Construction method and application of wheat rapid generation adding system

Abstract

The invention belongs to the technical field of crop breeding, and particularly relates to a construction method and application of a wheat rapid generation adding system, the construction method comprises the following steps: S1, taking young ears after flowering of wheat crops, stripping seed immature embryos, disinfecting and sterilizing, then inoculating the seed immature embryos into an induction culture medium, and performing dark culture to germinate the seed immature embryos to obtain seed immature embryos; then culturing under illumination until embryo seedlings grow; s2, transplanting the embryo seedlings into a planting pot, and performing seedling recovery or vernalization treatment; s3, transferring the embryo seedlings into an artificial climate chamber, and culturing until the plants bloom; wherein the temperature and illumination conditions are as follows: in a seedling stage, darkness at 20 DEG C is performed for 6 hours, illumination at 25 DEG C is performed for 18 hours, and the operation is performed alternately From the jointing stage to the mature stage, darkness at 22 DEG C is performed for 6 h, illumination at 28 DEG C is performed for 18 h, and operation is performed alternately. According to the construction method disclosed by the invention, the breeding time and the growth cycle of the wheat crops are greatly shortened, meanwhile, normal development and fruiting of the crops are ensured, and the breeding process of good varieties is greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of crop breeding, and in particular to a construction method of a wheat rapid generation system and application thereof. Background Art

[0002] The continued growth of population and environmental changes have posed a more severe challenge to global food security. Scientists from various countries are constantly working to improve crops to increase crop yields and safety, but the improvement rate of several important crops is currently insufficient to meet actual needs. The slow speed of obtaining improved varieties using traditional breeding methods is partly due to the long growth cycle of wheat. In the current hybrid breeding process of barley or wheat, the offspring materials produced by hybrid breeding generally have a full field growth period of 180-270 days, and can only be planted in the field for one generation per year. It usually takes 5-7 generations of self-pollination or backcrossing to obtain a genetically stable (trait gene homozygous) population for evaluating agronomic traits and yields. Therefore, it often takes several years to obtain new varieties. How to shorten the long breeding cycle of hybrid breeding of wheat crops, accelerate the breeding process, and improve the efficiency of new variety selection is an important topic in rapid breeding research.

[0003] Plant biologists and breeders have been looking for ways to accelerate the acquisition of improved varieties. For example, using natural environments with suitable climatic conditions for off-site generation, such as breeding in the north wheat region in the south in winter, obtaining the next generation of wheat or barley by using different latitudes or altitudes or "off-season", and another example is using shuttle breeding to obtain the next generation of wheat or barley. However, the above methods can only achieve 2-3 generations of wheat or barley per year.

[0004] One of the key factors limiting the progress of crop breeding and genetic research is the time required to produce "pure line" segregating populations. After two homozygous lines are crossed, six generations of self-pollination are required to produce 98.4% homozygous offspring. Barley and wheat are both important food crops in my country. In order to meet the needs of barley and wheat breeding and genetic research, pure line offspring need to be produced quickly. During the growth and development of barley and wheat, they mainly undergo the transition of five important stages: seedling stage, jointing stage, heading stage, flowering stage and maturity stage. Developing a rapid generation method that shortens the development time of each stage while ensuring the offspring's fruit set rate or number of grains per ear is of great significance for studying the gene function of wheat and accelerating breeding. Summary of the invention

[0005] In view of the above problems in the prior art, the present invention provides a method for constructing a rapid generation system for wheat, and provides the application of the wheat generation system prepared by the construction method in constructing a wheat near-isogenic line. The construction method of the present invention ensures that the growth cycle of wheat crops is shortened while ensuring the normal development and fruiting of crops, which is conducive to improving the breeding process of excellent varieties.

[0006] To achieve the above object, the present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a method for constructing a rapid generation system for wheat, comprising the following steps:

[0008] S1. Take young ears of wheat crops after flowering, peel out seed embryos, disinfect and sterilize them, then inoculate the seed embryos into an induction medium, culture them in the dark to allow the seed embryos to germinate, and then culture them under light until they grow into embryo seedlings;

[0009] S2, transplanting the embryo seedlings into planting pots and performing seedling hardening or vernalization treatment;

[0010] S3, transferring the embryo seedlings after the slow seedling or vernalization treatment to an artificial climate room for cultivation until the plants bloom; wherein the temperature and light conditions are:

[0011] Seedling stage: 20℃ dark for 6h, 25℃ light for 18h, alternating;

[0012] From jointing stage to maturity stage: 22℃ darkness for 6h, 28℃ light for 18h, alternating.

[0013] Furthermore, in step S1, the embryo age of the seed immature embryo is 10-16 days, and further, 12-14 days.

