Application of reagent for inhibiting DUSP23 expression in preparation of anti-hepatoma drugs

Abstract

The invention discloses DUSP23 targeted siRNA and application thereof, and belongs to the technical field of molecular biotechnology and genetic engineering. By researching the expression level of DUSP23 in liver cancer tissues, an action target of the DUSP23 gene is provided for treatment of liver cancer; the invention provides siRNA for inhibiting expression of a human DUSP23 gene and protein and application of the siRNA. The nucleotide sequence of the siRNA is shown as SEQ ID NO.5-SEQ ID NO.6. The invention further provides a preparation method of the siRNA. By transfecting the siRNA in a hepatoma carcinoma cell line, DUSP23 gene and protein expression can be regulated and interfered, cell proliferation and migration ability can be inhibited, cell cycle G0 / G1 phase arrest and cell apoptosis can be induced, and the siRNA has remarkable tumor inhibition activity on transplanted tumor in nude mice of hepatoma carcinoma cells.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and genetic engineering, and particularly relates to application of a reagent for inhibiting DUSP23 expression in the preparation of an anti-liver cancer drug. Background Art

[0002] As of 2020, nearly 10 million people worldwide have been diagnosed with liver cancer, and its incidence rate ranks sixth among malignant tumors. The prognosis of liver cancer patients is extremely poor, and it is the third leading cause of malignant tumor-related deaths worldwide. Due to the relatively hidden location of the liver, and in general, the early symptoms of liver cancer only manifest as common digestive system disorders such as loss of appetite, fatigue, and nausea, it is often easily overlooked. At present, early liver cancer screening mainly relies on serum alpha-fetoprotein and abdominal ultrasound examinations, but the academic community is still controversial about the sensitivity, specificity and predictive value of AFP detection, and under normal circumstances, asymptomatic patients will not take the initiative to seek medical treatment for ultrasound examinations. In addition, liver cancer is highly malignant and has the characteristics of easy metastasis and recurrence, resulting in most patients being in the middle and late stages of liver cancer once discovered, and basically need drug treatment. However, the anti-liver cancer drugs currently on the market have poor therapeutic effects, and most systemic treatment drugs will develop drug resistance after use, resulting in extremely poor prognosis for liver cancer patients, making drug treatment for liver cancer patients a major clinical problem. Therefore, studying the role of abnormally highly expressed genes and proteins in liver cancer in the diagnosis and prognosis evaluation of liver cancer patients, as well as in the development of new anti-liver cancer drugs and improving the prognosis of liver cancer patients has important theoretical significance and application value.

[0003] DUSP23 is the smallest PTPs discovered so far. It belongs to the atypical DUSPs subfamily in the DUSPs family. It was cloned and expressed and identified by three different research teams in 2004. It is also known as VHZ or LDP-3. The DUSP23 gene is located on human chromosome 1q23, encodes 150 amino acids, and is highly conserved in evolution. As a phosphatase, DUSP23 plays a key role in a variety of physiological processes. For example, studies have found that DUSP23 plays a key role in the development of the placenta. Studies have shown that DUSP23 may regulate cell mitosis by regulating the activity of polo-like kinase 4 to control centriole replication and spindle formation. At present, research results have shown that DUSP23 expression levels are upregulated in a variety of tumor tissues including breast cancer. Overexpression of DUSP23 protein can promote breast cancer cell proliferation and migration, while knocking down DUSP23 can inhibit cell proliferation by affecting the cell cycle process of breast cancer cells, resulting in reduced DNA synthesis. However, the research on DUSP23 in liver cancer and its targets for liver cancer treatment have not been reported yet.

[0004] RNA interference is a form of post-transcriptional gene silencing in which small interfering RNA triggers the degradation of its homologous messenger RNA. Due to its specific and mandatory gene silencing characteristics, RNAi technology has been considered in recent years to be a promising new therapeutic strategy for various infectious diseases, tumors, cardiovascular and neurodegenerative diseases by manipulating the expression of disease-related genes. At present, there are many siRNA drugs on the market or in clinical research, becoming the third largest type of new drugs after chemical drugs and biological protein drugs. Compared with traditional therapies, such as small molecules and protein drugs, the use of siRNA therapy has many advantages. First, compared with conventional therapies such as small molecules and protein drugs including monoclonal antibodies, siRNA therapy only has antagonistic effects, while conventional therapies can produce both agonist and antagonist effects; second, the target of siRNA therapy can exist in any position, even undrugable targets; third, siRNA has very high selectivity, which is unattainable by small molecule drugs; finally, easy synthesis is another feature of siRNA. Therefore, siRNA designed for specific genes with significant knockdown effects has great utilization value in the development of clinical gene therapy drugs. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art and obtain RNAi drugs that can effectively treat liver cancer, the inventors used the DUSP23 gene as a target, studied the expression level of DUSP23 in liver cancer tissues, designed the siRNA sequence of the DUSP23 gene, and constructed the corresponding siRNA, specifically inhibiting the expression of the DUSP23 gene and protein in human liver cancer cells, thereby inhibiting the proliferation, migration, cell cycle progression and other processes of human liver cancer cells, suggesting that the siRNA molecule can be used to treat liver cancer. This discovery has opened up new therapeutic gene targets for liver cancer, provided a direction for new targeted therapy, and thus formed the basis of the present invention.

[0006] Therefore, the first object of the present invention is to provide a siRNA targeting DUSP23 based on RNAi technology. Another object of the present invention is to provide the use of the above siRNA targeting DUSP23 in the preparation of a drug for treating liver cancer.

[0007] In order to achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] The invention discloses an application of an agent for inhibiting DUSP23 expression in the preparation of an anti-liver cancer drug, wherein the agent for inhibiting DUSP23 expression is an siRNA having a nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4 or an siRNA having a nucleotide sequence as shown in SEQ ID NO.5-SEQID NO.6.

[0009] Preferably, the drug is a solution prepared by siRNA having a nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4;

[0010] The drug is a solution prepared from siRNA with nucleotide sequences as shown in SEQ ID NO.5-SEQ ID NO.6.

[0011] Preferably, the solvent is DEPC water or sterile water for injection.

[0012] Preferably, the anti-liver cancer drug is a drug that inhibits the proliferation ability of liver cancer cells and reduces the clone-forming ability of liver cancer cells.

[0013] Preferably, the anti-liver cancer drug is a drug that inhibits the migration ability of liver cancer cells.

[0014] Preferably, the anti-liver cancer drug is a drug that induces cell cycle arrest and apoptosis of liver cancer cells.

[0015] Preferably, the anti-liver cancer drug is a drug that affects the cell cycle progression and apoptosis-related protein expression of liver cancer cells.

[0016] Preferably, the anti-liver cancer drug is a drug that has significant tumor inhibition activity on nude mouse transplanted tumors of liver cancer cells.

[0017] A DUSP23-targeted siRNA, wherein the siRNA is an siRNA with a nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.6.

