A novel nitrilase and its application in nicotinic acid biosynthesis
By recombining nitrile hydrolase in Gordonella and optimizing its promoter, the existing nitrile hydrolase has solved the problem of low enzyme activity and low expression intensity in niacin biosynthesis, and efficient niacin production has been achieved, meeting the needs of modern industrialization.
Patent Information
- Application Number
- CN202411566649.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-05
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2044-11-05
AI Technical Summary
The existing nitrile hydrolase has problems such as low enzyme activity, low expression intensity, and poor tolerance to nitrile substrates in niacin biosynthesis, which cannot meet the needs of modern industrialization.
Through the method of recombinant nitrile hydrolase of Gordonella, its promoter is optimized to enhance enzyme activity, and heterologous expression is carried out through E. coli as a host to obtain a new nitrile hydrolase with high substrate conversion rate and high niacin production efficiency.
The enzyme activity of nitrile hydrolase has been increased by about 1.7 times, and the production efficiency of niacin has reached 123.11g/L, meeting the needs of industrial production.
Smart Images

Figure CN119265168B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biocatalysis, and particularly to a novel nitrilase and its application in the biosynthesis of nicotinic acid. Background Art
[0002] Nicotinic acid is an essential nutrient for the human body, which can solve symptoms such as dermatitis, diarrhea, dementia, etc.; it is also a vascular protector that can prevent thrombus formation and atherosclerotic symptoms. In addition, nicotinic acid can be used as a pharmaceutical and chemical synthesis intermediate, food and feed additive, etc., and the market demand is increasing.
[0003] Currently, the domestic nicotinic acid industry mainly uses chemical synthesis methods. The existing production processes are relatively backward, with high energy consumption, small production scale, serious three-waste pollution, and the output is difficult to meet the market demand. However, biocatalytic methods have received increasing attention due to their great advantages, and related reports are also increasing day by day. Directly using 3-cyanopyridine as a raw material to hydrolyze it in one step under the action of nitrilase is also one of the hotspots of many studies. This method has the advantages of mild reaction conditions, easy control of the reaction process, few by-products, high conversion efficiency, and little environmental pollution. The specific reaction is as follows:
[0004]
[0005] In the existing biocatalytic production of nicotinic acid by nitrilase, there are still deficiencies such as fewer types of nitrilase-producing bacteria, weak tolerance to nitrile substrates, low catalytic activity, and poor thermal stability, which cannot meet the needs of modern industrialization. Therefore, it is of important industrial application value to improve the enzyme activity of nitrilase by the method of recombinant nitrilase of Gordonia sp., develop a highly efficient nitrilase with strong substrate tolerance, and prepare nicotinic acid green and efficiently. Summary of the Invention
[0006] To solve the above technical problems, the present invention provides a novel nitrilase and its application in the biosynthesis of nicotinic acid. The present invention provides a novel nitrilase derived from Gordonia sp., a nucleic acid molecule encoding it, a promoter with the highest nitrilase enzyme activity of Gordonia sp. expression, a vector and a cell containing these nucleic acid molecules, and characterizes the catalytic properties of the constructed recombinant engineering bacteria to determine the optimal conversion conditions, so as to solve the problems of low enzyme activity and low expression intensity existing in the existing technology of catalytic synthesis of nicotinic acid and its derivatives by nitrilase, and improve its application value in the synthesis of nicotinic acid.
[0007] The nitrilase gene GdNit derived from Gordonia sp. was cloned and amplified from a plasmid carrying the nitrilase gene GdNit. Its amino acid sequence is shown in SEQ ID NO:2, and its nucleotide sequence is shown in SEQ ID NO:1. Through further promoter modification, a recombinant nitrilase was obtained, and its promoter nucleotide sequence is shown in SEQ ID NO:3. The expression intensity of this promoter is lower than that of the plasmid T7 promoter, and the enzyme activity is increased by about 1.7 times compared with the initial enzyme activity, reaching 17.35 U / mL.