[0014] Further, in step S1, the induction medium includes a basic culture solution, 5 g / L malt extract, 0.5 mg / L NAA, 0.15 mg / L 6-BA, 30 g / L sucrose and 7 g / L agar, wherein the basic culture solution includes 2800 mg / L KNO3, 460 mg / L (NH4)2SO4, 400 mg / L KH2PO4, 185 mg / L MgSO4·7H2O, 165 mg / L CaCl2·2H2O, 0.415 mg / L KI, 3.1 mg / L H3BO3, 11.15 mg / L MnSO4·4H2O, 4.3 mg / L ZnSO4·7H2O, 0.125 mg / L Na2MoO4·2H2O, 0.0125 mg / L CuSO4·5H2O, and 0.065 mg / L CoCl2·6H2O. 0.0125mg / L, Na2·EDTA18.65mg / L, FeSO4·4H2O 13.9mg / L, Glycine 1mg / L, VB10.5mg / L, VB60.25 mg / L and VPP0.25mg / L.

[0015] Furthermore, in step S1, the dark culture temperature is 4°C and the time is 5 days.

[0016] Furthermore, in step S1, the culture conditions of the embryo seedlings include: 25° C., 1000 lux light intensity and 24 h light for 10-14 days.

[0017] Further, in step S2, when the wheat crop is a spring variety, the embryo seedlings are transplanted into planting pots, kept at a constant temperature of 20°C and away from light for 3-4 days to accelerate the growth of the seedlings, and watered with 1× Hoagland nutrient solution during the period of acclimatization; when the wheat crop is a weak winter variety, the embryo seedlings are transplanted into planting pots, kept at a constant temperature of 20°C and away from light for 3-4 days to accelerate the growth of the seedlings, and watered with 1× Hoagland nutrient solution during the period of acclimatization, and then transferred to an artificial climate room for cultivation, and after growing to the three-leaf stage, they are vernalized for 10-14 days at 8°C, 200lux light intensity and 24h light.

[0018] Furthermore, the volume of the planting pot is 7cm×7cm×8cm, and one embryo seedling is transplanted into each planting pot.

[0019] Furthermore, the composite soil in the planting pot is a mixture of loess, organic matrix and gravel in a volume ratio of 4:2:1.

[0020] Furthermore, in step S3, the light source in the artificial climate chamber uses an LED lamp as a light source, and the ratio of red light to blue light of the light source is 7:1.

[0021] The second aspect of the present invention provides the use of the method for constructing a rapid generation system for wheat as described above in constructing a near-isogenic line of wheat.

[0022] The third aspect of the present invention provides a method for constructing a wheat near-isogenic line, comprising the following steps: using the method for constructing a wheat rapid generation system as described above to perform generation culture, and using auxiliary molecular marker technology to screen the genotype of each generation of plants.

[0023] The advantages and positive effects of the present invention are:

[0024] The invention inoculates seed embryos into an induction medium for dark cultivation to induce rapid germination, then cultivates seedlings under light, performs seedling acclimatization or vernalization treatment to make the embryos transition from vegetative growth to reproductive growth, and finally cultivates seedlings through suitable temperature and light cycle, thereby greatly shortening the propagation time and growth cycle of wheat crops. The growth cycle of conventional wheat crops is shortened to 69-88 days, and 4-5 generations are achieved in one year. Meanwhile, normal development and fruiting of crops are ensured, and the number of grains in wheat ears of mature crops can reach 20.7-51, which is not much different from that of field planting, thereby greatly improving the breeding process of excellent varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 The germination of different explants in Example 1 of the present invention at the same time, wherein Figure A shows the germination of the whole young seed at 3 days after inoculation, Figure B shows the germination of the young embryo with half of the endosperm at 3 days after inoculation, and Figure C shows the germination of the young embryo of the whole seed in vitro at 3 days after inoculation;

[0027] Figure 2 This is the effect of the young spikelets stored at different storage temperatures for 4 days on the germination of the young embryos of seeds in Example 1 of the present invention, wherein the storage temperature in Figure A is -20°C, and the storage temperature in Figure B is 4°C;

[0028] Figure 3 The diagram is a development cycle diagram of the rapid generation culture of wheat crops in Example 2 of the present invention, wherein Figure A shows the growth status of Yangmai 18 immature embryos 2-5 days after inoculation, and from right to left they are 2d, 3d, 4d, and 5d, Figure B shows Yangmai 22 seedlings cultured for 7 days, Figure C shows the seedling stage after transplanting, Figure D shows spring barley at the heading stage, Figure E shows spring wheat (left) and weak winter wheat (right) at the heading stage, and Figure F shows wheat in flowering and fruiting;

[0029] Figure 4 This is a graph showing the PCR detection results of the target gene in the backcross progeny of Example 1 of the present invention, wherein lane M is D2000Marker, lane B is the parent Buloke, and lane V is the parent VVY; lanes 1, 4, and 12 are negative plants, and the remaining lanes are positive plants. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0031] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0032] In order to better understand the present invention rather than limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to represent dosage, percentage, etc., should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by conventional rounding methods. In addition, it should be noted that the meaning of the terms "including", "comprising", "containing", "having" and the like is non-restrictive, and other steps and other ingredients that do not affect the results can be added.

[0033] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below.