[0018] An anti-liver cancer drug contains the DUSP23-targeted siRNA.

[0019] Preferably, the anti-liver cancer drug further contains DEPC water.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention uses transcriptome sequencing technology and quantitative proteomics technology to detect the expression of DUSP23 gene and protein in liver cancer, and finds that the expression of DUSP23 gene and protein in liver cancer tissue is significantly higher than that in adjacent cancer tissue, providing a very effective target for the treatment of liver cancer, such as DUSP23 gene, which can be used for the development of targeted therapeutic drugs such as corresponding RNAi, monoclonal antibodies and small molecule antagonists.

[0022] The present invention designs siRNA that targets and inhibits the human DUSP23 gene, and the siRNA can efficiently inhibit the expression of the DUSP23 gene and protein in human liver cancer cells, thereby effectively inhibiting the proliferation and migration ability of liver cancer cells, inducing cell cycle G0 / G1 phase arrest and apoptosis of liver cancer cells, and having significant tumor inhibition activity on nude mouse transplanted tumors of liver cancer cells. The present invention provides a new gene target and drug for liver cancer treatment, and provides an effective method for developing targeted therapeutic drugs for liver cancer treatment targeting DUSP23, which is of great significance for the preparation of drugs for treating liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results of DUSP23 mRNA and protein expression levels in liver cancer and adjacent tissues are shown in Figure 1. A shows the expression of DUSP23 mRNA in liver cancer tissues and paired adjacent tissues. B shows the expression of DUSP23 protein in liver cancer tissues and paired adjacent tissues.

[0024] Figure 2 Figure 1 is a graph showing the expression of DUSP23 protein and mRNA in human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; A is a graph showing the expression of DUSP23 protein in human liver cancer cells MHCC97-H after DUSP23 siRNA transfection; B is a graph showing the expression of DUSP23 protein in human liver cancer cells HCCLM-3 after DUSP23 siRNA transfection; C is a graph showing the expression of DUSP23 mRNA in human liver cancer cells MHCC97-H after DUSP23 siRNA transfection; D is a graph showing the expression of DUSP23 mRNA in human liver cancer cells HCCLM-3 after DUSP23 siRNA transfection;

[0025] Figure 3 Figure 1 is a graph showing the proliferation curves and clone formation results of human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; A is a graph showing the proliferation curve of human liver cancer cells MHCC97-H after DUSP23 siRNA transfection; B is a graph showing the proliferation curve of human liver cancer cells HCCLM-3 after DUSP23 siRNA transfection; C is a graph showing the clone formation results of human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection;

[0026] Figure 4The results of Transwell assay and scratch assay of human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; A is the migration of human liver cancer cells MHCC97-H detected by Transwell assay after DUSP23 siRNA transfection; B is the migration of human liver cancer cells HCCLM-3 detected by Transwell assay after DUSP23 siRNA transfection; C is the migration of human liver cancer cells MHCC97-H detected by scratch assay after DUSP23 siRNA transfection; D is the migration of human liver cancer cells HCCLM-3 detected by scratch assay after DUSP23 siRNA transfection;

[0027] Figure 5 Figure 1 is a graph showing the cell cycle and cell cycle-related protein expression in human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; A is a graph showing the cell cycle distribution of human liver cancer cells MHCC97-H after DUSP23 siRNA transfection; B is a graph showing the cell cycle distribution of human liver cancer cells HCCLM-3 after DUSP23 siRNA transfection; C is a graph showing the expression of cell cycle-related proteins in human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; D is the expression of cell cycle-related proteins in MHCC97-H, and E is the expression of cell cycle-related proteins in HCCLM-3;

[0028] Figure 6 Figure 2 is a graph showing apoptosis and apoptosis-related protein expression in human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; A is a graph showing apoptosis levels in human liver cancer cells MHCC97-H after DUSP23 siRNA transfection; B is a graph showing apoptosis levels in human liver cancer cells HCCLM-3 after DUSP23 siRNA transfection; C is a graph showing apoptosis-related protein expression in human liver cancer cells MHCC97-H and HCCLM-3 after DUSP23 siRNA transfection; D is a graph showing apoptosis-related protein expression in MHCC97-H, and E is a graph showing apoptosis-related protein expression in HCCLM-3;

[0029] Figure 7 The results of the effect of DUSP23 siRNA on the growth of MHCC97-H cell xenografts in nude mice; A is a picture of subcutaneous transplanted tumors of human liver cancer cells MHCC97-H in nude mice; B is a statistical picture of the mass of subcutaneous transplanted tumors of human liver cancer cells MHCC97-H in nude mice; C is a statistical picture of the volume of subcutaneous transplanted tumors of human liver cancer cells MHCC97-H in nude mice; D is a statistical picture of the weight of nude mice with subcutaneous transplanted tumors of human liver cancer cells MHCC97-H; E is an immunofluorescence picture of the expression of DUSP23 and Ki-67 proteins in subcutaneous transplanted tumors of human liver cancer cells MHCC97-H in nude mice;

[0030] Figure 8 The results of the effect of DUSP23 siRNA on the growth of HCCLM-3 cell xenografts in nude mice; A is a picture of subcutaneous transplanted tumors of human liver cancer cells HCCLM-3 in nude mice; B is a statistical picture of the weight of subcutaneous transplanted tumors of human liver cancer cells HCCLM-3 in nude mice; C is a statistical picture of the volume of subcutaneous transplanted tumors of human liver cancer cells HCCLM-3 in nude mice; D is a statistical picture of the weight of nude mice with subcutaneous transplanted tumors of human liver cancer cells HCCLM-3; E is an immunofluorescence picture of the expression of DUSP23 and Ki-67 proteins in subcutaneous transplanted tumors of human liver cancer cells HCCLM-3 in nude mice;

[0031] Fig. 9 Figure 2 is the result of safety evaluation of DUSP23 siRNA on nude mice with MHCC97-H and HCCLM-3 cell xenograft tumors; A is the serum AST level in nude mice with subcutaneous transplanted tumors of human liver cancer cells MHCC97-H and HCCLM-3; B is the serum ALT level in nude mice with subcutaneous transplanted tumors of human liver cancer cells MHCC97-H and HCCLM-3; C is the HE staining of heart, liver, spleen, lung, kidney and brain tissues of nude mice with subcutaneous transplanted tumors of human liver cancer cells MHCC97-H and HCCLM-3. DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0033] The present invention provides a siRNA molecule, which is a double-stranded siRNA molecule consisting of a sense chain SEQ ID NO.5 and an antisense chain SEQ NO.6, which can specifically target the DUSP23 gene, block the mRNA transcription of the DUSP23 gene, thereby fundamentally inhibiting the expression of DUSP23, and ultimately achieving the purpose of treating liver cancer.

[0034] In this article, for the sake of simplicity, the names of DUSP23 protein and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different description occasions. For example, DUSP23 gene refers to the gene DNA encoding DUSP23 protein.