[0008] The present invention is achieved through the following technical solutions:
[0009] The first object of the present invention is to provide a novel nitrilase, which is derived from Gordonia sp., and its amino acid sequence is shown in SEQ ID NO:2.
[0010] The second object of the present invention is to provide a gene encoding the novel nitrilase.
[0011] In one embodiment of the present invention, the nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0012] The third object of the present invention is to provide an expression vector carrying the gene.
[0013] The fourth object of the present invention is to provide a recombinant bacterium expressing the novel nitrilase.
[0014] In one embodiment of the present invention, the expression of the novel nitrilase in the recombinant bacterium is regulated by a promoter sequence with a nucleotide sequence shown in SEQ ID NO.3.
[0015] In one embodiment of the present invention, the host of the recombinant bacterium is Escherichia coli, Bacillus subtilis, Pichia pastoris or Corynebacterium glutamicum; preferably Escherichia coli BL21(DE3).
[0016] The fifth object of the present invention is to provide a method for preparing the recombinant bacterium, which includes the following steps:
[0017] (1) Using the Escherichia coli genome as a template, amplifying the promoter sequence to obtain a promoter sequence with a nucleotide sequence shown in SEQ ID NO.3;
[0018] (2) After recovering the promoter fragment in step (1), constructing it into a plasmid carrying the nitrilase gene to obtain a recombinant plasmid;
[0019] (3) Transforming the recombinant plasmid in step (2) into a host bacterium to obtain a recombinant bacterium.
[0020] The sixth object of the present invention is to provide the application of the recombinant bacterium in nicotinic acid biosynthesis.
[0021] In one embodiment of the present invention, the method of the application is as follows:
[0022] Using 3-cyanopyridine at 100 mM - 300 mM as a substrate, and using the cells of the recombinant bacterium at 3 g·L -1 ~5 g·L -1 as a whole-cell catalytic biocatalyst, through batch conversion or continuous batch feeding conversion, biotransforming to produce nicotinic acid. The recombinant bacterium is the novel recombinant Escherichia coli with nitrilase.
[0023] The sixth object of the present invention is to provide a promoter, which is the promoter of the novel nitrilase gene, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 3.
[0024] The seventh object of the present invention is to provide an expression vector containing the promoter described above.
[0025] The eighth object of the present invention is to provide a recombinant bacterium expressing the novel nitrilase, which contains the promoter described above.
[0026] The ninth object of the present invention is the application of the promoter in promoting the expression of the novel nitrilase.
[0027] The above technical solutions of the present invention have the following advantages compared with the prior art:
[0028] The present invention provides a novel nitrilase and its application in nicotinic acid biosynthesis. The novel nitrilase of Gordonia provided by the present invention can efficiently catalyze 3-cyanopyridine to produce nicotinic acid. In particular, the substrate conversion rate of the nitrilase after promoter optimization reaches 100%, and the production efficiency of nicotinic acid is as high as 123.11 g / L, which has important industrial application value for the green and efficient preparation of nicotinic acid and its derivatives. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to the specific embodiments of the present invention and in combination with the drawings, wherein,
[0030] Figure 1 is the double digestion result of pET-3b-GdNit in the E. coli BL21(DE3) expression host of the present invention;
[0031] Figure 2 is the fermentation process curve of the recombinant bacterium E. coli BL21(DE3)-GdNit of the present invention;
[0032] Figure 3SDS-PAGE of the enzyme production of the novel nitrilase recombinant Escherichia coli in the present invention;
[0033] Figure 4 Comparison of the expression intensity and enzyme activity of the recombinant strains with different promoter modifications in the present invention;
[0034] Figure 5 Reaction process of fed-batch continuous conversion of 3-cyanopyridine to synthesize nicotinic acid in the present invention. Detailed implementation manners
[0035] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments do not limit the present invention.
