nucleotide sequence as shown in SEQ ID NO.3; a disease sensitivity site forward primer XK1B-63-FAM with a nucleotide sequence as shown in SEQ ID NO.4; and a common reverse primer XK1B-63-Common with a nucleotide sequence as shown in SEQ ID NO.5;

[0010] The XK1B-65 amplification primer set includes: a forward primer XK1B-65-FAM for a susceptible site whose nucleotide sequence is shown in SEQ ID NO.6; a forward primer XK1B-65-HEX for a resistant site whose nucleotide sequence is shown in SEQ ID NO.7; and a common reverse primer XK1B-65-Common whose nucleotide sequence is shown in SEQ ID NO.8.

[0011] A kit for detecting the KASP molecular marker comprises a primer set for the KASP molecular marker.

[0012] A method for detecting whether wheat contains the stripe rust resistance gene Yr85, comprising the following steps:

[0013] The genomic DNA of the wheat material to be tested is used as a template, and the primer set labeled with the KASP molecule is used for amplification, and the amplified product is transferred to an ELISA instrument to read the fluorescence data, and it is determined whether the wheat to be tested contains the stripe rust resistance gene Yr85 according to the fluorescence data of the amplified product.

[0014] As a further technical solution, the primer set of the KASP molecular marker was used for amplification, and the molecular reaction system used was: 0.2 μg of DNA of the wheat material to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of primer mixture, and 1.9552 μL of ddH2O;

[0015] As a further technical solution, the primer set of the KASP molecular marker was used for amplification, and the reaction procedure adopted was: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C per cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

[0016] As a further technical solution, in the primer mixture, the concentrations of the forward primer and the reverse primer are both 12 μM, and the concentration of the shared reverse primer is 30 μM.

[0017] As a further technical solution, judging whether the tested wheat contains the stripe rust resistance gene Yr85 according to the fluorescence data of the amplified product includes:

[0018] The fluorescence data is imported into KlusterCaller software for analysis to obtain the genotype, and the genotype is used to determine whether the wheat material to be tested contains the stripe rust resistance gene Yr85;

[0019] When the genotype of XK1B-63 and / or the genotype of XK1B-65 is a homozygous allele genotype or a heterozygous genotype with HEX fluorescence, it indicates that the wheat material to be tested contains the stripe rust resistance gene Yr85; when the genotype of XK1B-63 and / or the genotype of XK1B-65 is a homozygous allele genotype with FAM fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene Yr85.

[0020] As a further technical solution, the genotype of the homozygous allele with HEX fluorescence is "Y:Y", the genotype of the homozygous allele with FAM fluorescence is "X:X", and the genotype of the heterozygous allele is "X:Y" or "Y:X";

[0021] In XK1B-63, if the genotype is "Y:Y" or "X:Y" or "Y:X", the wheat material to be tested contains the stripe rust resistance gene Yr85; if the genotype is "X:X", the wheat material to be tested does not contain the stripe rust resistance gene Yr85;

[0022] In XK1B-65, if the genotype is "Y:Y" or "X:Y" or "Y:X", the wheat material to be tested contains the stripe rust resistance gene Yr85, and if the genotype is "X:X", the wheat material to be tested does not contain the stripe rust resistance gene Yr85.

[0023] The KASP molecular marker or the kit is used in identifying whether wheat materials contain the stripe rust resistance gene Yr85, screening germplasm resources of the wheat stripe rust resistance gene Yr85, screening wheat stripe rust resistance materials, creating wheat stripe rust resistance materials or molecular assisted breeding of wheat stripe rust resistance.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention obtains a SNP site tightly linked to the wheat stripe rust resistance gene Yr85 through research, and develops a KASP marker tightly linked to Yr85 based on the SNP site, which has a co-segregation characteristic, and the detection process is simple, rapid, and high-throughput, and can accurately identify wheat stripe rust-resistant plants containing the Yr85 gene, which is of great significance for the screening of wheat germplasm resources for stripe rust resistance genes, the creation of wheat stripe rust resistance materials, or molecular-assisted breeding of wheat stripe rust resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the genetic map of Yr85 in Example 1;

[0027] Figure 2 The genotyping result of the XK1B-63 marker in Example 2;

[0028] Figure 3 The genotyping result of the XK1B-65 marker in Example 2;

[0029] Figure 4 This is a comparison of disease resistance of wheat materials containing Yr85 and not containing Yr85 based on XK1B-63 genotyping in Example 3.