[0034] The embodiment of the present invention provides a method for constructing a rapid generation system for wheat, comprising the following steps:

[0035] S1. Take young ears of wheat crops after flowering, peel out seed embryos, disinfect and sterilize them, then inoculate the seed embryos into an induction medium, culture them in the dark to allow the seed embryos to germinate, and then culture them under light until they grow into embryo seedlings;

[0036] S2, transplanting the embryo seedlings into planting pots and performing seedling hardening or vernalization treatment;

[0037] S3, transferring the embryo seedlings after the seedling hardening or vernalization treatment to an artificial climate room and culturing them until the plants bloom; wherein the temperature and light conditions are:

[0038] Seedling stage: 20℃ dark for 6h, 25℃ light for 18h, alternating;

[0039] From jointing stage to maturity stage: 22℃ darkness for 6h, 28℃ light for 18h, alternating.

[0040] As an important environmental factor, light is not only the direct energy source for photosynthesis in plants, affecting the structure and function of photosynthetic organs, but also the key information source for plants to regulate their entire growth and development. Light intensity and ambient temperature directly affect the intensity of photosynthesis, and will also affect changes in plant morphology and anatomical structure. Changes in light and temperature are crucial to plant growth and development (including flower bud differentiation, flowering, and fruiting) as well as physiological processes such as photosynthesis. Choosing the right light time / cycle and growth temperature can ensure better plant growth and will also affect the flowering time, quality, and duration of the flowering period. In order to make the plants reproduce quickly, the present invention studies the development cycle and grain number of wheat crops under light temperature of 16-30°C and dark temperature of 10-25°C and different light cycles, and finds that when the culture conditions in the seedling stage are 20°C dark for 6h and 25°C light for 18h, and the culture conditions in the jointing stage and thereafter (including the jointing stage, booting stage, heading stage, flowering stage, filling stage and maturity stage) are 22°C dark for 6h and 28°C light for 18h, the growth cycle can be greatly shortened, and the growth cycle of conventional wheat crops can be shortened to 69-8 8d, significantly speeding up the breeding speed, and will not affect the development and normal fruiting of wheat ears, and the number of grains of wheat ears of mature crops can reach 20.7-51 grains; when the light temperature is higher or the light time is longer than the aforementioned culture conditions, although the breeding process is shortened to a certain extent, it will lead to higher plant height and thinner stems, abnormal plant growth and development, and reduce the fruiting rate, and when the light temperature is lower or the light time is shorter than the aforementioned culture conditions, on the one hand, the growth cycle is prolonged, and on the other hand, it will cause abnormal development of wheat ears, which also affects the fruiting rate. In general, the present invention inoculates seed embryos into an induction medium for dark culture to induce rapid germination, then cultivates seedlings under light, and then undergoes seedling retardation or vernalization treatment to make the embryo seedlings transition from vegetative growth to reproductive growth, and finally cultivates seedlings through appropriate temperature and light cycle. The synergistic effect of temperature and light intensity shortens the development cycle to a large extent while ensuring the normal development of crops, and can achieve 4-5 generations within a year, and obtain a number of grains per ear that is not much different from field planting, greatly improving the breeding process of excellent varieties.

[0041] Optionally, in step S1, the embryo age of the seed immature embryo is 10-16d, preferably 12-14d. The embryo age refers to the time after the crop blooms, and after flowering and fertilization, grain filling begins, and the seed embryo begins to develop. The embryo extraction time of the seed immature embryo is one of the key points of immature embryo culture. The present invention selects the embryo age of immature embryo culture as 10-16d through a large number of studies, among which the immature embryo of 12-14d is most suitable. When the embryo age of the immature embryo is less than 10 days, the immature embryo is transparent and very small, the seedling is weak, and the seedling rate is low; when the embryo age is greater than 16 days, the seed will become hard, increase the difficulty of embryo extraction and damage the immature embryo, and inhibit the germination speed of the immature embryo, and some varieties may not even germinate to form seedlings; when the embryo age of the immature embryo is greater than 30 days, the grain hardness is high and the endosperm is relatively sticky, which is not conducive to the peeling of the immature embryo.

[0042] Optionally, in step S1, the induction medium (pH 5.7) includes: basic culture solution, malt extract 5g / L, NAA 0.5mg / L, 6-BA 0.15mg / L, sucrose 30g / L and agar 7g / L, wherein the basic culture solution components include: KNO3 2800mg / L, (NH4)2SO4 460 mg / L, KH2PO4 400mg / L, MgSO4·7H2O 185mg / L, CaCl2·2H2O 165mg / L, KI 0.415mg / L, H3BO3 3.1mg / L, MnSO4·4H2O 11.15mg / L, ZnSO4·7H2O 4.3mg / L, Na2MoO4·2H2O 0.125mg / L, CuSO4·5H2O 0.0125mg / L, CoCL2·6H2O 0.0125mg / L, Na2·EDTA 18.65mg / L, FeSO4·4H2O 13.9mg / L, Glycine 1mg / L, VB10.5mg / L, VB60.25 mg / L and VPP0.25mg / L. The invention can promote seed embryo germination, root system development and seedling growth by adding exogenous additives such as malt extract, which is beneficial to shortening the culture period.

[0043] Optionally, in step S1, the dark culture temperature is 4°C and the time is 5 days, that is, the seed embryos are inoculated into the induction medium and cultured in the dark at 4°C for 5 days.