[0035] In this article, the terms "siRNA", "siRNA sequence", "siRNA molecule", "double-stranded siRNA", or "double-stranded siRNA molecule" are interchangeable and have the same meaning and scope. Among them, siRNA is a double-stranded structure formed by annealing of the sense strand and the antisense strand.

[0036] There are many methods for preparing siRNA molecules, such as chemical synthesis, in vitro transcription, enzyme cleavage of long-chain dsRNA, vector expression of RNA, PCR synthesis of RNA expression elements, etc. The emergence of these methods provides researchers with options to achieve higher gene silencing efficiency.

[0037] The dosage form of the drug of the present invention can be in various forms, as long as it is suitable for the administration of the corresponding disease and properly maintains the activity of the RNA molecule. For example, for an injection administration system, the dosage form can be a lyophilized powder. The drug can also be a liquid oral agent.

[0038] Optionally, the above-mentioned pharmaceutical dosage form may contain any pharmaceutically acceptable carrier and adjuvant, as long as they are suitable for the corresponding drug delivery system and properly maintain the activity of the RNA molecule or viral expression vector.

[0039] Figures 1 to 9 The present invention shows an embodiment of siRNA for targeted inhibition of DUSP23 gene and protein expression and its application. By studying the expression level of DUSP23 in human liver cancer tissue, designing the siRNA sequence of human DUSP23 gene and transfecting human liver cancer cells, the expression of DUSP23 gene and protein in human liver cancer cells is specifically inhibited, thereby inhibiting the proliferation and migration of human liver cancer cells, inducing G0 / G1 phase arrest and apoptosis of liver cancer cells, and having significant tumor inhibitory activity on nude mouse transplanted tumors of liver cancer cells, thereby playing a role in treating liver cancer.

[0040] The Chinese, English and abbreviations of the names involved in the present invention are shown in Table 1.

[0041] Table 1 Chinese-English and abbreviation comparison table

[0042] Chinese English abbreviation Serum alpha-fetoprotein Alphafetoprotein AFP / VH1-likephosphatasesmemberZ VZ / low-molecular-massdual-specificityphosphatase-3 LDP-3 Polo-like kinase 4 Polo-likekinase4 PLK4 RNA interference RNAinterference RNAi Small interfering RNA smallinterferenceRNA siRNA Messenger RNA messengerRNA mRNA

[0043] Example 1: Expression of DUSP23 gene and protein in liver cancer patient tissues obtained by transcriptome sequencing and quantitative proteomics

[0044] The nucleotide sequence of DUSP23 is: agaccacgtggcccgggaggcgccgaggccaggtaggtggtgagt tacttggctcggagcgggcgaggggacgcgtgggcggagcggggctggccagcctcggcccccatgacccgctgtcctgtgccctttcccagcgatgggcgtgcagccccccaacttctcctgggtgcttccgggccggctggcgggactggcgctgccgcggctccccgcccactaccagttcctgttggacctgggcgtgcggcacctggtgtccctgacggagcgcgggccccctcacagcgacagctgccccggcctcaccctgcaccgcctgcgcatccccgacttctgcccgccggcccccgaccagatcgaccgcttcgtgcagatcgtggacgaggccaacgcacggggagaggctgtgggagtgcactgtgctctgggctttggccgcactggcaccatgctggcctgttacctggtgaaggagcggggcttggctgcaggagatgccattgctgaaatccgacgactacgacccggctccatcgagacctatgagcaggagaaagcagtcttccagttctaccagcgaacgaaataa ggggccttagtacccttctaccaggccctcactccccttccccatgttgtcgatggggccagagatgaagggaagtggactaaagtattaaaccctctagctcccattggctgaagacactgaagtagcccacccctgcaggcaggtcctgattgaaggggaggcttgtactgctttgttgaataaatgagttttacgaaccagg, denoted as SEQ ID NO.13.

[0045] The liver cancer and adjacent tissue specimens of 4 male liver cancer patients were from patients who required surgical resection for liver cancer in the Department of General Surgery of Tangdu Hospital. The postoperative pathological diagnosis was hepatocellular carcinoma. All patients were diagnosed for the first time and had not received any treatment before the operation. The liver tissue that was ≥3 cm away from the resection margin of the lesion and had no cancerous changes at the resection margin was defined as adjacent tissue. The collected samples were agreed by the patients and their families and approved by the hospital ethics committee. The transcriptome sequencing and quantitative proteomic analysis of liver cancer tissue and adjacent tissue were performed by Shanghai Baiqu Biomedical Technology Co., Ltd. Figure 1 As shown in the figure, analysis of transcriptome sequencing and quantitative proteomics results revealed that the levels of DUSP23 gene and protein in liver cancer tissues were significantly higher than those in adjacent cancer tissues.

[0046] Example 2: Design and synthesis of DUSP23 siRNA

[0047] Three siRNA sequences and one negative control siRNA sequence were designed for the DUSP23 gene and synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0048] The base sequence of DUSP23 siRNA-1 is as follows:

[0049] Sense sequence: 5'-GGAGAUGCCAUUGCUGAAA-3', recorded as SEQ ID NO.1;

[0050] Antisense sequence: 5'-UUUCAGCAAUGGCAUCUCC-3', recorded as SEQ ID NO. 2;

[0051] The base sequence of DUSP23 siRNA-2 is as follows:

[0052] Sense sequence: 5'-CAGUCUUCCAGUUCUACCA-3', recorded as SEQ ID NO. 3;

[0053] Antisense sequence: 5'-UGGUAGAACUGGAAGACUG-3', recorded as SEQ ID NO. 4;

[0054] The base sequence of DUSP23 siRNA-3 is as follows,

[0055] Sense sequence: 5'-CUACCAGCGAACGAAAUAA-3', recorded as SEQ ID NO.5;

[0056] Antisense sequence: 5'-UUAUUUCGUUCGCUGGUAG-3', recorded as SEQ ID NO.6;

[0057] The base sequence of negative control siRNA, referred to as NC, is as follows:

[0058] Sense sequence: 5'-UUCUCCGAACGUGUCACGU-3', recorded as SEQ ID NO.7;

[0059] Antisense sequence: 5'-ACGUGACACGUUCGGAGAA-3', recorded as SEQ ID NO.8;

[0060] It should be noted that SEQ ID NO.1-SEQ ID NO.8 were all connected with TT at the 3' end as a protective structure when used.

[0061] Example 3: Cell culture and transfection of DUSP23 siRNA

[0062] 1. Cell culture: Human hepatoma cell lines HCCLM-3 and MHCC97-H were cultured in high-glucose DMEM complete medium, and human normal liver cell line L02 was cultured in RPMI 1640 complete medium. High-glucose DMEM complete medium contains 10% fetal bovine serum and 1% penicillin / streptomycin, and RPMI 1640 complete medium contains 10% fetal bovine serum and 1% penicillin / streptomycin. The temperature of the incubator was kept constant at 37°C, and the CO2 concentration was kept constant at 5%.

