Drug loading system combined with targeted nasopharynx cancer treatment as well as preparation method and application of drug loading system

Abstract

The invention provides a drug delivery system combined with targeted nasopharyngeal carcinoma treatment and a preparation method and application thereof, and belongs to the technical field of biomedicine.The drug delivery system is characterized in that a liposome is modified by a nucleic acid aptamer S3 specifically targeting nasopharyngeal carcinoma cells, and then an anti-cancer drug adriamycin is entrapped for targeted killing of NPC cells and tissues; besides, NK cells modified by nucleic acid aptamers S3 and PD-L1 are prepared for targeted infiltration of NPC tissues, the NK cells modified by the nucleic acid aptamers S3 and PD-L1 are combined with anti-PD-L1 antibodies to induce'antibody-dependent cytotoxic effect ', and finally, a chemotherapeutic drug targeted delivery system and immunotherapy are organically combined to form a multi-mode therapeutic scheme. And while multi-angle and multi-layer striking is carried out on tumors, the toxic and side effects on normal cells and tissues can be reduced, and the treatment effect on nasopharyngeal carcinoma patients is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to a drug-carrying system for combined targeted nasopharyngeal carcinoma treatment, and a preparation method and application thereof. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor that occurs in the epithelial tissue of the nasopharyngeal mucosa, especially in southern my country and parts of Southeast Asia. The treatment of NPC mainly includes radiotherapy, chemotherapy and targeted therapy. Radiotherapy is the main means of treating NPC, but it is only effective for patients with early NPC. The early symptoms of NPC mainly include nasal congestion, ear infection, hearing loss and neck mass, but these symptoms are easily ignored in the early stage, resulting in many patients being in the middle and late stages of the disease when diagnosed. Patients in the middle and late stages usually use radiotherapy combined with chemotherapy, but the toxic side effects of chemotherapy limit its therapeutic effect in NPC. In recent years, with the in-depth study of the molecular mechanism of NPC, targeted therapy and immunotherapy have been gradually applied to the treatment of NPC, providing patients with more treatment options. Therefore, it is an important direction for us to screen NPC-specific molecular probes, use the specific probes to make targeted drugs, and combine targeted immune cells with PD-L1 antibodies to induce ADCC effects, target NPC cells, promote activation and enhance the patient's immune system, and achieve more comprehensive and lasting therapeutic effects.

[0003] Nucleic acid aptamers are single-stranded oligonucleotides with unique three-dimensional structures that have high affinity and can recognize specific targets such as proteins, nucleic acids or cells. Aptamers show great potential in biomedical research and clinical applications because they are not only easy to synthesize, but also have lower toxicity, less immunogenicity, and higher chemical modification flexibility compared to traditional antibodies. These characteristics make nucleic acid aptamers have broad application prospects in tumor diagnosis and targeted therapy research.

[0004] The application of nucleic acid aptamers in nanomaterials science is an important branch of modern bio-nanotechnology. Nucleic acid aptamers are widely used in the targeted delivery of nanomedicines due to their high specificity. Through the combination of aptamers and nanoparticles, precise manipulation of nanoparticles can be achieved, thereby efficiently and safely delivering drug molecules to tumor cells for targeted therapy. As an important nanocarrier in drug delivery, liposomes have shown significant advantages in the field of drug delivery. They not only have a structure highly similar to that of cell membranes, ensuring good biocompatibility and biodegradability, reducing the toxicity and immunogenicity of drugs during in vivo transmission, but can also effectively protect drug molecules from enzymatic damage, thereby improving the stability and efficacy of drugs.

