Application of Tn5 transposase in library construction

Abstract

The invention relates to the field of library construction, in particular to application of Tn5 transposase in library construction. The invention provides application of Tn5 transposase in preparation of a transposition reaction system, a library construction reagent and / or a kit. The method comprises the following steps: carrying out enzyme interruption on genome DNA (Deoxyribonucleic Acid) by utilizing Tn5 transposase, introducing a known joint, repairing gap formed by the Tn5 transposase, and carrying out PCR (Polymerase Chain Reaction) amplification on a target fragment. The method can meet the requirements of 1-10ng genome DNA for whole-genome library construction and sequencing, and can solve the problem that low-initial-quantity library construction cannot be met in the prior art. And a low initiation library construction means is provided for cancer genomics research.

Description

Technical Field

[0001] The present invention relates to the field of library construction, and in particular to the application of Tn5 transposase in library construction. Background Art

[0002] Genome sequencing has undergone tremendous development in the past 20 years, from a rarely used research tool to a method with widespread application in clinical settings. From rare diseases to cancer, genomics is changing our knowledge of biology. Genomic research tools have solved the causes of previously undiagnosable diseases, identified mutations in driver genes associated with cancer, and given us a new understanding of the pathophysiology of many diseases. Common genomic tools based on next-generation sequencing (NGS) include targeted genome sequencing (TGP), whole exome sequencing (WES), and whole genome sequencing (WGS). Targeted genome sequencing (TGP) is the sequencing of a certain number of genes. Whole exome sequencing (WES) is a genomic analysis method that uses a designed probe kit to capture and enrich DNA from exon regions of the whole genome with known coordinates, and then perform high-throughput sequencing. For the human genome, the exon region accounts for about 1% of the genome, which is about 30M. Unlike focused methods such as exome sequencing or targeted resequencing that analyze limited parts of the genome, whole genome sequencing (WGS) is a comprehensive method that analyzes the entire genome. It can provide a comprehensive view of the entire genome and is ideal for exploratory applications such as identifying pathogenic variants and new genome assembly. Therefore, WGS is one of the most comprehensive forms of NGS and has the potential to identify more biomarkers. The genetic information obtained by WGS helps to better understand cancer and discover new biomarkers, thereby providing personalized treatment and precision medicine for future patients.

[0003] Whole Genome Sequencing (WGS) is the use of a high-throughput sequencing platform to sequence all genes in the genome of an organism and determine the base sequence of its DNA. This technology can detect a variety of comprehensive mutation information such as single nucleotide variations (SNVs), insertions and deletions (InDels), copy number variations (CNVs), and structural variations (SVs) at the whole genome level. At present, conventional WGS library construction methods usually include the following steps, namely, genomic DNA fragmentation and homogenization, end repair and A addition, adapter addition, and finally PCR amplification of the target fragment.

[0004] Currently, the minimum amount of genomic DNA required for WGS library construction is 300 ng, and the minimum amount of genomic DNA required for enzymatic WGS library construction kits is 50 ng. These methods are not suitable for samples with relatively low genomic DNA amounts (1-10 ng) in cancer omics research, such as microdissection samples or puncture samples.

[0005] Therefore, a sequencing method that requires a lower amount of genomic DNA is urgently needed. Summary of the invention

[0006] In view of this, the present invention provides the application of Tn5 transposase in library construction. The method provided by the present invention can meet the needs of whole genome library construction and sequencing with 1-10 ng genomic DNA, and can solve the problem that the current technology cannot meet the requirements of low starting amount library construction. It provides a means of low starting amount library construction for cancer genomics research.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides the use of Tn5 transposase in library construction.

[0009] In the above application, the Tn5 transposase is prepared into Tn5 transposomes.

[0010] In some embodiments of the present invention, in the above application, the added amount of the Tn5 transposase is 0.01U / μL to 0.2U / μL.

[0011] In some embodiments of the present invention, in the above application, the method for preparing Tn5 transposomes comprises the following steps: embedding the sequencing adapter into the Tn5 transposase to form a Tn5 transposon; the specific reaction system is: 20 μL of 1U / μL Tn5 transposase, 5 μL of 50 μM annealed adapter, a total of 25 μL, after the above reaction system is fully mixed, the temperature is kept at 25°C for 1 hour to obtain the Tn5 transposase, and it is stored at -20°C for future use.