[0044] Optionally, in step S1, the culture conditions for culturing the germinated seed embryos to grow them into seedlings include: 25° C., 1000 lux light intensity and 24 h light for 10-14 days.

[0045] Optionally, in step S2, when the wheat crop is a spring variety, the embryo seedlings are transplanted into planting pots, and the seedlings are grown at a constant temperature of 20°C in the dark for 3-4 days, during which time 1× Hoagland nutrient solution is irrigated; when the wheat crop is a weak winter variety, the embryo seedlings are transplanted into planting pots, and the seedlings are grown at a constant temperature of 20°C in the dark for 3-4 days, during which time 1× Hoagland nutrient solution is irrigated, and then the seedlings are transferred to an artificial climate room for cultivation. The culture conditions are the same as those in the seedling stage, that is, 20°C in the dark for 6 hours, 25°C in light for 18 hours, alternating between the two. After the seedlings grow to the three-leaf stage, they are vernalized for 10-14 days at 8°C, 200lux light intensity, and 24h light.

[0046] The volume of the planting pots described above is 7cm×7cm×8cm, and one embryo seedling is transplanted into each planting pot.

[0047] Optionally, the composite soil in the planting pot is a mixture of loess, organic matrix and gravel in a volume ratio of 4:2:1, wherein the organic matrix is ​​purchased from Zhongnong Saishi, and the registration number is Microbial Fertilizer (2016) Standard No. (1887). It should be noted that during the planting process, conventional fertilization can be performed.

[0048] Optionally, in step S3, the light source in the artificial climate chamber uses an LED lamp as the light source, and the red-to-blue light ratio of the light source is 7:1. The shorter the wavelength of the spectrum, the greater the energy contained. In photosynthesis, the capture and transmission of light energy are related to the light-collecting pigment protein complex. The present invention compares the artificial lighting effect of a metal halide lamp plus a sodium lamp with that of an LED lamp on plants, and investigates the relevant phenotypic traits and dry matter accumulation of wheat seedlings. Experiments show that LED lamps with a red-to-blue ratio of 7:1 can better promote the growth of plants in the seedling stage. The light intensity can be the conventional light intensity required for wheat culture, and the present invention does not make any special limitations.

[0049] Another embodiment of the present invention provides the use of the method for constructing a rapid generation system for wheat as described above in constructing a near-isogenic line of wheat.

[0050] The above-mentioned method for constructing a wheat rapid generation system is used for rapid generation culture, and the seed embryos of the 10th to 16th day after flowering are used to repeatedly breed offspring, and the auxiliary molecular marker technology is combined to screen plants homozygous for the target trait. The present invention realizes the construction of a wheat rapid generation system and a wheat near-isogenic line that can reproduce wheat crops for up to 5 generations each year by coordinating the embryo culture with the light intensity, light duration and temperature.

[0051] Based on the same inventive concept, an embodiment of the present invention also provides a method for constructing a near-isogenic line of wheat, comprising the following steps: using the method for constructing a rapid generation system of wheat as described above to perform rapid generation cultivation, and using auxiliary molecular marker technology to screen the genotype of each generation of plants.

[0052] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0053] The test materials in the following examples include: 1) spring wheat: Yangmai 18 (material properties see the literature: Lu Chengbin, Zhang Boqiao, Gao Derong, et al. New wheat variety resistant to scab - Yangmai 18 [J]. Journal of Wheat Crops, 2010 (1): 1.) and Yangmai 22 (material properties see the literature: Wu Hongya, Zhang Boqiao, Gao Derong, et al. New high-quality weak-gluten wheat variety resistant to powdery mildew - Yangmai 22 [J]. Journal of Wheat Crops, 2014 (6): 876-876.); 2) weak winter wheat: Dabaipi (material properties see the literature: Ding Yanhong, Liu Huan, Shi Lihong, et al. Analysis of leaf rust resistance of 28 wheat micro-core germplasms [J]. Acta Agronomica Sinica, 2010, 36 (7): 1126-1134.) and Baiqitou (material properties see the literature: Fu Baojian . Identification of stripe rust resistance and SSR genetic diversity analysis of 95 wheat farmer varieties [D]. Hebei Agricultural University, 2008.); 3) Spring barley: Yangnongpi No. 8 (material properties see the literature: Chang Lei, Jiang Ying, Xie Jixian, et al. Effects of different sowing dates on the growth process, yield and quality of Yangnongpi No. 8 wheat seedlings [J]. Seed Science and Technology, 2021.) and Zhejiang Pi 33 (material properties see the literature: Yang Jianming. New beer barley variety "Zhejiang Pi 33" [J]. China Agricultural Science and Technology Herald, 2009 (S2): 1.); the above materials can be purchased from the Seed Industry Network (link: http: / / www.a-seed.cn / html / 2016 / shendingpinzhong_0126 / 13013.html)

[0054] The induction medium (pH 5.7) for in vitro culture of immature embryos includes: basic culture medium, malt extract 5g / L, NAA 0.5mg / L, 6-BA 0.15mg / L, sucrose 30g / L and agar 7g / L. The composition of the basic culture medium is shown in Table 1.