[0036] In the first aspect, the present invention provides a Gordonia nitrilase (novel nitrilase), the amino acid sequence of which is shown in SEQ ID NO: 2, and it can catalyze the hydrolysis of 3-cyanopyridine to prepare nicotinic acid.
[0037] Further, the novel nitrilase is constructed by PCR amplification and gene recombination expression technology to construct a recombinant expression plasmid containing the Gordonia nitrilase gene, and is transformed into the engineering bacterium Escherichia coli BL21(DE3) host for heterologous expression.
[0038] In the second aspect, the present invention provides a nucleic acid molecule encoding the above novel nitrilase, and the nucleotide sequence thereof is shown in SEQ ID NO: 1.
[0039] The above nucleic acid molecule provided by the present invention can usually be obtained by using a PCR instrument for amplification or artificial synthesis methods.
[0040] In the third aspect, the present invention provides the optimized promoter P rpoH of the above novel nitrilase, the amino acid sequence of which is shown in SEQ ID NO: 3. Compared with the original T7 promoter, the recombinant nitrilase using P rpoH has the most suitable expression level, and its enzyme activity is significantly improved when catalyzing the production of nicotinic acid.
[0041] In the fourth aspect, the present invention provides a recombinant vector containing the above nucleic acid molecule.
[0042] Further, the above recombinant vector is pET-3b-GdNit, which is obtained by replacing the sequence between the Nde I and BamHI restriction enzyme sites of pET-3b with the nucleic acid molecule encoding the above novel nitrilase, and the remaining sequences remain unchanged.
[0043] In the fifth aspect, the present invention provides a recombinant cell containing the above recombinant vector.
[0044] Furthermore, the recombinant cells are recombinant bacteria E. coli BL21(DE3) and recombinant bacteria E. coli BL21(DE3). The recombinant cells can be recombinant genetically engineered bacteria. The culture medium used for the recombinant genetically engineered bacteria to express the novel nitrilase can be a culture medium in the art that can enable the growth of the recombinant genetically engineered bacteria and the expression of the nitrilase of the present invention, such as LB medium.
[0045] There are no special requirements for the culture method and culture conditions, as long as the normal growth of the recombinant genetically engineered strain is ensured, and the expression of Gordonia nitrilase is induced under appropriate temperature conditions. The preferred culture method is as follows: inoculate the recombinant bacteria E. coli BL21(DE3) / pET-3b-GdNit into an LB liquid medium containing ampicillin, culture at 37°C and 220 rpm for 12 hours, transfer to 30 mL of LB medium with corresponding resistance at an inoculation amount of 1% (v / v), place at 37°C and 220 rpm for culture, centrifuge the culture solution, collect the cell precipitate, and wash with physiological saline to obtain recombinant cells.
[0046] More specifically, the construction method of the above-mentioned recombinant cells may include the following steps:
[0047] (1) Amplification of the Gordonia nitrilase gene GdNit;
[0048] (2) Construction of the recombinant expression plasmid pET-3b-GdNit;
[0049] (3) Transformation of the recombinant expression plasmid pET-3b-GdNit into the host cell E. coli BL21(DE3);
[0050] (4) Screening for positive clone strains on an LB solid plate resistance medium containing ampicillin.
[0051] In the sixth aspect, the present invention provides the application of the above-mentioned nitrilase, the above-mentioned nucleic acid molecule, the above-mentioned promoter, the above-mentioned recombinant vector, the above-mentioned recombinant cell, and / or the nitrilase prepared by the above-mentioned method in the preparation of nicotinic acid.
[0052] Furthermore, the temperature of the hydrolysis reaction is 20°C to 40°C, such as 20°C, 30°C, 40°C, or any value or range between any two of these values, with 30°C being preferred; the pH value of the hydrolysis reaction is 5 to 9, such as 5, 6, 7, 8, or any value or range between any two of these values, with pH 7.5 (PBS sodium phosphate buffer) being preferred;
[0053] The final concentration of 3-cyanopyridine is 25 mM to 200 mM, such as 25 mM, 50 mM, 75 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, or any value or range between any two of these values, with 50 mM being preferred.