[0012] In some embodiments of the present invention, in the above application, the adapter is a double adapter sequence of the BGI sequencing platform, with reference to patent WO2016058127A1, and the specific adapter sequences include double adapter sequence A, double adapter sequence B and double adapter sequence C. Among them, double adapter sequence A is the sequence shown in SEQ ID NO: 1; double adapter sequence B is the sequence shown in SEQ ID NO: 2, and double adapter sequence C is the sequence shown in SEQ ID NO: 3.

[0013] In some embodiments of the present invention, in the above application, the sequence of SEQ ID NO: 1 is: 5'-CTGTCTCTTATACACATCT-3'.

[0014] In some embodiments of the present invention, in the above application, the sequence of SEQ ID NO: 2 is 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'.

[0015] In some embodiments of the present invention, in the above application, the sequence of SEQ ID NO: 3 is 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'.

[0016] The present invention also provides the use of Tn5 transposase in preparing a transposition reaction system, a library construction reagent and / or a kit.

[0017] The present invention also provides a transposition reaction system, comprising: 5X TD buffer and 0.01U / μL-0.2U / μL Tn5 transposase.

[0018] In some embodiments of the present invention, the transposition reaction system comprises:

[0019] 5X TD buffer 10μL

[0020] Tn5 transposase 1 μL

[0021] Make up to 50 μL with NF H2O.

[0022] The present invention also provides library construction reagents, including the above transposition reaction system.

[0023] The present invention also provides a kit, comprising the above transposition reaction system and / or the above library construction reagent and an acceptable auxiliary agent or carrier.

[0024] The present invention also provides the use of the above transposition reaction system, the above library construction reagent and / or the above kit in library construction.

[0025] The present invention also provides a method for constructing a library, wherein after a sample to be tested is subjected to transposition reaction, end repair, amplification, circularization, and purification, the library is obtained;

[0026] The transposition reaction adopts the above-mentioned transposition reaction system, the above-mentioned transposition reaction system in the library construction reagent or the above-mentioned transposition reaction system in the kit;

[0027] The mass volume ratio of the sample to be tested and the Tn5 transposase is 1:(0.1-3).

[0028] In some embodiments of the present invention, in the above construction method, when the added amount of the sample to be tested is 1 ng, the Tn5 transposase is diluted 20 times; when the added amount of the sample to be tested is 5 ng to 10 ng, the Tn5 transposase is diluted 10 times.

[0029] In some embodiments of the present invention, in the above construction method, the original concentration of the Tn5 transposase is 0.5-1.5 U / μL.

[0030] In some embodiments of the present invention, in the above construction method, the conditions of the transposition reaction include 55° C. and reaction time of 5 min.

[0031] In some embodiments of the present invention, in the above construction method, the transposition reaction includes a 1.8X magnetic bead purification step.

[0032] In some embodiments of the present invention, in the above construction method, the end repair adopts an end reaction system; the end reaction system comprises: NEB buffer 2, Klenow fragment (3'->5'exo-), Tagmented DNA and dNTP Mix; and / or

[0033] The amplification adopts an amplification system; the amplification system comprises: KAPA HiFi HotStart Ready Mix and primers; and / or

[0034] The cyclization adopts a cyclization reaction system; the cyclization reaction system includes: TA buffer, ATP, Ad153splint oligo and T4 DNA Ligase.

[0035] In some embodiments of the present invention, in the above construction method, the end repair adopts an end reaction system; the end reaction system comprises:

[0036]

[0037] In some embodiments of the present invention, in the above construction method, the conditions of the terminal reaction include 37° C. and reaction time of 30 min.

[0038] In some embodiments of the present invention, in the above construction method, the terminal reaction includes a 1.8X magnetic bead purification step.

[0039] In some embodiments of the present invention, in the above construction method, the amplification adopts an amplification system; the amplification system comprises:

[0040] KAPA HiFi HotStart Ready Mix 2X Primer 1 20 μM Primer 2 20 μM;

[0041] The primer 2 includes a barcode primer.

[0042] In some embodiments of the present invention, in the above construction method, when the samples to be tested are different, the barcode primers are different.