[0055] Table 1. Formula ratio of basic culture fluid

[0056]

[0057] The composite soil in the planting pot is a mixture of loess, organic matrix and gravel in a volume ratio of 4:2:1. The organic matrix is ​​commercially available, specifically purchased from Zhongnong Saishi, with the registration number of Microbial Fertilizer (2016) Standard No. (1887). Hogland nutrient solution was purchased from McLean, with the item number H931416.

[0058] Example 1 Method for constructing a rapid generation system for wheat

[0059] A method for constructing a rapid generation system for wheat, comprising the following steps:

[0060] S1. Take young ears of wheat crops after flowering, peel out seed embryos, disinfect and sterilize them, then inoculate the seed embryos into an induction medium, culture them in the dark to allow the seed embryos to germinate, and then culture them under light until they grow into embryo seedlings;

[0061] S2, transplanting the embryo seedlings into planting pots and performing seedling hardening or vernalization treatment;

[0062] S3. Transfer the embryo seedlings after the seedling hardening or vernalization treatment to an artificial climate room and culture them until the plants bloom; wherein the temperature and light conditions in the artificial climate room are as follows: seedling stage: 20°C dark for 6 hours, 25°C light for 18 hours, alternating; jointing stage to maturity stage: 22°C dark for 6 hours, 28°C light for 18 hours, alternating; the light source is an LED lamp with a red to blue ratio of 7:1.

[0063] 1. Exploration of in vitro culture system of seed embryos

[0064] Disinfection and inoculation of seed embryos: Select healthy wheat ears with the same flowering period for marking, take young ears 12-14 days after flowering, then peel off the middle spikelets and florets, disinfect the seeds with 75% alcohol for 30 seconds, disinfect with 0.1% mercuric chloride for 8-15 minutes, wash with sterile water 3-5 times, inoculate the sterilized explants into the induction medium, and design three inoculation methods: 1) whole young seeds, 2) young embryos with half endosperm (seed embryos + 1 / 2 endosperm), 3) complete seed embryos. The inoculation method includes: taking the whole young seeds, young embryos with half endosperm, and complete seed embryos, disinfecting and rinsing them, and then inoculating them into the culture medium, culturing them in the dark at 4°C, and observing and comparing the germination under different inoculation methods every day.

[0065] See the germination of different explants at the same time. Figure 1 , among which, Figure A shows the germination of the whole young seed at 3 days after inoculation, Figure B shows the germination of the young embryo with half of the endosperm at 3 days after inoculation, and Figure C shows the germination of the young embryo of the in vitro seed at 3 days after inoculation. The results show that in the case of the inoculation of the whole young seed (i.e. the whole young seed), none of the experimental materials germinated; in the case of the inoculation with the endosperm and young embryo (young embryo with half of the endosperm) as explants, the germination rate can reach 40%, but the germination time is long, requiring 19-25 days; in the case of the inoculation with the young embryo of the in vitro seed as the explant, the germination rate can reach 100% in 5 days, and the germination speed is fast, and it can germinate in about 36 hours after inoculation.

[0066] Two storage temperatures were set for young wheat ears: 4°C and -20°C. The storage time was 4 days. The effects of different young ear storage temperatures on the germination of late embryos were compared. The results are shown in Figure 2 , among which, Figure A shows the germination of seed embryos after germination for 7 days at -20℃ storage, and Figure B shows the germination of seed embryos after germination for 7 days at 4℃ storage. The results show that after 4 days of short-term storage, the embryos at -20℃ storage temperature are inactive and cannot be induced into seedlings, while the embryos of seeds stored at 4℃ can germinate normally.

[0067] 2. Exploration of embryo culture system

[0068] Follow the following experimental steps to explore the light cycle and culture temperature:

[0069] (1) Seedlings: Healthy wheat ears with the same flowering period were selected for marking. Young ears 12-14 days after flowering were taken, and the seeds of the spikelets and florets in the middle were peeled off. The seeds were disinfected with 75% alcohol for 30 seconds, and then disinfected with 0.1% mercuric chloride for 8-15 minutes. They were washed with sterile water for 3-5 times, and the intact in vitro seed embryos were inoculated into the induction medium. They were cultured in the dark at 4°C for 5 days, and then cultured at 25°C, with a light intensity of 1000 lux and 24 hours of light per day for 10-14 days to induce seedlings.

[0070] (2) Seedling hardening and rapid vernalization process: For spring varieties, hardening treatment is performed. The embryonic seedlings that have been cultured for 10-14 days are transplanted into planting pots (pot volume 7cm×7cm×8cm), with one seedling planted in each pot. The seedlings are hardened at a constant temperature of 20℃ and away from light for 3-4 days, and irrigated with 1× Hoagland nutrient solution during the hardening period. For weak winter varieties, hardening is performed according to the above conditions first, followed by green body vernalization. The embryonic seedlings after hardening are transferred to an artificial climate room for culture. The culture conditions are the same as those for the seedling stage, that is, 20℃ in the dark for 6 hours and 25℃ in the light for 18 hours, alternating. After the seedlings grow to the three-leaf stage, they are vernalized for 10-14 days at a temperature of 8℃, a light intensity of 200lux and 24 hours of light per day.