[0030] Figure 5 This is a comparison of the disease resistance of wheat materials with and without Yr85 genotyped with XK1B-65 in Example 3.

[0031] Figure 6 The genotyping results of the XK1B-63 marker in the population material in Example 4;

[0032] Figure 7 This is the genotyping result of the XK1B-65 marker in the population material in Example 4. DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1: Genetic localization of Yr85 and acquisition of tightly linked KASP molecular markers

[0035] A method for genetically locating a wheat stripe rust resistance gene Yr85 and obtaining a tightly linked KASP molecular marker comprises the following steps:

[0036] The single gene line wheat material AvsYrTr1NIL of Yr85 was crossed with the susceptible wheat variety Avocet S to construct a secondary segregation population. The secondary segregation population was phenotypically identified and genotyped using KASP molecular markers. The genetic map of Yr85 was constructed using phenotypic and genotypic data to complete the genetic localization of Yr85. The results are shown in Figure 1 ;

[0037] The phenotypic identification method uses the infection type (IT) indicator and adopts the 0-9 identification standard developed by Line and Qayoum. IT of 0-6 indicates that the plant is resistant to the disease, and IT of 7-9 indicates that the plant is susceptible to the disease.

[0038] All KASP molecular markers used in this example were derived from the Wheat660KSNP chip data and resequencing data of the parents AvsYrTr1NIL and Avocet S. SNP sites in the 1BS region were screened, and the SNP sites were converted into KASP markers for gene localization. After gene localization, markers closely linked to Yr85 were selected for typing in natural populations, and the successfully typed markers were used as detection markers for Yr85. KASP primer design was completed using the Polymarker website (http: / / www.polymarker.info / ), and the primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0039] KASP molecular marker XK1B-63 is derived from the resequencing data of the parents AvsYrTr1NIL and Avocet S, and is co-segregated with Yr85. The nucleotide sequence is shown in SEQ ID NO.1, specifically:

[0040] 5′-ATGGGTGGTGATTGTTTGGTAAGGAGGACAATGTGAGCATGTAGTGTTCC[C / G]TCAATCA GTCAGTCTCACCTTACAGTCACACGTGTGAAATAGTTGAAGGT-3′.

[0041] The disease resistance site forward primer XK1B-63-HEX of XK1B-63 is shown in SEQ ID NO.3, specifically:

[0042] 5′-GAAGGTGACCAAGTTCATGCTtgtgagcatgtagtgttccC-3′;

[0043] The forward primer XK1B-63-FAM of the susceptible site of WRS-T 64 is shown in SEQ ID NO.4, specifically:

[0044] 5′-GAAGGTCGGAGTCAACGGATTtgtgagcatgtagtgttccG-3′;

[0045] The common reverse primer XK1B-63-Common of XK1B-63 is shown in SEQ ID NO.5, specifically:

[0046] 5′-acacgtgtgactgtaaggtga-3′.

[0047] KASP molecular marker XK1B-65 was derived from the resequencing data of the parents Avs YrTr1NIL and Avocet S, and was co-segregated with Yr85. Its nucleotide sequence is shown in SE QID NO.2, specifically:

[0048] 5′-ATTCGATACTAACAGAACTTTTAGTTACCTTTAGCAATTTCAATGGTGAG[A / G]GAAGGTATGATCATGCCACTGTATGAATCGCCGGCAATGTAGAGCGGGTT-3′;

[0049] The forward primer XK1B-65-FAM of the susceptible site of XK1B-65 is shown in SEQ ID NO.6, specifically:

[0050] 5′-GAAGGTGACCAAGTTCATGCTacctttagcaatttcaatggtgagA-3′;

[0051] The disease resistance site forward primer XK1B-65-HEX of XK1B-65 is shown in SEQ ID NO.7, specifically:

[0052] 5′-GAAGGTCGGAGTCAACGGATTacctttagcaatttcaatggtgagG-3′;

[0053] The common reverse primer XK1B-65-Common of XK1B-65 is shown in SEQ ID NO.8, specifically:

[0054] 5′-ttgccggcgattcatacagt-3′.