[0043] In some embodiments of the present invention, in the above construction method, the amplification system comprises:

[0044]

[0045] In some embodiments of the present invention, in the above construction method, the amplification procedure comprises:

[0046]

[0047]

[0048] In some embodiments of the present invention, in the above construction method, the amplification further includes a 1.0X magnetic bead purification step.

[0049] In some embodiments of the present invention, in the above construction method, the cyclization adopts a cyclization reaction system; the cyclization reaction system comprises:

[0050]

[0051] In some embodiments of the present invention, in the above construction method, the cyclization reaction system comprises:

[0052]

[0053]

[0054] In some embodiments of the present invention, in the above construction method, the cyclization reaction system further comprises: heat denaturing the sample to be tested after the amplification; the heat denaturation comprises the step of reacting at 95°C for 5 minutes.

[0055] In some embodiments of the present invention, in the above construction method, the conditions of the cyclization reaction include reaction at 37° C. for 30 min.

[0056] In some embodiments of the present invention, in the above construction method, the purification further includes an enzymatic digestion step; the enzymatic digestion adopts an enzymatic digestion reaction system; the enzymatic digestion reaction system includes:

[0057]

[0058]

[0059] In some embodiments of the present invention, in the above construction method, the conditions of the enzymatic digestion include reaction at 37° C. for 30 min.

[0060] In some embodiments of the present invention, in the above construction method, the enzyme digestion also includes a step of 2.5X magnetic bead purification.

[0061] The present invention also provides a library obtained by the above construction method.

[0062] The present invention also provides application of the above library in tumor genomics.

[0063] The present invention also provides the use of the above library in screening markers.

[0064] The present invention also provides the use of the above library in preparing products for detecting tumor genomes.

[0065] In some embodiments of the present invention, in the above application, the detection amount of the tumor genome is 1 to 10 ng.

[0066] The present invention provides the use of Tn5 transposase in preparing a transposition reaction system, a library construction reagent and / or a kit. The present invention uses Tn5 transposase to perform enzymatic shearing on genomic DNA and introduces a known linker at the same time, repairs the gap formed by Tn5 transposase, and then PCR amplifies the target fragment. The method can meet the needs of whole genome library construction and sequencing of 1 to 10 ng genomic DNA, and can solve the problem that the current technology cannot meet the requirements of low starting amount library construction. It provides a means of low starting library construction for cancer genomics research. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0068] Figure 1 The result graph of 2100 after PCR double selection products is shown;

[0069] Figure 2 The figure shows the library sequencing quality result; the vertical axis is the percentage, the first line from top to bottom is Q20, the second line from top to bottom is Q30, which indicates the sequencing quality, the higher the quality value (Q), the smaller the probability (P) of the base being measured incorrectly; Q20 and Q30 indicate the percentage of bases with a quality value ≥ 20 or 30; for example, a total of 1G of data is measured, of which 0.9G of bases have a quality value greater than or equal to 20, then Q20 is 90%;

[0070] Figure 3 The figure shows the comparison of the number of SNVs in the low starting sample and the 500ng normal starting sample for library construction; where: the intersection ratio corresponds to the values ​​of the ratio-Micro and ratio-Normal lines;

[0071] Figure 4 The figure shows the VAF analysis of sample 14TS0Z0434TR1 in tumor samples with different starting amounts for library construction, where 5 ng was used for micro-library construction;

[0072] Figure 5 The figure shows the VAF analysis of sample 14TS0Z0434TR1 in tumor samples with different starting amounts for library construction, where 10 ng was used for micro-library construction;

[0073] Figure 6 The figure shows the VAF analysis of different starting amounts of sample P5MT15T in tumor samples, where 5ng was used for the micro-library construction;

[0074] Figure 7 The figure shows the difference analysis of SNV annotation types in tumor samples when constructing libraries with different starting amounts; from left to right, they are micro-library, normal library, and the intersection of micro-library and normal library. DETAILED DESCRIPTION

[0075] The invention discloses the application of Tn5 transposase in library construction.

[0076] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0077] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0078] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0079] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0080] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0081] The present invention utilizes Tn5 transposase to perform enzyme shearing on genomic DNA and simultaneously introduces a known linker, repairs the gap formed by the Tn5 transposase, and then PCR amplifies the target fragment.

