SNP (Single Nucleotide Polymorphism) molecular marker related to rice hypoxia resistance character and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a rice hypoxia resistance character and application of the SNP molecular marker. The SNP molecular marker provided by the invention is located at the 25740898th site of the 12th chromosome of rice, and the polymorphism is A or G. The SNP molecular marker is remarkably related to the seedling germination rate of rice under the low-temperature stress condition, and the low-oxygen germination property of a rice variety with the site base type of G under the low-temperature stress condition is remarkably higher than that of a rice variety with the base type of A. The invention also designs a PCR (Polymerase Chain Reaction) primer according to the SNP locus, and the nucleotide sequences of the primer are shown as SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a kit for detecting the SNP locus. Natural population verification shows that the SNP molecular marker related to rice hypoxia resistance can effectively predict rice hypoxia-resistant germination, so that the SNP molecular marker can be used for rice hypoxia and direct seeding molecular breeding marker assisted breeding.

Description

Technical Field

[0001] The invention belongs to the field of rice stress resistance breeding and molecular genetics, and relates to a SNP molecular marker related to the hypoxia tolerance trait of rice and an application thereof, and specifically relates to a SNP marker on rice chromosome 12 that is significantly associated with the hypoxia germination trait of rice, a primer, and the application of the molecular marker. Background Art

[0002] Rice direct seeding technology is a cultivation method that directly sows seeds in the field without raising seedlings or transplanting. Because it can save a lot of labor, it is gradually becoming an ideal method for light, simple and efficient rice cultivation in modern agriculture. The problem of full seedlings is the primary factor affecting the low and unstable yield of direct-seeded rice. One of the reasons is that direct-seeded rice is in a flooded environment during germination. Flooding is beneficial for controlling weeds but not conducive to the formation of direct-seeded rice seedlings. Therefore, it is of great significance to breed rice varieties with good germination flooding tolerance. Studying the genetic basis of rice seed germination flooding tolerance can provide an important theoretical reference for breeding excellent direct-seeded rice varieties. At the same time, by identifying the QTL (Quantitative Trait Loci) that controls germination flooding tolerance and then finely locating and cloning these genes, it will help to further reveal the biochemical and molecular mechanisms of rice germination flooding tolerance.

[0003] The flooding tolerance of rice is a quantitative trait controlled by multiple genes. The expression of genes is closely related to the environment. The interaction between QTL and environment is the main factor affecting quantitative traits. Xu et al. used the flood-tolerant indica rice line IR40931-26 and the flood-tolerant japonica rice line PI543851 as experimental materials. Using RAPD and RFLP molecular markers, they located the QTL related to rice flooding tolerance on chromosome 9, about 4 cM away from RFLP marker C1232, named Sub1, and found that 69% of the phenotypic variation related to flooding tolerance was controlled by Sub1. The rice Sub1 locus contains three genes encoding proteins of the ethylene response factor ERF subfamily—Sub1A, Sub1B, and Sub13. Hou Mingyu et al. used the bud length of seedlings germinated in the dark for 5 days under 20 cm deep water as the index of hypoxia germination ability of rice seedlings, and detected a total of 5 QTLs for hypoxia germination ability of seedlings on chromosomes 1, 2, 5, 5, and 7, respectively. Among them, the enhancement alleles of qAG-1, qAG-2, and qAG-7 came from DV85, and the enhancement alleles of qAG-5a and qAG-5b came from Kinmaza. With the development of whole genome sequencing technology, it is possible to compare the genetic variation of different germplasm resources at the whole genome level. At the same time, combined with phenotypic identification data, the use of linkage analysis and association analysis (GWAS) and other analysis methods can effectively discover new genes and favorable alleles contained in germplasm resources. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker related to the hypoxia tolerance trait of rice and application thereof.

[0005] In a first aspect of the present invention, a SNP molecular marker related to the hypoxia tolerance trait of rice is provided, the molecular marker is from the exon of the LOC_Os12g41590 gene, is located at 25740898 bp of chromosome 12 of rice, and the base is A or G. The SNP molecular marker is significantly correlated with the hypoxia phenotype of rice, and the hypoxia tolerance of rice varieties with a site genotype of G / G is significantly stronger than that of rice varieties with a site genotype of A / A.

[0006] The second aspect of the present invention provides specific primers for the SNP molecular markers related to the hypoxia tolerance trait of rice, which are used to detect the above SNP molecular markers, including: SEQ ID NO.1: 5'-GAGACGATGAGTGCTCACGA-3'; SEQ ID NO. 2: 5'-ACGTTGCCTTCATCTAGCC-3'.