[0055] Among them, 5′-GAAGGTGACCAAGTTCATGCT-3′ is the FAM fluorescent universal primer, and the FAM fluorescent group is observed and read at an excitation light of 485 nm and an emission light of 520 nm.

[0056] 5′-GAAGGTCGGAGTCAACGGATT-3′ is a HEX fluorescent universal primer. The HEX fluorescent group is observed and read at an excitation light wavelength of 535 nm and an emission light wavelength of 556 nm.

[0057] Example 2: Genotyping and identification of whether the strain contains the stripe rust resistance gene Yr85

[0058] The method for identifying whether wheat materials contain the stripe rust resistance gene Yr85 comprises the following steps:

[0059] Step 1: Using the CTAB method to extract the genomic DNA of the wheat material to be tested as a template for DNA amplification;

[0060] Step 2: Using the genomic DNA of the wheat material to be tested as a template, and using the primer set of KASP molecular markers XK1B-63 and XK1B-65 obtained in Example 1, perform fluorescence quantitative PCR amplification to obtain an amplified product;

[0061] The reaction system of fluorescence quantitative PCR amplification was: 0.2 μg DNA template, 2 μL 2×KASPV 4.0 Master mix, 0.0448 μL amplification primer set, and 1.9552 μL ddH2O.

[0062] In the primer set, the concentrations of the disease-resistant site forward primer XK1B-63-HEX, the susceptible site forward primer XK1B-63-FAM, the susceptible site forward primer XK1B-65-FAM and the disease-resistant site forward primer XK1B-65-HEX are all 12 μM, and the concentrations of the common reverse primer XK1B-63-Common and the common reverse primer XK1B-65-Common are 30 μM.

[0063] The reaction procedure of fluorescence quantitative PCR amplification was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

[0064] Step 3: Move the amplified product to a microplate reader to read the fluorescence data, and then import the fluorescence data into KlusterCaller software for analysis to obtain genotype data and obtain the genotype; determine whether the plant to be tested is resistant to stripe rust based on the genotype result of the amplified product.

[0065] The genotype of the homozygous allele with HEX fluorescence is "Y:Y", the genotype of the homozygous allele with FAM fluorescence is "X:X", and the genotype of the heterozygous allele is "X:Y" or "Y:X";

[0066] In XK1B-63, if the genotype is "Y:Y" or "X:Y" or "Y:X", the wheat material to be tested contains the stripe rust resistance gene Yr85; if the genotype is "X:X", the wheat material to be tested does not contain the stripe rust resistance gene Yr85;

[0067] In XK1B-65, if the genotype is "Y:Y" or "X:Y" or "Y:X", the wheat material to be tested contains the stripe rust resistance gene Yr85, and if the genotype is "X:X", the wheat material to be tested does not contain the stripe rust resistance gene Yr85.

[0068] Example 3: Application in disease resistance breeding

[0069] The disease resistance gene detection of AvsYrTr1NIL / Avocet S F2 progeny materials was performed using the KASP molecular markers XK1B-63 and XK1B-65 described in Example 1 and the method described in Example 2. The detection results of the two molecular markers were consistent, showing that 53 wheat samples contained Yr85 and the genotype was homozygous; 106 wheat samples contained Yr85, but the genotype was heterozygous; 35 wheat samples did not contain Yr85; the disease resistance of these wheat samples was identified, and the results showed that the wheat containing Yr85 had lower disease severity than the wheat not containing Yr85 ( Figure 4 , Figure 5 ). These results indicate that XK1B-63 and XK1B-65 can be used for molecular detection of wheat stripe rust resistance gene Yr85 and screening of disease-resistant wheat.

[0070] Example 4: Application in genetically diverse populations

[0071] Identifying the stripe rust resistance genes contained in disease-resistant wheat germplasm resources will have guiding significance for the application of these germplasms in disease-resistant breeding.

[0072] The KASP molecular markers XK1B-63 and XK1B-65 described in Example 1 and the method described in Example 2 were used to perform molecular detection on 220 wheat natural population germplasm resources and the disease-resistant parent AvsNILYrTr1. The results showed that ( Figure 6 , Figure 7 ), except for the positive control, all wheat materials did not contain Yr85, which indicated that Yr85 has not been widely used in wheat breeding and has potential breeding value. These results indicate that XK1B-63 and XK1B-65 can distinguish Yr85 from other disease resistance genes and can be used for germplasm screening of wheat stripe rust resistance gene Yr85.