[0071] The composite soil in the planting pot is a mixture of loess, matrix and gravel in a volume ratio of 4:2:1.

[0072] (3) Transfer the seedlings after the seedling hardening or vernalization treatment to the artificial climate room for cultivation. The cultivation conditions in the artificial climate room are: the temperature in the seedling stage is set to 20 / 25℃ (dark / light), 6 / 18h (dark / light), that is, 20℃ dark for 6h, 25℃ light for 18h, alternating; at the jointing stage, the temperature is relatively increased to 22 / 28℃ (dark / light), 6 / 18h (dark / light), that is, from the jointing stage to the maturity stage: 22℃ dark for 6h, 28℃ light for 18h, alternating, appropriate drought during the period, increase water pressure, and promote jointing. Pay attention to the management of insect diseases during the entire cultivation period.

[0073] In order to explore the effects of light cycle and culture temperature on the embryo development cycle, multiple experimental groups were set up at a light temperature of 16-25℃ and a dark temperature of 10-20℃, and the light cycle was controlled to be 6 / 18h (dark / light). The light source was an LED lamp with a red / blue ratio of 7:1, and the development cycle of wheat crops was used as the evaluation standard. The specific experimental design and results are shown in Table 2. The results show that the combination of experimental groups 1 and 5 has the shortest overall cycle, but due to the higher temperature of experimental group 5, it will lead to higher plant height and thinner stems. Therefore, in terms of plant growth and development, experimental group 6 is better than experimental group 5, and its plants can be normally strong and have more grains.

[0074] Table 2 Effect of culture temperature on embryonic development cycle

[0075]

[0076] In addition, the temperature was controlled at 20 / 25℃ (dark / light) during the seedling stage, and at 22 / 28℃ (dark / light) during the jointing stage and later, and the light cycle was adjusted to 12-20h light / 4-12h dark. Using the development cycle of wheat crops as the evaluation standard, it was found that 18h light and 6h darkness is a widely used and better light cycle for wheat crops, which can shorten the development cycle and ensure the normal development of wheat ears.

[0077] Follow the following experimental steps to explore the light source:

[0078] Yangmai 22, Yangmai 18 and Yangnongpi No. 8 were used as experimental materials. The seed embryo seedling and embryo seedling rapid vernalization process were the same as above. The temperature in the artificial climate room was set at 20℃, 6h dark light, 25℃, 18h light, and irradiated alternately. The morphological indicators of wheat seedlings were measured after the seedlings grew for 20 days. Two light source combinations were designed in the experiment. Combination 1: four metal halide lamps + two sodium lamps; combination 2: 6 groups of LED lights, red / blue light intensity ratio of 7:1, the light range can cover all planting materials. The main indicators measured are: plant height, stem diameter, aboveground dry mass, and underground dry mass. The plant height from the top to the base of the plant was measured with a ruler, the stem diameter at the base of the plant was measured with a vernier caliper, and the aboveground dry mass and underground dry mass of the plant were measured with a one-tenth of a balance and the root-crown ratio of the plant was calculated. The root-crown ratio = underground dry mass / aboveground dry mass. The specific results are shown in Table 3 below.

[0079] Table 3 Effects of different light sources on plant seedlings

[0080]

[0081] Note: Different letters for the same growth index of the same variety indicate significant differences among treatments (p<0.05).

[0082] Table 3 shows the effects of different lighting systems on various growth indicators of wheat and corn seedlings. Under the lighting conditions of combination 2, the plant height, stem diameter, aboveground dry mass and root-to-crown ratio of the three materials were higher than those of combination 1. The results showed that plants could accumulate more biomass under the irradiation of LED lights with a red-to-blue light ratio of 7:1.

[0083] Example 2 Method for constructing near-isogenic lines

[0084] Wheat: Yangmai 18, Yangmai 22, Dabaipi, Baiqitou, and barley: Yangnongpi No. 8 and Zhepi 33 were inoculated according to the optimized inoculation and storage method of Example 1. The intact seed embryos were used as explants for culture. The embryos of wheat and barley inoculated for 24-36 hours could germinate, and the leaf length could reach 3-5 cm (0.1-0.6 cm) after 5 days of dark culture. Figure 3 After that, the seedlings were cultured for 7 days at 25℃, 1000 lux and 24h light intensity, and all had 3 or more roots ( Figure 3 Figure B), after 10-14 days of cultivation, the seedlings can be transplanted for seedling hardening or vernalization treatment ( Figure 3 Then transfer to artificial climate room for cultivation, the temperature is 20 / 25℃ (dark / light), the light cycle is 6 / 18h (dark / light) during the seedling stage, the temperature is 22 / 28℃ (dark / light), the light cycle is 6 / 18h (dark / light) during the jointing stage and later, the heading rate of spring varieties can reach 100% ( Figure 3 Figure D), the heading rate of weak winter varieties can reach 100% after green body vernalization ( Figure 3 Middle E), the plants after heading can bloom and bear fruit normally ( Figure 3 (Fig. F in the middle), young panicles are taken 12-14 days after flowering to breed the second generation.