[0007] Furthermore, the nucleotide sequence of the PCR amplification product fragment of the specific primers is shown in SEQ ID NO.3, and the SNP molecular marker is located at the 86th bp in the sequence, where the base type of R is A or G, resulting in different low temperature phenotypes of rice.

[0008] SEQ ID NO.3: GAGACGATGAGTGCTCACGAACTCGAGCCCGATGCCGCGGGACGCGCCCTGCACCATGGACACGCCGCCGCCGGATGTCGCCGTC R ACGAGAACGCCCTCGCCGCCGCCGCCGCAGCCGCCAGCGTCCTCGCCGTCGCCATTGCTCCTCCTCTCGCCTCGATTCGATTCTCTTCCTCCGGGTGCTCGCGGCGGTTCGGTGGCGAGGCGAGGCGCACAGGGGCAGTAATGGCGGGTCGTTGTTGTGGGGGAAATTTTGGGGGAGAATTGCGTGGCTAGATGAAGGCACACGT Furthermore, the method for screening SNP molecular markers related to the hypoxia tolerance trait of rice is specifically as follows: Perform SNP detection on several rice samples; The detected SNPs were used to perform genome-wide association analysis on rice samples, and a SNP molecular marker that was tightly linked to the hypoxia tolerance trait of rice was obtained. The SNP molecular marker was from the exon of the LOC_Os12g41590 gene, located at the 25740898 bp position of rice chromosome 12, and the base was A or G.

[0009] The third aspect of the present invention provides a kit for SNP markers related to the hypoxia tolerance trait of rice, comprising the above-mentioned specific primers.

[0010] The fourth aspect of the present invention provides the use of the SNP molecular marker, the specific primer or the kit in identifying the hypoxia tolerance trait of rice.

[0011] Furthermore, the base type of the SNP molecular marker related to the rice hypoxia tolerance trait in the rice sample to be tested is detected, and the hypoxia tolerance of the G base type rice is stronger than that of the A base type rice.

[0012] The fifth aspect of the present invention provides the use of the SNP molecular markers related to the hypoxia tolerance trait of rice, the specific primers or the kit in genetic breeding.

[0013] The SNP molecular marker in the present invention is located in the exon of the LOC_Os12g41590 gene. LOC_Os12g41590 is an oxidoreductase, which is involved in the abiotic stress response of plants and may respond to hypoxia stress.

[0014] Specifically, taking the cultivation of new varieties of hypoxia-resistant rice as an example, the LOC_Os12g41590 gene (the base type of the SNP molecular marker is G) containing strong hypoxia resistance can be transferred into rice varieties through genetic engineering to improve the hypoxia resistance of rice. The SNP site of the LOC_Os12g41590 gene (the base type of the SNP molecular marker is A) in hypoxia-sensitive rice can also be subjected to site-directed mutation to transform it into a new variety of hypoxia-resistant rice. The sixth aspect of the present invention provides a method for identifying or assisting in identifying the hypoxia resistance of rice, the method specifically comprising: detecting whether the genotype at position 25740898 of chromosome 12 of the tested rice is an A / A genotype or a G / G genotype: the hypoxia resistance of the tested rice with the G / G genotype is stronger than that of the tested rice with the A / A genotype;

[0015] The A / A genotype is a homozygous body in which the deoxyribonucleotide at position 25740898 of chromosome 12 of the rice genome is all A; the G / G genotype is a homozygous body in which the deoxyribonucleotide at position 25740898 of chromosome 12 of the rice genome is all G.

[0016] Further, the method for detecting whether the genotype at position 25740898 of chromosome 12 of the tested rice is an A / A genotype or a G / G genotype comprises the following steps: 1) Extracting genomic DNA from the rice sample to be tested; 2) using the genomic DNA of the rice sample to be tested as a template, and using the specific primers of the SNP molecular marker related to the hypoxia tolerance trait of rice to perform PCR amplification reaction to obtain an amplified product fragment; 3) Detecting the base type at the SNP molecular marker associated with the rice hypoxia tolerance trait in the PCR amplification product fragment.

[0017] Furthermore, the step (3) is specifically as follows: The base type at the 86th bp of the PCR amplification product fragment was detected. The hypoxia tolerance of G-base type rice was stronger than that of A-base type rice.