[0082] In Examples 1 to 4, Verification Example 1 and Effect Examples 1 to 4 of the present invention,

[0083] Primer sequences:

[0084] Primer name Nucleotide sequence (5'-3') Ad153splintoligo (as shown in SEQ ID NO:4) GCCATGTCGTTCTGTGAGCCAAGG

[0085] All the raw materials and reagents used can be purchased from the market.

[0086] The present invention will be further described below in conjunction with embodiments:

[0087] Example 1 Tn5 transposition reaction

[0088] 1) Take out 5X TD buffer from -20℃ in advance, thaw it on ice and mix thoroughly.

[0089] 2) Prepare the transposition reaction system in the PCR tube:

[0090]

[0091] 3) After mixing, place in a PCR instrument at 55°C for 5 minutes.

[0092] 4) Return the used reagents to the original kit and store at -20°C.

[0093] 5) After the reaction is completed, the solution is purified with 1.8X magnetic beads and then dissolved in 21 μL NF H2O.

[0094] Example 2 End Repair

[0095] 1) Take out NEB buffer 2 and 10 mM dNTP Mix from -20℃ in advance, thaw them on ice and mix thoroughly.

[0096] 2) Prepare the terminal reaction system in a PCR tube:

[0097] NEB buffer 2 (10X) 2.5μL Klenow fragment (3'->5'exo-) 1.5μL Tagmented DNA obtained in Example 1 19μL 10mM dNTP Mix 2μL

[0098] 3) After mixing, place in a PCR instrument at 37°C for 30 minutes.

[0099] 4) Return the used reagents to the original kit and store at -20°C.

[0100] 5) After the reaction is completed, the solution is purified with 1.8X magnetic beads and then dissolved in 25 μL NF H2O.

[0101] Example 3 PCR amplification

[0102] 1) Take out KAPA HiFi HotStartReadyMix from -20℃ in advance, thaw the PCR primers on ice and mix thoroughly.

[0103] 2) Prepare the amplification system in the PCR tube: add primers with different barcodes to different samples:

[0104] KAPA HiFi HotStart Ready Mix(2X) 25μL 20 μM primer-1 1.5μL 20 μM primer-barcode 1.5μL TN5-treated DNA obtained in Example 2 22μL Total 50μL

[0105] 3) After mixing, amplify on a PCR instrument under the following conditions:

[0106]

[0107] 4) After the reaction is completed, the solution is purified with 1.0X magnetic beads and then dissolved in 25 μL NF H2O.

[0108] 5) Take 1 μL of the PCR purified product for 2100 detection, and use 1 μL for quantitative detection using QubitdsDNA Hs Assay kit.

[0109] Example 4 PCR product cyclization

[0110] Single-chain ring cyclization:

[0111] 1. Cyclization reaction

[0112] 1) Take out 10X TA buffer, ATP and Ad153 splint oligo from -20℃, thaw them on ice and mix thoroughly.

[0113] 2) Thermal denaturation: Take 170-330 ng of the purified PCR product obtained in Example 3, add water to make up to 48.2 μL of the system, mix well, react at 95° C. for 5 minutes, and then immediately place at 4° C.

[0114] 3) Configure the cyclization reaction system:

[0115] 10X TA buffer 6μL 0.1M ATP 0.6μL 20μM Ad153 splint oligo 5μL T4 DNA Ligase (600U / μL) 0.2μL Total volume 11.8μL

[0116] 4) After mixing, react at 37°C for 30 minutes and store at 4°C.

[0117] 2. Exo I and Exo III digestion:

[0118] 1) Take out 10X TA buffer from -20℃, thaw it on ice and mix thoroughly.

[0119] 2) Configure the enzyme digestion reaction system:

[0120] 10X TA buffer 0.4μL ExoI 1.95μL Exo III 0.65μL <![CDATA[H2O]]> 0.65μL Total volume 4μL

[0121] 3) After mixing, incubate at 37°C for 30 minutes.

[0122] 4) Use 2.5X magnetic beads to purify and recover the enzyme digestion product and dissolve it in 22 μL TE buffer.

[0123] 5) Take 1 μL of the cyclized product for Qubit TM ssDNA Assay Kit Quantification.