[0054] In one embodiment of the present invention, it includes using any of the above-mentioned recombinant cells to catalyze the hydrolysis reaction of 3-cyanopyridine to prepare nicotinic acid;
[0055] The Gordonia nitrilase described in the present invention can be used in the form of whole cells of engineered bacteria, or in the form of unpurified crude enzyme, or in the form of partially purified or fully purified enzyme. The Gordonia nitrilase of the present invention can also be prepared into a catalyst in the form of immobilized enzyme or immobilized cells using immobilization techniques known in the art.
[0056] Furthermore, the hydrolysis reaction is carried out in a stirred or oscillating environment, for example, reacting under stirring at 100 rpm to 500 rpm.
[0057] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels.
[0058] (1) Method for measuring enzyme activity:
[0059] ① Take 200 μL of the bacterial solution, centrifuge at 12000×g for 1 min, discard the supernatant, then suspend and wash the bacterial cells with 100 mM PBS at pH 7.2 for 2 - 3 times to obtain the bacterial cells free of culture residues, and finally supplement to 0.9 mL with the same PBS to obtain the resuspended bacterial cell solution at this volume (as a blank).
[0060] ② Place the above resuspended bacterial cell solution in a metal bath at 30℃ and 1500 rpm for 5 min to allow the bacterial cells to adapt to the subsequent conversion temperature in advance.
[0061] ③ Conversion reaction process: Add 100 μL of 500 mM substrate 3-cyanopyridine to the above resuspended bacterial cell solution to make the total reaction volume 1 mL, and place this reaction system in a metal bath at 30℃ and 1500 rpm for 10 min.
[0062] ④ After the conversion reaction is completed, quickly centrifuge at 12000×g for 1 min to terminate the reaction.
[0063] ⑤ Color development reaction process: Take 10 μL of the supernatant of the conversion solution and put it into a 10 mL clean and dry centrifuge tube, add 1.0 mL of sodium phenol solution, 1.5 mL of sodium nitrosoferricyanide solution, and 1.5 mL of sodium hypochlorite solution respectively, and add ammonia-free water to make up to 5 mL volume (990 μL), react in a 27°C water bath for 15 minutes to obtain a blue soluble substance, and detect the absorbance at 630 nm.
[0064] (2) Enzyme activity calculation method: Under standard conditions, the amount of enzyme required to produce 1 μmol of niacin or ammonia per minute.
[0065] (3) The culture medium used in the embodiments of the present invention is as follows:
[0066] LB liquid medium (g / L): peptone 10, yeast powder 5, NaCl 10, pH 7.0. Used for strain fermentation and seed activation
[0067] LB solid medium (g / L): peptone 10, yeast powder 5, NaCl 10, agar powder 18-20 (added to solid medium), pH 7.0.
[0068] Example 1: Obtaining the nitrilase gene sequence from Gordonia
[0069] A plasmid carrying the nitrilase gene GdNit was used as a template and 3b-GdNit-F and 3b-GdNit-R were used as primers to perform PCR amplification to obtain the nitrilase gene GdNit from Gordonia, wherein the nucleotide sequence of the Gordonia nitrilase gene is shown in SEQ ID NO: 1, and the amino acid sequence of the nitrilase encoded by the gene is shown in SEQ ID NO: 2.