[0018] By adopting the above technical solution, the present invention has the following beneficial effects: The method of using whole genome association analysis of the present invention provides a SNP molecular marker that is extremely significantly correlated with the hypoxia resistance of rice, based on the significant association between the sequence polymorphism of LOC_Os12g41590 and the hypoxia resistance of rice, that is, the presence of a SNP molecular marker related to the hypoxia resistance of rice in the gene, and uses the SNP molecular marker as an auxiliary selection marker for hypoxia resistance in the rice breeding process, thereby improving the accuracy of selection and accelerating the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is a frequency histogram of the hypoxia germination rate trait of the rice test population identified in Example 1; Figure 2 is the Manhattan plot of the genome-wide association analysis of the rice hypoxia germination rate trait in Example 1; Figure 3 is a box plot of the germination rate of samples with different genotypes at the Chr12:25740898 locus of the LOC_Os12g41590 gene in Example 1; Figure 4 is a schematic diagram of the position of the SNP site; Figure 5 This is the base peak diagram of the sequencing results of 10 rice materials collected in Example 2. DETAILED DESCRIPTION

[0020] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the materials, reagents, etc. used in the examples can be obtained from commercial sources.

[0021] Example 1: Acquisition and identification of SNP molecular markers tightly linked to hypoxia germination of rice 1. Obtaining SNP molecular markers tightly linked to hypoxia germination in rice 1. This experiment selected 208 rice varieties from the China National Rice Research Institute.

[0022] 2. 208 materials, each material has 2 biological replicates, and 15 seeds are taken from each replicate (empty seeds, shriveled seeds and moldy seeds are picked out, and the seeds are placed in a 42℃ oven for 3 days before the experiment). The seeds are soaked in 5% NaClO for surface disinfection for 15 minutes, and then rinsed thoroughly with distilled water. The disinfected seeds are soaked in a 13cm deep all-black plastic container, filled with distilled water and tightly covered with a lid to create a flooded and hypoxic environment, and placed in a culture room at 28˚C for germination. Set dark conditions to simulate the natural dark conditions under the soil during the germination period of rice. Take out after 10 days of culture, measure the germination rate, fresh weight of coleoptile, coleoptile length and mesocotyl length, and use them for genome-wide association analysis (GWAS).

[0023] 3. Use GEMMA software (https: / / www.xzlab.org / software.html) to perform genome-wide association analysis. Use a mixed linear model for analysis and use the population structure and the kinship matrix between materials as covariates. Combine the genotype and phenotypic values ​​to calculate the statistical test value P of the SNP. Use P<0.001 as the standard to screen genetic loci related to phenotypic traits. In order to further analyze the significant SNPs with a close distance, the significant SNPs with a distance of ≤ 200kb were merged, and the most significant SNP in the interval was selected as a QTL. Query candidate genes within 200kb upstream and downstream of the QTL. A SNP site significantly associated with the hypoxia germination of rice was discovered through genome-wide association analysis. The SNP site is located at position 25740898 on chromosome 12 of rice, which is also the 86th position of SEQ ID NO.3 (such as Figure 4 When the SNP is G, the seedling germination rate is higher, that is, it has stronger hypoxia germination ability. When the SNP is A, the seedling germination rate is lower, that is, the hypoxia germination ability is poor.

[0024] The frequency histogram of the hypoxia germination rate trait of the rice test population identified in this embodiment is as follows: Figure 1 The Manhattan plot of the genome-wide association analysis of rice hypoxia germination rate traits is shown in Figure 2 As shown in the figure, the germination rate box plot of different genotype samples of rice hypoxia tolerance SNP loci is as follows Figure 3 shown.

[0025] 4. Primers were designed for the SNP sites obtained in step 3. The primer sequences are as follows: SEQ ID NO.1: 5'-GAGACGATGAGTGCTCACGA-3'; SEQ ID NO.2: 5'-ACGTTGCCTTCATCTAGCC-3' 2. Methods for identifying rice hypoxia tolerance based on SNP molecular markers The method for identifying the hypoxia tolerance of the rice to be tested based on SNP molecular markers is to detect whether the base type of the SNP site (25740898th position of chromosome 12) in the rice to be tested is A or G: the hypoxia tolerance of the G base type rice is stronger than that of the A base type rice. The G base type rice is a homozygous body with the deoxyribonucleotide at the 25740898th position of chromosome 12 of the rice genome as G; the A base type rice is a homozygous body with the deoxyribonucleotide at the 25740898th position of chromosome 12 of the rice genome as A.

[0026] The specific steps of detecting whether the base type of the SNP site (position 25740898 of chromosome 12) in the rice to be tested is A or G are as follows: extract rice genomic DNA, use the genomic DNA as a template, use SEQ ID NO.1 and SEQ ID NO.2 for PCR amplification, and obtain PCR amplification products: sequence the PCR amplification products, and determine whether the base type of the SNP site of the rice to be tested is A or G based on the sequencing results.

