TTG1 protein as well as coding gene and application thereof

Abstract

The invention relates to the technical field of plant genetics, in particular to a TTG1 protein and a coding gene and application thereof. The TTG1 protein comprises an amino acid sequence as shown in SEQ ID NO. 1. Based on full-length transcriptome data of pennisetum alopecuroides, the TTG1 protein and the encoding gene thereof are obtained through research. The TTG1 protein provided by the invention not only can effectively regulate and control the anthocyanin content in plants, but also can regulate and control the development of leaves, furs and hairs of the plants. The improved TTG1 protein can be used for cultivating high-resistance pennisetum alopecuroides varieties, and has important significance in the field of developing high-quality pennisetum alopecuroides varieties.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetics, and in particular to a TTG1 protein and a coding gene and application thereof. Background Art

[0002] Anthocyanins are a type of polyphenolic water-soluble plant pigment that not only gives plants bright colors, but also has strong antioxidant and reactive oxygen scavenging functions, which can enhance the stress resistance of plants. Trichomes develop from the epidermal cells of the aboveground part of the plant and are a specialized hair-like structure. Trichomes are the outermost layer of the plant in contact with the environment and are one of the important protective tissues of the plant. They play an important role in resisting both biotic and abiotic stresses. Therefore, in the selection of new varieties, focusing on selecting germplasm resources with high anthocyanin content and trichomes is an effective solution for breeding highly resistant varieties.

[0003] 'Purple-leaf' Pennisetum setaceum cv. Rubrum is an important ornamental grass with purple-red leaves and inflorescences. It is a beautiful member of the genus Pennisetum. It also has strong resistance to diseases and pests and is widely used to improve garden landscapes. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a TTG1 protein and a coding gene and application thereof.

[0005] The present invention uses the full-length transcriptome data of 'purple leaf' Pennisetum obtained by the research group to clone the PsTTG1 gene. The 35S::PsTTG1:YFP vector was further constructed and transiently transformed into tobacco, and it was found that PsTTG1 was localized in the nucleus and cytoplasm. The present invention further transformed PsTTG1 into the Arabidopsis thaliana ttg1 mutant and found that PsTTG1 could restore the seed coat color of the ttg1 mutant, proving that the PsTTG1 gene is a functional gene that controls the anthocyanin content of Pennisetum seeds. In addition, PsTTG1 can also regulate the development of leaf epidermal hairs.

[0006] In a first aspect, the present invention provides a TTG1 protein, wherein the TTG1 protein comprises an amino acid sequence as shown in SEQ ID NO.1.

[0007] Furthermore, the gene encoding the TTG1 protein contains the nucleotide sequence shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides a nucleic acid comprising a nucleotide sequence as shown in SEQ ID NO.2.

[0009] The present invention further provides a biological material, which comprises the nucleic acid; the biological material is an expression cassette, a vector or a transgenic cell.

[0010] The present invention further provides a kit, which comprises one or more of the TTG1 protein, the nucleic acid or the biological material.

[0011] In a third aspect, the present invention provides use of the TTG1 protein, the nucleic acid, the biological material or the kit in regulating the anthocyanin content in plants.

[0012] The present invention further provides the use of the TTG1 protein, the nucleic acid, the biological material or the kit in regulating the development of leaf epidermal hairs of plants.

[0013] Furthermore, by increasing the expression level of the TTG1 protein or the nucleic acid, the anthocyanin content in the plant is increased, or the development of epidermal hair is promoted.

[0014] Furthermore, the plant is Pennisetum.

[0015] The present invention has the following beneficial effects:

[0016] The present invention has obtained a TTG1 protein and a coding gene thereof, which can effectively provide the content of anthocyanins in plants by increasing the expression level of the TTG1 protein in plants, and can also promote the development of epidermal hairs. The TTG1 protein provided by the present invention can be used to regulate the content of anthocyanins and the development degree of epidermal hairs in Pennisetum, and then applied to the variety breeding of Pennisetum, which is conducive to the breeding of high-resistant varieties of Pennisetum. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 This is an agarose gel electrophoresis diagram of the PCR amplification product of the TTG1 protein provided in Example 1 of the present invention.

[0019] Figure 2 It is a schematic diagram of the electrophoresis results after prokaryotic expression of TTG1 protein provided in Example 1 of the present invention.

[0020] Figure 3 It is a schematic diagram of the subcellular localization results of the TTG1 protein provided in Example 1 of the present invention.