[0063] 2. Cell transfection: Wash the cells three times with PBS, digest with warm trypsin for 1-2 minutes, terminate digestion with complete medium after complete digestion, centrifuge at 1000rpm for 10 minutes, discard the supernatant and add 2mL of medium without antibiotics, gently blow the cells with a 3mL Pasteur pipette to make a cell suspension, count the cells and inoculate them in different well plates. Here, a 6-well plate is used as an example, with about 1×10 cells per well. 5 Cells were placed in a constant temperature incubator for culture. When the cell density reached 40%-50%, transfection was performed according to the following steps:

[0064] (1) Dilute different siRNAs with DEPC water to 20 μM solution for later use;

[0065] (2) taking an appropriate amount of the solution in step (1) so that the mass of siRNA is 2 μg, and mixing the obtained siRNA solution with 100 μL of Opti-MEM medium;

[0066] (3) Mix 10 μL X-tremeGENE siRNA Transfection reagent with 100 μL Opti-MEM medium;

[0067] (4) adding the mixed culture medium of step (3) dropwise into the mixed culture medium of step (2), incubating at room temperature for 20 min, to obtain a liposome transfection complex;

[0068] (5) Discard the original cell culture medium, wash with PBS three times, add 2 mL of dual antibody-free culture medium and the above-mentioned liposome transfection complex to each well, shake gently and place in an incubator for culture for the specified time before subsequent experiments.

[0069] Example 4: Detection of gene silencing efficiency using Western Blotting

[0070] The cancer cells used in the experiment included human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3. Cells were collected 72 hours after transfection with siRNA according to the method in Example 3, and Western Blotting experiments were performed according to the following method:

[0071] 1. Protein extraction

[0072] Cell preparation: scrape the cells with a cell scraper, transfer the cells with culture medium to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 10 min to collect the cell precipitate, wash and resuspend the cells twice with PBS; add an appropriate amount of RIPA cell lysis buffer, and transfer to a 1.5 mL EP tube. The RIPA cell lysis buffer used in the present invention contains protease inhibitors and phosphatase inhibitors.

[0073] Cell disruption: Use a cell ultrasonic disruptor at 15% power to disrupt cells on ice for 3 seconds, cool for 3 seconds, and repeat 3 times; after lysis, let stand on ice for 30 minutes, then centrifuge at 4°C, 12,000 rpm for 20 minutes; carefully pipette the supernatant into a clean, pre-cooled new EP tube.

[0074] 2. Protein quantification, i.e. BCA method

[0075] Preparation of standard curve: Use RIPA cell lysis buffer to prepare 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, and 0 mg / mL BSA standard solutions.

[0076] Prepare the color developing solution: Use the Thermo Fisher BCA quantitative kit and prepare the color developing solution at a ratio of A:B = 50:1.

[0077] Sample addition: Add 10 μL of sample and 10 μL of standard of different concentrations to each well of a 96-well plate, immediately add 200 μL of AB colorimetric solution, and incubate at 37°C for 30 min.

[0078] Concentration determination: The protein concentration was measured at a wavelength of 562 nm using an ELISA reader. According to the measured absorbance value of the standard, RIPA cell lysis buffer and 5× loading buffer were added to adjust the cell concentration to be consistent.

[0079] Protein denaturation: Heat in a metal bath for 10 minutes to fully denature the protein.

[0080] 3. Glue preparation: According to the different molecular weights of proteins, 6%-15% lower separation gel and 5% upper condensation gel are required.

[0081] (1) Install the glass plate: The glass plate should be cleaned in advance and dried in the oven. When installing, make sure the lower end is aligned on a flat surface, otherwise the glue will leak. Fix the glass plate on the bracket and clamp it for later use.

[0082] (2) Prepare the lower separation gel: Prepare the required gel according to the recipe, quickly pour the mixed gel into the glass plate, add 2 mL of water, flatten the separation gel, and let it stand for 40 min.

[0083] (3) Prepare the upper layer of condensation glue: After the lower layer of glue solidifies, pour out the water, drain the liquid, gently absorb the remaining liquid with filter paper, pour the upper layer of glue, insert a comb between the two glass plates, and let it stand for 30 minutes.

[0084] 4. Protein loading: Take the protein sample out from -20℃ and immediately place it on ice. Determine the loading volume according to the protein concentration, so that the loading amount is generally 20μg.

[0085] 5. Electrophoresis: When running the upper gel, keep the voltage constant at 80V and run the electrophoresis for 30 minutes. When running the lower gel, keep the voltage constant at 120V and run the electrophoresis for 60-80 minutes to fully separate the marker bands corresponding to the target bands.

[0086] 6. Transfer: Place the PVDF membrane in methanol to activate for 30 seconds, cut off the upper layer of glue, install the transfer device, blackboard (-) → porous padding sponge → second layer of filter paper → gel → PVDF membrane → second layer of filter paper → porous padding sponge → white board (+), carefully remove the bubbles between each layer, install the transfer device into the transfer tank, add transfer liquid, put an ice box in the empty space in the transfer tank, cover the lid, put the transfer tank into the foam box, fill it with ice and water mixture, turn on the power, constant voltage 100V, transfer for 1h-2h.

[0087] 7. Blocking: Prepare 5% blocking solution with TBST and skimmed milk powder and block for 1.5 hours.

[0088] 8. Primary antibody incubation: remove the PVDF membrane, wash the blocking solution thoroughly with TBST, and then add the diluted target protein antibody. The primary antibody is DUSP23, produced by Novus Biologicals, and the dilution ratio is 1:2000; the internal reference antibody is GAPDH, produced by Bioworld, and the dilution ratio is 1:5000; incubate at 4°C overnight; remove the PVDF membrane and wash it 3 times with room temperature TBST on a shaker, each time for 10 minutes.

[0089] 9. Secondary antibody incubation: Place the PVDF membrane in an antibody incubation box, add the secondary antibody corresponding to the target protein antibody, the secondary antibody is Anti-Mouse IgG, the manufacturer is Zhuangzhi Bio, the dilution ratio is 1:5000, and incubate on a shaker at room temperature for 1.5 hours; take out the PVDF membrane and wash it 3 times with room temperature TBST on a shaker, each time for 10 minutes.

[0090] 10. Gel imaging luminescence: prepare luminescence solution, A:B=1:1, mix well, and protect from light. Use filter paper to remove residual night, soak the PVDF membrane in a black box, and fully contact it for imaging.