[0027] Example 2: Application of SNP molecular markers tightly linked to rice hypoxia germination 1. Base type detection Another 10 rice materials were selected as the rice to be tested, and the base types of the rice to be tested were detected according to the method in step 2 of Example 1.

[0028] The results are shown in Table 1. Among the 10 rice materials, 5 materials have a base type of A at the SNP site, and 5 materials have a base type of G at the SNP site. It was also found that the average hypoxia germination rate of the rice materials with a base type of G at the SNP site was 100%, and the average hypoxia germination rate of the rice materials with a base type of A was 68%, and the difference between the two was extremely significant. The results show that the seedling germination rate of the rice materials with a base type of G at the SNP site is significantly higher than that of the rice materials with a base type of A, indicating that the hypoxia germination ability of the rice materials with a base type of G is significantly stronger than that of the rice materials with a base type of A. The present invention further proves that the SNP site can be used as an effective genetic marker in rice molecular marker-assisted selection to improve the hypoxia germination characteristics of rice and accelerate the breeding process of direct-seeded rice.

[0029] The base peak diagram of the sequencing results of 10 rice materials is as follows Figure 5 shown.

[0030] Table 1 Hypoxia phenotypes of 10 rice materials Material No. Germination rate Fresh weight(g) Bud length (cm) Mesocotyl length (cm) Base type QC53 100% 0.374 13.34 2.89 G QC98 100% 0.581 12.14 2.22 G QC109 100% 0.597 10.38 2.65 G QC99 100% 0.663 9.43 2.25 G QC23 100% 0.348 7.16 2.96 G QC95 70% 0.021 0.885 0.241 A QC3 70% 0.123 2.604 0.000 A QC117 70% 0.098 2.177 0.263 A QC198 65% 0.124 1.375 0.461 A QC137 65% 0.114 2.098 0.294 A The embodiments of the present disclosure have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

[0031] The above are only optional embodiments of the present disclosure and are not intended to limit the present disclosure. For those skilled in the art, the present disclosure may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. A SNP molecular marker related to hypoxia tolerance in rice, characterized in that: The SNP molecular marker comes from the exon of the LOC_Os12g41590 gene, is located at 25740898 bp of rice chromosome 12, and the base is A or G; the rice variety with a genotype of G / G at the SNP molecular marker site has stronger hypoxia tolerance than the rice variety with a genotype of A / A at the site.

2. A specific primer for detecting the SNP molecular marker related to the hypoxia tolerance trait of rice according to claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

3. The specific primer according to claim 2, characterized in that The nucleotide sequence of the PCR amplification product fragment of the specific primers is shown in SEQ ID NO.3, and the SNP molecular marker is located at the 86th bp in the sequence.

4. A kit for SNP markers related to hypoxia tolerance in rice, characterized in that: Comprising the specific primers as described in claim 3.

5. Use of the SNP molecular marker associated with the hypoxia tolerance trait of rice according to claim 1, the specific primer according to any one of claims 2 to 3, or the kit according to claim 4 in identifying the hypoxia tolerance of rice.

6. The use according to claim 5, characterized in that: The application is specifically: The base types of SNP molecular markers related to the hypoxia tolerance trait of rice in the tested rice samples were detected. The hypoxia tolerance of G base type rice was stronger than that of A base type rice.

7. Use of the SNP molecular marker associated with the hypoxia tolerance trait of rice according to claim 1, the specific primer according to any one of claims 2 to 3, or the kit according to claim 4 in rice genetic breeding.

8. A method for identifying or assisting in identifying the hypoxia tolerance of rice, characterized in that: The method comprises the following steps: detecting whether the genotype at position 25740898 of chromosome 12 of the tested rice is an A / A genotype or a G / G genotype; the tested rice with the G / G genotype has a stronger hypoxia tolerance than the tested rice with the A / A genotype.

9. The method according to claim 8, characterized in that The method for detecting the genotype of position 25740898 of chromosome 12 of the tested rice comprises the following steps: (1) extracting genomic DNA from the rice sample to be tested; (2) using the genomic DNA of the rice sample to be tested as a template, performing a PCR amplification reaction using specific primers to obtain an amplified product fragment; the nucleotide sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; (3) The base type of the SNP molecular marker related to the hypoxia tolerance trait of rice in the PCR amplification product fragment was detected. The hypoxia tolerance of G base type rice was stronger than that of A base type rice.

10. A method for screening SNP molecular markers related to the hypoxia tolerance trait of rice as claimed in claim 1, characterized in that: The method comprises the following steps: SNP detection was performed on multiple rice samples; the detected SNPs were used to conduct whole-genome association analysis on the rice samples, and a SNP molecular marker that was tightly linked to the rice's hypoxia tolerance trait was obtained.

Images