[0021] Figure 4 It is the phenotypic analysis result after overexpression of PsTTG1 provided in Example 1 of the present invention; wherein A: Arabidopsis thaliana ttg1 mutant (ttg1) and PsTTG1 overexpression strain (OE); B: leaves; C: anthocyanin content in leaves; D: fruit pods; E: seeds; F: epidermal hairs. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1

[0024] 1. Gene cloning

[0025] The present invention is based on the full-length transcriptome data of 'purple leaf' Pennisetum (NCBI accession number: PRJ NA741859, completed by the present invention), and uses the Blast Zone function of TBTools (v1.120) to establish a local Pennisetum protein database. The protein sequence of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1) gene (GenBank accession number: CAC10524.1) is used as the input sequence, and Blast screening is performed on homologous sequences. Then, the gene sequence with the smallest E-value (Gene.148134::Mix_transcript_60358::g.148134::m.148134) is selected as the candidate gene.

[0026] According to the full-length sequence of the gene, primers PsTTG1-F 5'-CACCAGATCAATCCACTCCACC-3' and PsTTG1-R 5'-AAGTGCAGAACCACATATGACCA-3' were designed to amplify the coding region. Sequence analysis found that the GC content of the PsTTG1 coding region reached 70%, which is a gene with high GC content. The amplification effect of ordinary PCR enzymes is poor. Therefore, the present invention uses TaKaRa Ex Premier DNA Polymerase for PCR reaction. The template uses cDNA of Pennisetum leaf.

[0027] The PCR reaction system is as follows:

[0028] Table 1 PCR reaction system

[0029] TaKaRa Ex Premier DNA Polymerase(2×) 25μL TTG1-F 1μL TTG1-R 1μL cDNA 1μL ddH2O 22μL Total volume 50μL

[0030] The PCR reaction procedure is as follows:

[0031] Table 2 PCR reaction procedure

[0032]

[0033] Agarose gel electrophoresis of PCR amplification products Figure 1 shown.

[0034] The present invention uses a PCR product purification kit (Novozyme DC301-01) to purify and recover the PCR product, and then takes 4 μL of the product and 1 μL of pEASY-Blunt Cloning Vector (All Gold CB101-01) flat-end cloning vector in a PCR instrument (Bio-Rad C1000Touch) for 25°C connection and reacts for 15 minutes. DH5α competent cells are transformed by freeze-thaw method, coated on Amp-resistant LB plates, cultured overnight at 37°C, and single clones are selected and sent to sequencing companies for sequencing after colony PCR verification. The plasmid extracted from the bacterial solution with correct sequencing is used for standby, that is, pEASY-PsTTG1 plasmid.

[0035] Finally, the Pennisetum PsTTG1 gene was obtained, with a coding region of 1080 bp in length (e.g. Figure 1 ), the sequence is shown in SEQ ID NO.2. It encodes 359 amino acid residues, the sequence is shown in SEQ ID NO.1, and belongs to the WD40 transcription factor gene family.

[0036] 2. Prokaryotic expression

[0037] The pEASY-PsTTG1 plasmid constructed in the previous step was used as a template, and the coding region sequence of PsTTG1 with the termination codon removed was amplified using primers PsTTG1-YH-F: 5'-ATGGACCTCCCCAAGCCGCC-3' and PsTTG1-YH-R: 5'-GACCCTGAGAAGCTGGACCT-3'. The PCR product was purified and recovered and connected to the pEASY-BluntE2 prokaryotic expression vector. The successfully constructed and sequenced pEASY-BluntE2-PsTTG1 plasmid was transformed into BL21 (DE3) competent cells (full gold CD601).

[0038] Take 10 μL of bacterial solution and add 2 mL of LB (Amp) to culture overnight at 37°C at 180 rpm (small shaking). Take 1 mL of the overnight cultured bacterial solution and add it to 50 mL of LB (Amp) medium for culture (large shaking). The culture conditions are 37°C and 180 rpm. Shake until OD 600=0.5, add IPTG with a working concentration of 1mM for induction, and the culture conditions are 30℃, 180rpm. Take 1mL of bacterial solution at 0h, 2h, 4h, and 6h respectively, and store at 4℃. After the induction, pour the cultured bacterial solution into a 50mL centrifuge tube, centrifuge at 4℃ and 5000rpm for 10min, pour out the supernatant and resuspend the bacteria with 10mL PBS buffer, transfer to a 50ML centrifuge tube and add 100μL PMSF (to prevent protein degradation). Then use an ultrasonic crusher (Ningbo Xinzhi JY92-IIDN) on ice for crushing, the program is: ultrasonic 3s, stop 2s, a total of 30min, power 30%. Pour the crushed liquid into a 50mL centrifuge tube, centrifuge at 12000rpm for 15min, pour the supernatant into a 15mL centrifuge tube and freeze at -80℃. Dissolve the precipitate with 8M urea, culture overnight at 4℃ after dissolution, and then freeze in a -80℃ refrigerator. Take 100 μL of the supernatant and precipitate at 0h (before induction), 2h, 4h, 6h, and add 20 μL of 6×Protein Loading Buffer (All-Gold DL101) to each, mix well, and boil for 10 minutes. Take 20 μL of each for SDS-PAGE electrophoresis. The electrophoresis results showed that PsTTG1 began to express at 2h after IPTG induction, with a size of about 40kDa, which was in line with expectations. At the same time, it was found that the expression level in the precipitate was the highest, indicating that the expression of PsTTG1 protein mainly existed in the form of inclusion bodies.