[0091] The results of protein expression were as follows Figure 2 As shown in A and B in the figure, it can be seen that in human liver cancer MHCC97-H cells, compared with the NC group, the expression of DUSP23 protein in the experimental group cells transfected with DUSP23 siRNA-1, DUSP23 siRNA-2 and DUSP23siRNA-3 was reduced; in human liver cancer HCCLM-3 cells, compared with the NC group, the expression of DUSP23 protein in the experimental group cells transfected with DUSP23 siRNA-2 and DUSP23 siRNA-3 was reduced. It can be clearly seen from the relative expression of the protein that in human liver cancer MHCC97-H cells and HCCLM-3 cells, the experimental group transfected with DUSP23 siRNA-3 had the greatest interference with DUSP23 protein expression and the best effect. Therefore, siRNA-3 that interferes with DUSP23 gene expression can be used in interfering with DUSP23 gene expression, and is used in subsequent embodiments. The siRNA-3 that interferes with DUSP23 gene expression is referred to as DUSP23siRNA below.

[0092] Example 5: Detection of gene silencing efficiency using real-time fluorescence quantitative RT-PCR

[0093] The primers used for real-time quantitative RT-PCR to verify whether the DUSP23 gene was silenced were:

[0094] Upstream primer: 5'-ATGGGCGTGCAGCCCCCCAAC-3', recorded as SEQ ID NO.9;

[0095] Downstream primer: 5'-TTATTTCGTTCGCTGGTAGAACTGG-3', recorded as SEQ ID NO.10.

[0096] The internal reference for real-time quantitative RT-PCR to verify whether the DUSP23 gene was silenced was the housekeeping gene GAPDH. The primers for the internal reference gene GAPDH were:

[0097] Upstream primer: 5'-AGAAGGCTGGGGCTCATTTG-3', recorded as SEQ ID NO.11;

[0098] Downstream primer: 5'-GAGGGGCCATCCACAGTCTTC-3', recorded as SEQ ID NO.12.

[0099] The cancer cells used in the experiment included human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3. After transfection with DUSP23 siRNA according to the method in Example 3 for 48 hours, real-time fluorescence quantitative RT-PCR was performed according to the following method:

[0100] (1) Add 1 mL of Trizol to each well and let it stand for 5 min. Pipette the cells and collect them in an EP tube. Invert the tube 10 times and let it stand for 5 min.

[0101] (2) Add 200 μL of chloroform, invert 10 times, and let stand for 10 min.

[0102] (3) Centrifuge at 4°C, 12,000 rpm for 20 min. Take 500 μL of the upper aqueous phase and place it in a new EP tube. Add 500 μL of isopropanol, invert the tube 10 times, and let it stand for 10 min.

[0103] (4) Centrifuge at 4°C, 12,000 rpm for 20 min, discard the supernatant, add 1 mL of pre-cooled 75% ethanol, and wash the precipitate.

[0104] (5) Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant, invert the EP tube, and allow to dry naturally for 5 min.

[0105] (6) Add 30 μL of DEPC water and blow evenly to dissolve the precipitate.

[0106] (7) Use a spectrophotometer to measure the concentration of the RNA sample and select 1 μg for quantification.

[0107] (8) Take out the corresponding volume of RNA sample and place it in a sterile EP tube, incubate at 72°C for 10 min, and place it on ice for 5 min.

[0108] (9) Establish a cDNA reverse transcription reaction system according to Table 2 below:

[0109] Table 2 cDNA reverse transcription reaction system

[0110] Reactants dose <![CDATA[Anchored-oligo(dT) 18 First]]> 1μL TranscriptorRTReactionBuffer(5×) 4μL ProtectorRNaseInhibitor 0.5μL Deoxynuc-leotideMix 2μL TranscriptorReverseTranscriptase 0.5μL RNAsample 1 μg Nuclease-FreeWater Make up to 20 μL

[0111] (10) After the system is established, the system is centrifuged and placed in a PCR instrument, and the reaction program is set to 55°C, 30 min, and 85°C, 5 min.

[0112] (11) Establish a PCR reaction system according to Table 3 below:

[0113] Table 3 PCR reaction system

[0114] Reactants dose 2×SYBR Green Master Mix 10μL 100 μM Primer F 0.1μL 100 μM PrimerR 0.1μL cDNA (50-100ng) 2μL Nuclease-FreeWater 7.8μL

[0115] (12) After the system was established, centrifuge and place in a PCR instrument and set the reaction program as 95°C, 8 min → 95°C, 10 s → 58°C, 14 s → 72°C, 20 s plate reading, 45 cycles → insert melting curve. After completion, analyze the data and calculate 2 -▲▲ct .

[0116] The results of mRNA expression were as follows Figure 2 As shown in Figures C and D, in human liver cancer MHCC97-H cells and HCCLM-3 cells, the expression level of DUSP23 mRNA in the experimental group transfected with DUSP23 siRNA was significantly reduced compared with that in the NC group.

[0117] Example 6: Detection of the proliferation ability of human liver cancer cells transfected with DUSP23 siRNA

[0118] The cancer cells used in the experiment included human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3. After transfection of DUSP23 siRNA at 0h, 24h, 48h, 72h and 96h according to the method in Example 3, the original culture medium was discarded, 90 μL of culture medium and 10 μL of CCK-8 were added to each well, and the cells were placed in an incubator and incubated for 40 min. The OD value was detected at 450nm using a microplate reader.

[0119] The results of CCK-8 assay are as follows Figure 3 As shown in A and B, the results showed that compared with the NC group, transfection of DUSP23 siRNA could significantly inhibit the proliferation of human liver cancer MHCC97-H cells and HCCLM-3 cells.

[0120] Example 7: Detection of the cloning ability of human liver cancer cells transfected with DUSP23 siRNA

[0121] The cancer cells used in the experiment included human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3. After 14 days of transfection with DUSP23 siRNA according to the method in Example 3, the original culture medium was discarded, and the culture medium containing DUSP23 siRNA was replaced every 72 hours during the 14 days. The cells were washed three times with PBS, 1 mL of 4% paraformaldehyde was added to each well, and fixed for 30 min-60 min; washed three times with PBS, 1 mL of crystal violet stain was added to each well, and the cells were stained for 10 min-20 min; washed three times with PBS, dried, and the entire six-well plate and each well were photographed separately with a digital camera.

[0122] The results of the cell plate clone formation experiment are as follows Figure 3 As shown in C, the results showed that compared with the NC group, the number of clones formed in the human liver cancer MHCC97-H cells and HCCLM-3 cells transfected with DUSP23 siRNA was significantly reduced, indicating that knocking down DUSP23 expression can inhibit the clone formation ability of the two liver cancer cell lines.

[0123] Example 8: Detection of the migration ability of human liver cancer cells transfected with DUSP23 siRNA

[0124] The cancer cells used in the experiment include human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3.

[0125] 1. Transwell experiment: DUSP23 siRNA was transfected according to the method in Example 3. After 24 h, the cells were digested and centrifuged, and the cells were resuspended in serum-free medium to adjust the cell density to 2×10 5 cells / well, inoculated in a Transwell chamber, in a 24-well plate, add 500 μL of culture medium containing 20% ​​FBS to the lower chamber of the chamber, carefully put in the upper chamber to avoid bubbles, and culture in an incubator; after 24 hours, take out the chamber, discard the culture medium in the upper chamber, and carefully wipe the cells inside the chamber twice with a wet cotton swab; soak the chamber in 4% paraformaldehyde for cell fixation for 20 minutes, wash with PBS, and stain with 1% crystal violet at room temperature for 20 minutes; after washing with PBS, cut off the chamber membrane, put it on a slide, observe under a microscope, collect images, and count statistics.