[0085] The growth and development cycle and number of grains per ear of the six wheat materials were statistically analyzed, and the results are shown in Table 4. In the above-mentioned rapid generation system, the one with the shortest cycle is Yangmai 22, which takes only 69 days from inoculation to sampling and breeding the second generation. The number of grains per ear reaches 32, which is not much different from the number of grains per ear harvested from normal field planting. Each plant can obtain 1-2 ears (i.e. tillers). Under ideal conditions, this variety can breed 5.2 generations a year. Among the wheat varieties, Baiqitou has the longest growth cycle, which takes 88 days from inoculation to sampling. This variety can breed 4.1 generations a year, and 51 grains can be harvested per ear in the rapid generation system. The four genotypes of wheat varieties can breed an average of 4.6 generations per year. Yangnongpi No. 8 takes 72 days from inoculation to sampling, can breed 4.6 generations per year, and can harvest 21 seeds per ear on average. The cycle time from inoculation to sampling for Zhejiangpi No. 33 is 75 days, can breed 4.9 generations per year, and can harvest 23 seeds per ear on average. When this variety is planted in the field, its growth cycle is about 160 days, and 28 seeds per ear are harvested on average. This shows that the rapid generation system established by the present invention can significantly shorten the plant growth cycle and harvest a normal number of grains per ear, which improves the success rate of subsequent hybridization and backcrossing processes of near-isogenic lines.

[0086] Table 4 Development cycle of different materials in the generation system

[0087]

[0088]

[0089] The radiation-induced mutant VVY of the Australian two-row beer barley variety Vlamingh and the Australian two-row beer barley Buloke (material properties see the literature: Wang R, Yang F, Zhang XQ, et al. Characterization of a thermo-inducible chlorophyll-deficient mutant inbarley [J]. Frontiers in Plant Science, 2017, 8: 1936.) were used as parents to verify the role of the generation system of the present invention in constructing near-isogenic lines. Among them, the radiation-induced mutant VVY of the Australian two-row beer barley variety Vlamingh has green leaves at room temperature and light yellow above 30°C. Buloke is an Australian two-row beer barley with evergreen leaves, similar maturity to Vlamingh, and excellent agronomic traits and yield. The above two materials are now stored in this research group.

[0090] Using VVY, whose agronomic trait is high temperature sensitive yellow leaves, as the donor material, Buloke with excellent agronomic traits and consistent maturity period is hybridized, and the young spikelets after flowering and fertilization are taken, and the seed embryos are peeled out, and the wheat rapid generation system construction method of Example 1 is used for cultivation until the F1 generation plant blooms, and then the F1 generation plant is used as the female parent, and backcrossed with the recurrent parent Buloke, and the young spikelets 10-14d after flowering and fertilization are taken, and the seed embryos are peeled out, and the aforementioned process is repeated for three generations of continuous backcrossing. The traditional emasculation bag hybridization method is adopted, and 14 florets are emasculated per ear of the female parent, and the florets at both ends are taken out, and the middle part is selected for emasculation. The cultivation method of each generation of plants backcrossed during the period is cultivated by the construction method of the wheat rapid generation system of Example 1.

[0091] The CTAB method was used to quickly extract the genomic DNA of each generation of plants. Primers were designed based on the fine positioning results of the high temperature sensitive yellow leaf gene vvy. Phenotypic investigation and PCR detection were performed on hybrid F1 and backcross generation plants (BC1F1-BC3F1). Plants containing the target gene vvy were screened and amplified using standard PCR. The PCR products were electrophoresed on 2.5% agarose gel. The primers used in PCR detection were:

[0092] Primer-F:GGCTGTATGTGGTACGAAAATG;

[0093] Primer-R: AAAACGCCCTACTCATGTTGAT.

[0094] The reaction system for PCR amplification was: dd H2O 1.2μL, 10× reaction buffer 1.0μL, dNTP 0.3μL, MgCl2 (50mM) 0.4μL, Creosol Red (10% sol) 3.0μL, Primer-F (10μmol) 1.0μL, Primer-R (10μmol) 1.0μL, Taq enzyme (5U / μL) 0.04μL and DNA 1.4μL. The program for PCR amplification was: Step 1: 95℃, 3min; Step 2: 95℃, 30s, Step 3: 56℃, 30s, Step 4: 72℃, 30s (Step 2-Step 4, 34 cycles); Step 5: 72℃, 7min.