[0039] 3. Construction of overexpression vector

[0040] The expression vector was constructed by seamless connection. First, a primer with 22 bp vector flanking sequence (underlined part) was designed according to the expression vector sequence: Y3-PsTTG1-F: 5'- cctactagtcctagggacgtca ATGGACCTCCCCAAGCCGCC-3';Y3-PsTTG1-R:5'- tgctcaccatacgcgttacaga GACCCTGAGAAGCTGGACCT-3'. Using pEASY-PsTTG1 plasmid as template, PCR amplification was performed using TaKaRa Ex Premier DNA Polymerase (the method is the same as above). The expression vector Y3 was single-digested with BglII. The 3302Y3 vector digestion product and PCR product were purified and recovered respectively. After recovery, seamless ligase (ClonExpress II One Step Cloning Kit) was used for ligation.

[0041] The connection system is as follows:

[0042] Table 3 Connection system

[0043] Y3 digestion and purification product 1μL PCR purification product 4μL 5×CE II buffer 2μL Exnase II 1μL ddH2O 2μL Total volume 10μL

[0044] Reaction conditions: 37°C for 30 min.

[0045] After the reaction is completed, take 5 μL of the ligation product to transform DH5α competent cells, spread it on Kana resistance LB plates, culture it at 37°C overnight, pick a single clone and send it to a sequencing company for sequencing after colony PCR verification. The plasmid extracted from the correctly sequenced bacterial solution is used for standby, namely the Y3-TTG1 (35S::PsTTG1:YFP) plasmid.

[0046] 4. Subcellular localization observation

[0047] To further clarify the subcellular localization of the protein, the Y3-PsTTG1 plasmid constructed in the present invention was transformed into Agrobacterium EHA105 and then injected into the lower epidermal cells of Nicotiana benthamiana. After 48 hours of culture, the protein localization was observed under a laser confocal microscope (Leica SP8). Figure 2 As shown, PsTTG1 is localized in the nucleus and cytoplasm, indicating that PsTTG1 protein is a protein localized in the nucleus and cytoplasm, which is consistent with the localization characteristics of TTG1 protein.

[0048] 5. Gene function identification

[0049] In order to clarify the function of Pennisetum PsTTG1, the present invention transformed the constructed Y3-PsTTG1 plasmid into Agrobacterium GV3101. The Arabidopsis thaliana ttg1 mutant (the strain does not contain PsTTG1) was transformed by inflorescence infection, and the seed coat color was observed after the T3 generation transgenic seeds were harvested. The results showed that the leaves of the PsTTG1 overexpressing strain were purple-red, while the leaves of the Arabidopsis thaliana ttg1 mutant (control) were green ( Figure 4 A and B in the figure). Anthocyanins were extracted from the leaves and compared to find that the anthocyanin content of the overexpression strain was significantly higher than that of the control ( Figure 4 C in the figure). It was observed that the fruit pods and seed coats of the control were green, while the fruit pods and seed coats of the overexpression strain were purple-red ( Figure 4 D and E in Figure 1). In addition, the present invention also found that the control leaves had no epidermal hairs, while the overexpression strains had obvious epidermal hairs ( Figure 4 These results suggest that the PsTTG1 gene regulates anthocyanin content and controls leaf epidermal hair development.

[0050] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A TTG1 protein, characterized in that It includes the amino acid sequence shown in SEQ ID NO.

1.

2. The TTG1 protein according to claim 1, characterized in that The gene encoding the TTG1 protein contains the nucleotide sequence shown in SEQ ID NO.

2.

3. A nucleic acid, characterized in that The nucleic acid comprises the nucleotide sequence shown in SEQ ID NO.

2.

4. A biomaterial, characterized in that: The biological material comprises the nucleic acid according to claim 3; the biological material is an expression cassette, a vector or a transgenic cell.

5. A kit, characterized in that: The kit comprises one or more of the TTG1 protein according to claim 1 or 2, the nucleic acid according to claim 3, or the biological material according to claim 4.

6. Use of the TTG1 protein according to claim 1 or 2, the nucleic acid according to claim 3, the biological material according to claim 4 or the kit according to claim 5 in regulating the anthocyanin content in plants.

7. Use of the TTG1 protein according to claim 1 or 2, the nucleic acid according to claim 3, the biological material according to claim 4 or the kit according to claim 5 in regulating the development of leaf epidermal hairs of plants.

8. The use according to claim 6 or 7, characterized in that: By increasing the expression level of the TTG1 protein or the nucleic acid, the anthocyanin content in the plant is increased, or the development of epidermal hair is promoted.

9. The use according to any one of claims 5 to 8, characterized in that: The plant is Pennisetum.

Images