[0126] The results are as follows Figure 4 As shown in A and B, compared with the NC group, the number of transmembrane cells in human liver cancer cell lines MHCC97-H and HCCLM-3 transfected with DUSP23 siRNA was significantly reduced, indicating that knocking down DUSP23 expression can inhibit the cell migration ability of the two liver cancer cell lines.

[0127] 2. Cell scratch experiment: The cells were seeded in a 6-well plate and transfected with DUSP23 siRNA according to the method in Example 3. After 24 hours, a sterile pipette tip was used to vertically and quickly scratch the cell surface at a random position in the well, and clear scratches were observed; the culture medium was discarded, the cell surface was gently rinsed 3 times with PBS, 2 mL of serum-free culture medium was gently added along the well wall, and the wells were placed in an incubator; the scratch area of ​​each group of cells was observed and photographed using a live cell workstation at 0 h and 24 h after scratching, and the area of ​​the scratch area was calculated.

[0128] The results are as follows Figure 4 As shown in Figures C and D, compared with the NC group, the scratch healing area of ​​human liver cancer cell MHCC97-H and HCCLM-3 cells transfected with DUSP23 siRNA was significantly reduced, indicating that knocking down DUSP23 expression can inhibit the migration ability of the two liver cancer cell lines.

[0129] Example 9: Detection of the cell cycle and expression of cell cycle-related proteins in human liver cancer cells transfected with DUSP23 siRNA

[0130] The cancer cells used in the experiment include human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3.

[0131] 1. Flow cytometry for cell cycle detection: cells were inoculated in 6-well plates and transfected with DUSP23 siRNA according to the method in Example 3. After 48 hours, the cell supernatant was collected, and the cells were digested with trypsin and collected in a 1.5 mL EP tube. Centrifuge at 4°C, 1000 rpm for 10 min, discard the supernatant, and wash the cells twice with PBS; add 1 mL of pre-cooled 70% ethanol to each tube, blow the cells apart, and fix at 4°C for 24 h; centrifuge at 1000 rpm for 5 min, discard the supernatant; add 1 mL of pre-cooled PBS to wash the cells twice, and discard the supernatant; add 500 μL of propidium iodide staining solution to each tube to resuspend the cells, and incubate at 37°C in the dark for 30 min; use a flow cytometer to detect fluorescence and light scattering at a wavelength of 488 nm.

[0132] The experimental results are as follows Figure 5As shown in A and B in the figure, in MHCC97-H cells, the proportion of G0 / G1 phase cells in the NC group was 34.62±2.14%, while the proportion of G0 / G1 phase cells in the DUSP23 siRNA group was 56.87±0.86%, which was significantly higher than that in the NC group, P=0.000075; the proportion of S phase cells in the NC group was 33.81±0.63%, while the proportion of S phase cells in the DUSP23 siRNA group was 24.32±1.43%, which was significantly lower than that in the NC group, P=0.000464; the proportion of G2 / M phase cells in the NC group was 30.11±2.79%, while the proportion of G2 / M phase cells in the DUSP23 siRNA group was 18.77±1.55%, which was significantly lower than that in the NC group, P=0.003542. In HCCLM-3 cells, the proportion of G0 / G1 cells in the NC group was 31.36±3.60%, while the proportion of G0 / G1 cells in the DUSP23 siRNA group was 41.29±0.96%, which was significantly higher than that in the NC group, P=0.009918; the proportion of S cells in the NC group was 41.02±3.09%, while the proportion of S cells in the DUSP23 siRNA group was 37.85±4.34%, which was not significantly different from that in the NC group, P=0.360637; the proportion of G2 / M cells in the NC group was 24.76±0.79%, while the proportion of G2 / M cells in the DUSP23 siRNA group was 18.50±3.28%, which was significantly lower than that in the NC group, P=0.032510. The above results indicate that DUSP23 siRNA can block the cell cycle process, preventing MHCC97-H and HCCLM-3 cells from transitioning from the G0 / G1 phase to the S phase, thereby inhibiting the proliferation of liver cancer cells.

[0133] 2. Western Blotting experiment to detect cell cycle related proteins: cells were inoculated on 60 mm 2In a culture dish, DUSP23 siRNA was transfected according to the method in Example 3, and 48 hours later, a Western Blotting experiment was performed according to the method in Example 4. Primary antibodies: cyclin D1, manufactured by CST, with a dilution ratio of 1:1000; cyclin E1, manufactured by CST, with a dilution ratio of 1:1000; CDK 2, manufactured by CST, with a dilution ratio of 1:1000; CDK4, manufactured by CST, with a dilution ratio of 1:1000; P21, manufactured by CST, with a dilution ratio of 1:1000; P27, manufactured by CST, with a dilution ratio of 1:1000; c-Myc, manufactured by CST, with a dilution ratio of 1:1000; β-actin, manufactured by Proteintech, with a dilution ratio of 1:5000. Secondary antibody: Anti-Mouse IgG, manufactured by Zhuangzhi Bio, dilution ratio of 1:5000; Anti-Rabbit IgG, manufactured by Zhuangzhi Bio, dilution ratio of 1:5000.

[0134] The experimental results are as follows Figure 5 As shown in Figure C, compared with the NC group, the expression of cyclin D1 protein, cyclin E1 protein, CDK2 protein, CDK4 protein, P21 protein and c-Myc protein in human liver cancer cells MHCC97-H and HCCLM-3 transfected with DUSP23 siRNA was significantly reduced, and the expression of P27 protein was significantly increased. These results indicate that DUSP23 siRNA can inhibit the proliferation of liver cancer cells by affecting the expression of G1 / S cell cycle checkpoint-related proteins in MHCC97-H and HCCLM-3 cells and blocking the cell cycle process.

[0135] Example 10: Detection of apoptosis level and expression of apoptosis-related proteins in human liver cancer cells transfected with DUSP23 siRNA

[0136] The cancer cells used in the experiment include human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3.

[0137] 1. Flow cytometry to detect apoptosis levels: cells were inoculated in a 6-well plate and transfected with DUSP23 siRNA according to the method in Example 3. After 48 hours, the cell supernatant was aspirated and collected in a centrifuge tube; the cells were washed three times with PBS, digested with trypsin, and collected in an EP tube containing the supernatant; centrifuged at 4°C, 1000 rpm for 10 min, the supernatant was aspirated and discarded, 500 μL binding buffer was added, and the cells were gently blown to prepare a cell suspension, and the cell count was adjusted to 5×10 5 / mL; aspirate 195μL of cell resuspension and transfer to a 1.5mL EP tube; add 5μL AnnexinV-FITC dye to each group, mix well and then add 10μL PI dye; protect from light, let stand for 15min, and detect on the machine.