[0070] 3b-GdNit-F:
[0071] ACTTTAAGAAGGAGATATACATATGATGGTGAACTACACTAATAA
[0072] 3b-GdNit-R:
[0073] TTGTTAGCAGCCGGATCCTTAACGGTCAGAAGACATATCC
[0074] Example 2: Construction of pET-3b-GdNit recombinant plasmid
[0075] The fragment containing the Gordonia nitrilase gene obtained in Example 1 was digested with Nde I and BamHI to obtain a gene fragment; pET-3b was digested with QuickCut Nde I and QuickCut BamHI to obtain a vector fragment; the gene fragment and the vector fragment were ligated to obtain a recombinant expression plasmid, which was named pET-3b-GdNit. The double digestion result of pET-3b-GdNit in the E. coli BL21(DE3) expression host is as Figure 1 shown. The plasmid was sent for sequencing, and the result was consistent with the expectation.
[0076] Example 3: Heterologous expression of Gordonia nitrilase in E. coli BL21(DE3)
[0077] The recombinant expression plasmid pET-3b-GdNit obtained in Example 2 was transformed into the expression host E. coli BL21(DE3) by heat shock transformation, and spread on an LB solid medium containing 50 μg / mL ampicillin for screening to obtain the recombinant bacterium E. coli BL21(DE3) / pET3b-GdNit expressing Gordonia nitrilase.
[0078] The constructed recombinant nitrilase expression strain E. coli BL21(DE3)-GdNit was fermented to produce the enzyme. During the fermentation process, the growth of the recombinant bacterium (OD600) and the enzyme activity were detected. The results are shown in Figure 2 It was found that the recombinant bacterium reached the highest enzyme activity of 10.53 U / mL when it just entered the growth stationary phase (8 h).
[0079] After that, the recombinant Escherichia coli fermented for 8 h to produce the enzyme was collected, ultrasonically disrupted, and the supernatant was taken for SDS-PAGE analysis after centrifugation. The results are shown in Figure 3 It was found that there was an obvious target protein band at about 39 kDa, which was consistent with the theoretical molecular weight of Gordonia nitrilase. Therefore, it can be concluded that the recombinant Escherichia coli E. coli BL21(DE3)-GdNit was successfully constructed, and Gordonia nitrilase was recombinantly expressed in Escherichia coli.
[0080] Example 4: Promoter screening
[0081] In this example, 6 endogenous promoters in Escherichia coli (P asnB , P alsR , P rpoH , P fnr , P gapA , P ssrA), and characterized the expression intensity together with the plasmid T7 promoter. In the experiment, the green fluorescent protein gene (EGFP) was used as the reporter gene, and the fluorescence intensity of the recombinant bacteria expressing green fluorescent protein was used as an index to measure the level of expression (such as Figure 4 ). It can be seen from the results of promoter characterization that different strength promoter intervals were constructed in the experiment, and the difference in expression intensity was about 10-fold.
[0082] Previous studies have found that too high an expression level of recombinant nitrilase will significantly reduce the enzyme activity of nitrilase. Therefore, it is necessary to regulate the expression level and expression intensity of nitrilase to ensure that the expression level of nitrilase is maintained at the most appropriate level in order to obtain the highest enzyme activity level. For this purpose, the nitrilase gene GdNit was introduced into expression cassettes controlled by different strength promoters for expression in this invention. After fermenting recombinant Escherichia coli with nitrilase of different strength promoters, it can be known from the results of enzyme activity determination (as above Figure 4 shown), for Gordonia nitrilase, the most suitable promoter for recombinant expression intensity is P rpoH . The expression intensity of this promoter is lower than that of the plasmid T7 promoter, and moreover, the enzyme activity has increased by about 1.7 times compared with the initial enzyme activity, reaching 17.35 U / mL. The results of this invention can verify again the speculative conclusion that too high an expression level of nitrilase may lead to a decrease in enzyme activity.
[0083] Example 5: Construction of recombinant strains with promoter modification
[0084] 1. Use a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd., GK1071) to extract the genome of Escherichia coli BL21(DE3) as a template for promoter sequence amplification, and use the designed primers to PCR amplify the DNA fragment of the promoter rpoH, and the amino acid sequence is as shown in SEQ ID NO:3.