[0095] The rapid generation system and auxiliary molecular marker method established in this study were used to construct a near-isogenic line of the vvy gene for rapid high-temperature sensitive yellow leaves. During the planting cycle from 2017-3-30 to 2017-6-14, 8-10 hybrid F1 immature embryos were obtained per ear; during the planting cycle from 2017-6-14 to 2017-8-28, BC1F1 immature embryos were obtained; during the planting cycle from 2017-8-28 to 2017-11-13, BC2F1 immature embryos were obtained; during the planting cycle from 2017-11-13 to 2018-1-25, BC3F1 immature embryos were obtained, with an average of 28 grains obtained. Using the generation technology, the experimental materials were multiplied four times, shortening the time from four years to ten months. Before entering the next round of hybridization and backcrossing, DNA was extracted from the seedlings, and the hybrid and backcross offspring were tested for the target gene by PCR, so that the plants containing the target gene entered the next round of hybridization or backcrossing (see the results). Figure 4 ), Figure 4 Among them, lane M is D2000 Marker, lane B is parent Buloke, lane V is parent VVY; lanes 1, 4, and 12 are negative plants without the target gene, and the remaining lanes are positive plants containing the target gene.

[0096] In this embodiment, VVY is used as the donor material, Buloke with excellent agronomic traits is used as the recurrent parent, and then auxiliary molecular marker technology is used to quickly identify near-isogenic lines, so that the near-isogenic line of the high-temperature sensitive yellow leaf gene vvy can be quickly constructed. First, through in vitro culture of seed embryos and combined with different light cycles and culture temperatures explored, the growth cycle of the plant is greatly shortened, the accumulation of plant biomass is accelerated, and the Buloke material is used as the recurrent parent through the screening of auxiliary molecular markers to quickly construct the near-isogenic line of the high-temperature sensitive yellow leaf gene vvy. Finally, a first-generation hybrid and a third-generation backcross offspring are obtained in ten months, which greatly shortens the reproduction time of wheat crops and accelerates breeding and research progress.

[0097] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a rapid generation system for wheat, characterized in that: The following steps are involved: S1. Take young ears of wheat crops after flowering, peel out seed embryos, disinfect and sterilize them, then inoculate the seed embryos into an induction medium, culture them in the dark to allow the seed embryos to germinate, and then culture them under light until they grow into embryo seedlings; S2, transplanting the embryo seedlings into planting pots and performing seedling hardening or vernalization treatment; S3, transferring the embryo seedlings after the slow seedling or vernalization treatment to an artificial climate room for cultivation until the plants bloom; wherein the temperature and light conditions are: Seedling stage: 20℃ dark for 6h, 25℃ light for 18h, alternating; From jointing stage to maturity stage: 22℃ darkness for 6h, 28℃ light for 18h, alternating.

2. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S1, the embryo age of the seed immature embryo is 10-16 days.

3. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S1, the induction medium includes a basic culture solution, 5 g / L malt extract, 0.5 mg / L NAA, 0.15 mg / L 6-BA, 30 g / L sucrose and 7 g / L agar, wherein the basic culture solution includes 2800 mg / L KNO3, 460 mg / L (NH4)2SO4, 400 mg / L KH2PO4, 185 mg / L MgSO4·7H2O, 165 mg / L CaCl2·2H2O, 0.415 mg / L KI, 3.1 mg / L H3BO3, 11.15 mg / L MnSO4·4H2O, 4.3 mg / L ZnSO4·7H2O, 0.125 mg / L Na2MoO4·2H2O, 0.0125 mg / L CuSO4·5H2O, and 0.65 mg / L CoCl2·6H2O. 0.0125mg / L, Na2·EDTA 18.65mg / L, FeSO4·4H2O 13.9mg / L, Glycine1mg / L, VB10.5mg / L, VB60.25 mg / L and VPP 0.25mg / L.

4. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S1, the dark culture temperature is 4°C and the time is 5 days.

5. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S1, the culture conditions of the embryo seedlings include: 25°C, 1000 lux light intensity and 24h light for 10-14 days.

6. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S2, when the wheat crop is a spring variety, the embryo seedlings are transplanted into a planting pot, kept in a constant temperature of 20° C. and away from light for 3-4 days, and watered with 1× Hoagland nutrient solution during the acclimatization period; When the wheat crop is a weak winter variety, the embryo seedlings are transplanted into planting pots and grown in a constant temperature of 20°C and away from light for 3-4 days. During the growth period, 1× Hoagland nutrient solution is irrigated. The crops are then transferred to an artificial climate room for cultivation. After they grow to the three-leaf stage, they are vernalized for 10-14 days at 8°C, 200 lux light intensity and 24h light.

7. The method for constructing a rapid generation system for wheat according to claim 1, characterized in that: In step S2, the volume of the planting pot is 7 cm×7 cm×8 cm, and one embryo seedling is transplanted into each planting pot; The composite soil in the planting pot is a mixture of loess, organic matrix and gravel in a volume ratio of 4:2:

1.

8. The method for constructing a rapid generation system for wheat according to claim 6 or 7, characterized in that: In step S3, the light source in the artificial climate chamber uses an LED lamp as a light source, and the ratio of red light to blue light of the light source is 7:

1.

9. Use of the method for constructing a rapid generation system for wheat as described in any one of claims 1 to 8 in constructing a near-isogenic line of wheat.

10. A method for constructing a near-isogenic line of wheat, characterized in that: The method for constructing a rapid generation system for wheat as described in any one of claims 1 to 8 is used for generation culture, and the genotype of each generation of plants is screened using auxiliary molecular marker technology.

Images