[0138] The experimental results are as follows Figure 6 As shown in A and B in Figure 2, in MHCC97-H cells, the apoptotic rate of cells in the NC group was 10.40±2.23%, while the apoptotic rate of cells in the DUSP23 siRNA group was 57.60±0.74%, which was significantly higher than that in the NC group. In HCCLM-3 cells, the apoptotic rate of cells in the NC group was 16.02±1.07%, while the apoptotic rate of cells in the DUSP23 siRNA group was 33.18±1.13%, which was also significantly higher than that in the NC group. The above results indicate that DUSP23 siRNA can induce apoptosis in MHCC97-H cells and HCCLM-3 cells.

[0139] 2. Western Blotting experiment to detect apoptosis-related proteins: cells were inoculated on 60 mm 2 In a culture dish, DUSP23 siRNA was transfected according to the method in Example 3. After 48 hours, Western Blotting experiments were performed according to the method in Example 4. Primary antibody: Caspase-3, manufactured by CST, dilution ratio of 1:1000; Cleaved Caspase-3, manufactured by CST, dilution ratio of 1:1000; γ-H2AX, manufactured by Abcam, dilution ratio of 1:1000; β-actin, manufactured by Proteintech, dilution ratio of 1:5000. Secondary antibody: Anti-Mouse IgG, manufactured by Zhuangzhi Bio, dilution ratio of 1:5000; Anti-Rabbit IgG, manufactured by Zhuangzhi Bio, dilution ratio of 1:5000.

[0140] The experimental results are as follows Figure 6 As shown in Figure C, compared with the NC group, the expression levels of cleaved-Caspase-3 protein and γ-H2AX protein in human liver cancer cells MHCC97-H and HCCLM-3 transfected with DUSP23 siRNA were significantly upregulated. The above results indicate that DUSP23 siRNA can induce apoptosis of MHCC97-H and HCCLM-3 cells.

[0141] Example 11: Investigating the tumor-suppressing ability of DUSP23 siRNA in nude mice

[0142] The cancer cells in the experiment included human liver cancer cells MHCC97-H and human liver cancer cells HCCLM-3. The experimental animals were 40 5-6 week old male BALB / c nude mice, and the experimental days were 30 days. The content of the investigation was the ability of DUSP23 siRNA to inhibit the growth of human liver cancer cells MHCC97-H and HCCLM-3 transplanted tumors in nude mice and the toxicity to nude mice.

[0143] 1. Nude mouse subcutaneous tumor experiment: When the cell healing degree reaches 80%-90%, collect the cells, wash the cells three times with pre-cooled PBS, remove the residual serum in the cells, digest with warm trypsin for 1-2 minutes, terminate the digestion with complete medium after complete digestion, centrifuge at 1000rpm for 10 minutes, discard the supernatant, and wash with PBS three times. Count the cells, resuspend the cells with serum-free medium, and the concentration of the cell suspension is 1×10 8 Cells / mL. Use a 1mL syringe to extract cells, insert the needle about 2cm under the skin, slide the needle left and right under the skin several times to allow the cells to be inoculated into a cluster and reduce the overflow of the cell suspension from the needle eye after injection. Inject 100μL of cell suspension into the left armpit of each nude mouse. Seven days after the injection of the cell suspension, use a vernier caliper to measure the longest and shortest parts of the tumor. According to the formula V = 1 / 2×a×b 2 , a is the long axis, b is the short axis, calculate the tumor volume, remove the nude mice without tumors, and divide the nude mice into two groups according to the tumor size, the negative control siRNA group and the DUSP23 siRNA group, 9 in each group, and start the treatment with the negative control siRNA or DUSP23 siRNA carried by the intratumoral transfection reagent, once every 3 days, 10ug siRNA is transfected once with 1.2uL transfection reagent, and the weight and tumor volume of the nude mice are measured at the same time. On the second day after the last administration, blood was collected from the orbit, and the nude mice were killed by cervical dislocation, the tumor tissue was peeled off and weighed, and the heart, liver, spleen, lung, kidney and brain were separated and fixed with 4% paraformaldehyde for later use.

[0144] The experimental results are as follows Figure 7 AD and Figure 8As shown in Figures AD, in the nude mice xenografts of MHCC97-H and HCCLM-3 cells, the volume of subcutaneous xenografts in the nude mice treated with DUSP23 siRNA was significantly smaller than that in the nude mice in the NC group. The results of weighing the tumor weight after the nude mice were sacrificed also showed that the tumor weights of the nude mice xenografts of MHCC97-H and HCCLM-3 cells in the DUSP23 siRNA group were 0.78±0.21g and 0.56±0.16g, respectively, and the weights of the nude mice xenografts of MHCC97-H and HCCLM-3 cells in the NC group were 1.25±0.48g and 0.93±0.40g, respectively, and the tumor weights of the nude mice in the DUSP23 siRNA group were significantly lower than those in the NC group. There were no deaths in all nude mice with MHCC97-H and HCCLM-3 cell xenografts during the entire study, and there was no significant difference in the weights of nude mice in the DUSP23 siRNA group and the NC group. The above results indicate that DUSP23 siRNA can inhibit the growth of MHCC97-H and HCCLM-3 cell xenograft tumors in nude mice in vivo.

[0145] 2. Immunofluorescence staining: dewax and rehydrate the paraffin sections, perform antigen repair, and block with goat serum at room temperature for 1 hour after cooling; place the sections face up on the slide, add 100 μL of primary antibodies diluted with goat serum to each section: Ki-67, manufactured by CST, with a dilution ratio of 1:100; DUSP23, manufactured by Novus Biologicals, with a dilution ratio of 1:100, put into a wet box, and incubate at 4°C overnight; place the sections in a wash box and wash three times with PBS, 5 min / time; add 100 μL of diluted fluorescent secondary antibodies in a dark place: Anti-Mouse FITC, manufactured by Zhuangzhi Bio, with a dilution ratio of 1:100; Anti-RabbitCY3, manufactured by Zhuangzhi Bio, dilution ratio is 1:100, incubate at room temperature for 1 hour; place the slices in a washing box, protect from light, wash three times with PBS, 5 minutes each time; place the slices in a wet box, add DAPI staining solution in the dark, and incubate at room temperature for 15 minutes; place the slices in a washing box, protect from light, wash three times with PBS, 5 minutes each time; seal the slices with anti-fluorescence quenching sealing agent, and observe and take pictures under a fluorescence microscope.

[0146] The experimental results are as follows Figure 7 E and Figure 8 As shown in Figure E, in nude mice xenografts of MHCC97-H and HCCLM-3 cells, the expression levels of DUSP23 protein and proliferation marker Ki-67 in tumor tissues of nude mice in the DUSP23 siRNA group were significantly lower than those in the NC group, indicating that DUSP23 siRNA can inhibit the proliferation of human liver cancer cells MHCC97-H and HCCLM-3 in vivo.