[0085] 2. Mix the pET-3b vector with the PCR recovery product, transform it into the competent cells of the expression host E. coli BL21(DE3), and spread it on an LB solid plate containing ampicillin, and place it in an inverted position in a 37°C biochemical incubator for about 12 h. After colonies grow, screen positive transformants for colony PCR verification, and verify by sequencing after colony PCR verification.
[0086] 3b-P rpoH -F:
[0087] GGCTCTAAGGGCATCGGTCGACTAAAAGCGTGTTATACTC
[0088] 3b-P rpoH -R:
[0089] Example 6: Preparation of nicotinic acid using Gordonia nitrilase as a biocatalyst
[0090] 50 mL of the bacterial solution was centrifuged to discard the supernatant, and an equal volume of PBS buffer was added to prepare a resting cell suspension. After incubation in a shaker at 30 °C and 220 rpm for 5 min, 3-cyanopyridine with a final concentration of 200 mM was added to the conversion system in batches. At the same time, 500 μL of the bacterial solution was centrifuged to obtain the supernatant, which was filtered through a membrane. The HPLC method was used to detect the residual amount of the substrate 3-cyanopyridine and the production amount of the product nicotinic acid in the reaction system. The results of biotransformation are as Figure 5 shown; from Figure 5 it can be seen that the resting cells can completely convert 5 batches of the substrate within 150 min, and the accumulated concentration of nicotinic acid is about 1000 mM, that is, the yield is 123.11 g / L.
[0091] Obviously, the above examples are only for clear illustration and are not limitations on the implementation methods. For those of ordinary skill in the art, other different forms of changes or variations can be made based on the above description. It is not necessary and impossible to list all implementation methods here. And the obvious changes or variations derived therefrom are still within the protection scope of the present invention.
Claims
1. A novel nitrilase, characterized in that: The novel nitrilase is derived from Gordonia Gordonia cholesterolivorans ), the amino acid sequence is shown in SEQ ID NO:
2.
2. A gene encoding the novel nitrilase according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
4. An expression vector carrying the gene according to claim 2 or 3.
5. A recombinant bacterium expressing the novel nitrilase according to claim 1.
6. The recombinant bacterium according to claim 5, characterized in that The recombinant bacteria regulates the expression of the novel nitrilase with a promoter sequence such as the nucleotide sequence shown in SEQ ID NO.
3.
7. The recombinant bacterium according to claim 5, characterized in that The host of the recombinant bacteria is Escherichia coli ( Escherichia coli )、Bacillus subtilis( Bacillus subtilis )、Pichia pastoris( Pichia manshurica ) or Corynebacterium glutamicum ( Corynebacterium glutamicum ).
8. The method for preparing the recombinant bacteria according to any one of claims 5 to 7, characterized in that: The following steps are involved: (1) Using the Escherichia coli genome as a template, amplifying the promoter sequence to obtain a promoter sequence having a nucleotide sequence as shown in SEQ ID NO. 3; (2) recovering the promoter fragment of step (1) and constructing it into a plasmid carrying a novel nitrilase gene to obtain a recombinant plasmid; (3) The recombinant plasmid of step (2) is transformed into a host bacterium to obtain a recombinant bacterium.
9. Use of the recombinant bacteria according to claim 5 or 6 in nicotinic acid biosynthesis.
10. The use according to claim 9, characterized in that: The method of application is: 100 mM - 300 mM 3-cyanopyridine was used as substrate and 3 g·L -1 ~ 5 g·L -1 The cells of the recombinant bacteria are used as whole-cell catalytic biocatalysts to generate nicotinic acid through bioconversion in a batch conversion or continuous batch fed conversion manner.
Citation Information
Patent Citations
Fungal nitrilase and gene sequence thereof
CN102618563A
Construction and high density fermentation method of nitrilase recombination expression bacterial strain
CN107267433A