[0124] 6) Use Qubit to detect the amount of cyclization product. The cyclization efficiency is normal between 10% and 30%. Print the label and stick it on the wall of the centrifuge tube for easy search. The library preparation is now complete.

[0125] Verification Example 1

[0126] Sequencing: The 5-10 ng starting sample circularization product obtained in Example 4 was sequenced. The sample information is as follows:

[0127] Table 1 Sample information

[0128] Sample name Sample Type 5ng sequencing 10ng sequencing P1St18D1 Epithelial √ √ P1St02N Epithelial √ x P5MT15T Tumor √ x 14TS0Z0434TR1 Tumor √ √

[0129] Effect Example 1

[0130] 2100 Results Figure 1 As shown, the size of the obtained DNA fragments is concentrated around 225 bp.

[0131] The GC content, Q20 and Q30 of the samples in Verification Example 1 are as follows Figure 2 As shown, in general, Q20 and Q30 are consistent with conventional WGS library construction and can pass the quality control requirements.

[0132] The basic analysis is shown in Table 2;

[0133] Table 2 Basic analysis results

[0134]

[0135]

[0136] The amount of sequencing data for each sample is greater than 30X, and the clean rate of 5ng data is lower than 10ng, but it can still reach more than 85%, and the alignment rate is around 99.95%.

[0137] Effect Example 2 SNV Number Analysis

[0138] Compare the low starting (sample amount of 5ng and 10ng) data with the 500ng normal starting sample for library construction, such as Figure 3 As shown in the figure, the number of SNVs detected by the micro-library (low starting library) is less than that of the normal library. In tumor samples, most (>75%) of the SNVs detected by the micro-library (low starting library) can be detected by the normal library. The two library construction methods for normal epithelial tissue detected SNVs with great differences (the number of SNVs in the intersection was only in the single digit), while the difference between 5ng and 10ng was not much in tumor samples.

[0139] Effect Example 3 VAF Analysis

[0140] like Figures 4 to 6 As shown in the figure, the VAF of tumor samples starting from different library constructions is not much different, all greater than 0.2, and the VAF of the micro-library is still higher than that of the normal library. In addition, there is little difference between 5ng and 10ng.

[0141] Depend on Figure 7 As shown in the figure, there is little difference in the SNV annotation types of tumor samples when building libraries with different starting amounts, and the SNV annotation types of the intersections are also similar to the original SNV annotation types, that is, the overlap graph is not much different from the micro graph and the normal graph.

[0142] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of Tn5 transposase in preparing transposition reaction systems, library construction reagents and / or kits.

2. A transposition reaction system, characterized in that: include: 5X TD buffer and 0.01U / μL~0.2U / μL Tn5 transposase.

3. Library construction reagent, characterized in that, Comprising the transposition reaction system as described in claim 2.

4. A kit, characterized in that It comprises the transposition reaction system as claimed in claim 2 and / or the library construction reagent as claimed in claim 3 and an acceptable auxiliary agent or carrier.

5. Use of the transposition reaction system according to claim 2, the library construction reagent according to claim 3 and / or the kit according to claim 4 in library construction.

6. A method for constructing a library, characterized in that: After the sample to be tested is subjected to transposition reaction, the library is obtained after end repair, amplification, circularization and purification; The transposition reaction adopts the transposition reaction system as claimed in claim 2, the transposition reaction system in the library construction reagent as claimed in claim 3, or the transposition reaction system in the kit as claimed in claim 4; The mass volume ratio of the sample to be tested and the Tn5 transposase is 1:(0.1-3).

7. The construction method according to claim 6, characterized in that: The end repair adopts an end reaction system; the end reaction system includes: NEB buffer 2, Klenow fragment (3'->5'exo-), Tagmented DNA and dNTPMix; and / or The amplification adopts an amplification system; the amplification system comprises: KAPA HiFi HotStartReady Mix and primers; and / or The cyclization adopts a cyclization reaction system; the cyclization reaction system comprises: TA buffer, ATP, Ad153 splintoligo and T4 DNA Ligase.

8. The library obtained by the construction method according to claim 6 or 7.

9. Use of the library as claimed in claim 8 in preparing a product for detecting tumor genomes.

10. The use according to claim 9, characterized in that The detection amount of the tumor genome is 1 to 10 ng.

Images