[0147] 3. AST / GOT detection: Centrifuge the serum at 3500rpm, 25℃ for 15min, carefully pipette an appropriate amount of supernatant into a new EP tube, and follow the steps in the table below.

[0148]

[0149]

[0150] The experimental results are as follows Fig. 9 As shown in A, in nude mice with MHCC97-H and HCCLM-3 cell xenograft tumors, there was no significant change in the serum AST level of nude mice in the DUSP23 siRNA treatment group compared with the nude mice in the NC group, indicating that DUSP23 siRNA has good safety in nude mice.

[0151] 4. Alanine transaminase (ALT) / GPT test: Centrifuge the serum at 3500 rpm, 25°C for 15 min. Carefully pipette an appropriate amount of supernatant into a new EP tube and follow the steps in the table below.

[0152]

[0153] The experimental results are as follows Fig. 9 As shown in Figure B, in nude mice bearing MHCC97-H and HCCLM-3 cell xenograft tumors, there was no significant change in the serum ALT level in the DUSP23 siRNA-treated nude mice compared with the NC group, indicating that DUSP23 siRNA has good safety in nude mice.

[0154] 5. HE staining: After the tissue is fixed, rinse it with running water for 2 hours, then dehydrate it with 70%, 80%, and 90% ethanol solutions for 30 minutes each, and then put it in 95% and 100% ethanol solutions twice, each for 20 minutes; sequentially use pure ethanol and xylene mixed solution for 15 minutes, xylene I for 15 minutes, and xylene II for 15 minutes, until it is transparent; put xylene and paraffin mixed solution of half and half for 15 minutes in a 60℃ constant temperature box, then put paraffin I and paraffin II for 50-60 minutes each; use tweezers to hold the metal paraffin mold and heat it slightly on the alcohol lamp, put it on a flat table, take out the wax cup containing pure paraffin from the incubator, pour a little paraffin, and then heat the tweezers slightly on the alcohol lamp, hold it, and then put it on the table. Take the material and put it into the wax mold with the cut surface facing down, arrange it neatly, then put on the embedding box, and gently pour in the molten wax for embedding; install the fixed and trimmed paraffin block on the clamping table of the slicer, fix the slicer on the knife clamp, with the blade facing up; shake and push the spiral to make the paraffin block close to the blade; adjust the angle and position between the paraffin block and the blade, so that the blade and the paraffin slice are about 15 degrees; adjust the thickness regulator to make the slice thickness 5μm; lay the wax tape cut into 20-30cm long flat on the wax tape box, cut a small section of the wax slice with a single-sided blade, put it on the slide, add a drop of water, and observe the slice under a microscope; take a clean slide, pick up the unfolded slice, so that it is located at 1 / 3 of the slice, mark or label it on the grinded surface, and put it on the slice rack. Adjust the temperature of the water bath to 60℃. When the water temperature is controlled at 60℃, put the slices and the slice rack into a dry staining jar, put them into the water bath, cover them with a lid, and wait for 30 minutes until the wax melts; sequentially put the slices into xylene for 10 minutes → xylene for 10 minutes → anhydrous ethanol for 5 minutes → anhydrous ethanol for 5 minutes → 95% alcohol for 5 minutes → 90% alcohol for 5 minutes → 80% alcohol for 5 minutes → 70% alcohol for 5 minutes → distilled water for washing; put the slices into Harris hematoxylin for 5 minutes, wash with tap water, differentiate with 1% hydrochloric acid alcohol for a few seconds, rinse with tap water, blue with 0.6% ammonia water, and rinse with running water; use tap water to stain the slices. Rinse with running water for about 15 minutes to turn the slices blue; put the slices into 1% hydrochloric acid ethanol solution to fade for about 2 seconds to tens of seconds until the slices turn red and the color is lighter; put the slices into running tap water to restore the blue color; put the slices into 50% ethanol → 70% ethanol → 80% ethanol for 3-5 minutes each; put the slices into eosin stain for 1-3 minutes; put the slices into 95% ethanol to wash away the excess red, and then put them into anhydrous ethanol for 3-5 minutes, and finally use absorbent paper to absorb the excess ethanol; put the slices into xylene I and II for 3 minutes each; seal with neutral gum, examine under a microscope, and collect and analyze images.

[0155] The experimental results are as follows Fig. 9As shown in Figure C, in nude mice with MHCC97-H and HCCLM-3 cell xenograft tumors, compared with nude mice in the NC group, DUSP23 siRNA treatment did not cause damage to important tissues and organs such as the heart, liver, spleen, lung, kidney, and brain of nude mice. These results indicate that DUSP23 siRNA has good safety in nude mice.

[0156] Based on the above experiments, it can be seen that the DUSP23 siRNA provided in the embodiments of the present invention can be used as a targeted drug, showing the activity of efficiently inhibiting the expression of DUSP23 gene and protein; DUSP23 siRNA molecules can effectively inhibit the proliferation, cloning, migration, cell cycle progression, xenograft tumor growth of MHCC97-H and HCCLM-3 cells, and induce apoptosis of MHCC97-H and HCCLM-3 cells, and thus have the potential to be used in anti-tumor, especially liver cancer treatment.

[0157] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0158] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0159] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of an agent for inhibiting DUSP23 expression in the preparation of an anti-liver cancer drug, characterized in that: The reagent for inhibiting DUSP23 expression is siRNA with a nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4 or siRNA with a nucleotide sequence as shown in SEQ ID NO.5-SEQ ID NO.

6.

2. The use according to claim 1, characterized in that The drug is a solution prepared by siRNA with nucleotide sequences such as SEQ ID NO.3-SEQ ID NO.4; The drug is a solution prepared from siRNA with nucleotide sequences as shown in SEQ ID NO.5-SEQ ID NO.

6.

3. The use according to claim 2, characterized in that The solvent used to prepare the solution is DEPC water or sterile water for injection.

4. The use according to claim 1, characterized in that The anti-liver cancer drug is a drug that inhibits the proliferation ability of liver cancer cells and reduces the cloning ability of liver cancer cells.

5. The use according to claim 1, characterized in that The anti-liver cancer drug is a drug that inhibits the migration ability of liver cancer cells.

6. The use according to claim 1, characterized in that The anti-liver cancer drug is a drug that induces cell cycle arrest and apoptosis of liver cancer cells.

7. The use according to claim 1, characterized in that The anti-liver cancer drug is a drug that has tumor inhibition activity on nude mouse transplanted tumors of liver cancer cells.

8. A DUSP23-targeted siRNA, characterized in that: The siRNA is the siRNA with a nucleotide sequence as shown in SEQ ID NO.5 to SEQ ID NO.6 in claim 1.

9. An anti-liver cancer drug, characterized in that: The anti-liver cancer drug contains the DUSP23-targeted siRNA according to claim 9.

10. The anti-liver cancer drug according to claim 9, characterized in that The anti-liver cancer drug also contains DEPC water.

Images