[0073] The above-described embodiments are only preferred embodiments of the present invention, and are not exhaustive of the feasible implementations of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A KASP molecular marker linked to the wheat stripe rust resistance gene Yr85, characterized in that: The KASP molecular marker comprises XK1B-63 and / or XK1B-65; the nucleotide sequence of XK1B-63 is shown in SEQ ID NO.1, and the polymorphism of XK1B-63 is C / G; the nucleotide sequence of XK1B-65 is shown in SEQ ID NO.2, and the polymorphism of XK1B-65 is A / G.

2. The KASP molecular marker linked to the wheat stripe rust resistance gene Yr85 according to claim 1, characterized in that: The KASP molecular marker and the wheat stripe rust resistance gene Yr85 are co-localized on the wheat 1BS chromosome.

3. A primer set for amplifying the KASP molecular marker according to claim 1 or 2, characterized in that: It includes XK1B-63 amplification primer set and XK1B-65 amplification primer set; wherein, The XK1B-63 amplification primer set includes: a disease resistance site forward primer XK1B-63-HEX, whose nucleotide sequence is shown in SEQ ID NO.3; a disease susceptible site forward primer XK1B-63-FAM, whose nucleotide sequence is shown in SEQ ID NO.4; and a common reverse primer XK1B-63-Common, whose nucleotide sequence is shown in SEQ ID NO.5; The XK1B-65 amplification primer set includes: a forward primer XK1B-65-FAM for the susceptible site whose nucleotide sequence is shown in SEQ ID NO.6; a forward primer XK1B-65-HEX for the resistant site whose nucleotide sequence is shown in SEQ ID NO.7; and a common reverse primer XK1B-65-Common whose nucleotide sequence is shown in SEQ ID NO.

8.

4. A kit for detecting the KASP molecular marker according to claim 1, characterized in that: A primer set comprising the KASP molecular marker according to claim 3.

5. A method for detecting whether wheat contains the stripe rust resistance gene Yr85, characterized in that: The following steps are involved: The genomic DNA of the wheat material to be tested is used as a template, and the primer set of the KASP molecular marker described in claim 3 is used for amplification, and the amplified product is moved to an ELISA instrument to read the fluorescence data, and the fluorescence data of the amplified product is used to determine whether the wheat to be tested contains the stripe rust resistance gene Yr85.

6. A method for detecting whether wheat contains the stripe rust resistance gene Yr85 according to claim 5, characterized in that: Amplification was performed using the primer set of the KASP molecular marker of claim 3, and the molecular reaction system used was: 0.2 μg of DNA of the wheat material to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of primer mixture, and 1.9552 μL of ddH2O; The reaction program used was: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65°C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 32 cycles.

7. A method for detecting whether wheat contains the stripe rust resistance gene Yr85 according to claim 5, characterized in that: In the primer mixture, the concentrations of the forward primer and the reverse primer are both 12 μM, and the concentration of the shared reverse primer is 30 CM.

8. The method for detecting whether wheat contains the stripe rust resistance gene Yr85 according to claim 5, characterized in that: Judging whether the tested wheat contains the stripe rust resistance gene Yr85 according to the fluorescence data of the amplified product includes: The fluorescence data is imported into KlusterCaller software for analysis to obtain the genotype, and the genotype is used to determine whether the wheat material to be tested contains the stripe rust resistance gene Yr85; When the genotype of XK1B-63 and / or the genotype of XK1B-65 is a homozygous allele genotype or a heterozygous genotype with HEX fluorescence, it indicates that the wheat material to be tested contains the stripe rust resistance gene Yr85; when the genotype of XK1B-63 and / or the genotype of XK1B-65 is a homozygous allele genotype with FAM fluorescence, the wheat material to be tested does not contain the stripe rust resistance gene Yr85.

9. Use of the KASP molecular marker according to any one of claims 1 to 3 or the kit according to claim 4 in identifying whether wheat materials contain the stripe rust resistance gene Yr85, screening germplasm resources of the wheat stripe rust resistance gene Yr85, screening wheat stripe rust resistance materials, creating wheat stripe rust resistance materials or molecular assisted breeding of wheat stripe rust resistance.

Images