[0005] Considering the limited clinical benefits of a single method in treating malignant tumors, targeted therapy is increasingly used in combination with immunotherapy to achieve targeted drug delivery and enhance the ability of immune cells to recognize and kill tumors. At the same time, the immunomodulatory function of antibodies is used to achieve multi-angle and multi-level attacks on tumors, providing a new, multi-modal treatment option for tumor treatment, which is expected to achieve significant therapeutic effects in future clinical applications. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a drug delivery system for combined targeted nasopharyngeal carcinoma treatment and its preparation method and application. Nanoparticles and immune cells can accurately target NPC cells, thereby improving the treatment effect and reducing the toxic side effects of chemotherapy. The organic combination of chemotherapy and immunotherapy provides a new, multi-angle, multi-level tumor treatment program, which is expected to achieve significant therapeutic effects in future clinical applications.

[0007] To achieve the above objectives, the present scheme first provides a drug delivery system for combined targeted nasopharyngeal carcinoma treatment, wherein the drug delivery system comprises drug-loaded nanoparticles, engineered NK cells and PD-L1 antibodies, wherein the drug-loaded nanoparticles comprise nucleic acid aptamer S3, liposomes and doxorubicin, the nucleic acid aptamer S3 modifies the liposomes and then encapsulates the anticancer drug doxorubicin; the engineered NK cells are NK cells dual-modified with nucleic acid aptamer S3 and PD-L1.

[0008] Preferably, the sequence of the nucleic acid aptamer S3 is as shown in SEQ ID NO.1.

[0009] Based on a general inventive concept, the present invention also provides a method for preparing a drug delivery system, comprising the following steps:

[0010] S1. Liposome encapsulation of doxorubicin: distearoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-polyethylene glycol-2000 were dissolved in chloroform, and a phospholipid film was formed after rotary evaporation. Ammonium sulfate solution was then added to hydrate to form multi-compartment liposomes, and the unencapsulated ammonium sulfate was removed to prepare blank liposomes. A 10 mg / mL aqueous solution of doxorubicin hydrochloride was encapsulated into the blank liposomes at a drug-lipid ratio of 1:10. After hydration at 65°C for 30 min, the liposomes were added to a dialysis bag and dialyzed for 6 h. The unencapsulated doxorubicin hydrochloride was removed to prepare Lip-DOX, which was stored at 4°C.

[0011] S2. Construction of aptamer-drug conjugate delivery system: Carboxyl-modified distearoylphosphatidylethanolamine-polyethylene glycol-2000, amino-modified nucleic acid aptamer S3, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide were mixed at room temperature to cause condensation reaction between amino and carboxyl groups. The nucleic acid aptamer S3 was cross-linked to distearoylphosphatidylethanolamine-polyethylene glycol-2000 to form a divalent aptamer. Stearoylphosphatidylethanolamine-polyethylene glycol-2000-nucleic acid aptamer S3, ultrafiltration and centrifugation to remove free 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, distearoylphosphatidylethanolamine-polyethylene glycol-2000-nucleic acid aptamer S3 and Lip-DOX prepared in step S1 are connected by post-insertion method, and incubated in a metal bath at 60°C for 1h to obtain S3-Lip-DOX;

[0012] S3. Preparation of azide-modified NK92 cells: incubating NK92 cells with N-azidoacetylmannosamine-tetraacylated, then collecting the NK92 cells and washing them with PBS to obtain azide-modified NK92 cells;

[0013] S4. Preparation of engineered NK cells: the azide-modified NK92 cells prepared in step S3 were mixed and incubated with the FAM-labeled, DBCO-modified S3 aptamer and the cy5-labeled, DBCO-modified PD-L1 aptamer in a PBS buffer supplemented with 1% fetal bovine serum, and then washed with PBS buffer to obtain S3-P-NK cells;

[0014] S6. Mixing of drug delivery system: 20 μg / mL of PD-L1 antibody was mixed and co-incubated with S3-P-NK cells prepared in step S4, and S3-Lip-DOX prepared in step S2 was added to prepare a drug delivery system for combined targeted nasopharyngeal carcinoma treatment, wherein the effector-target ratio of PD-L1 antibody and S3-P-NK cells was E / T=5:1.

[0015] Preferably, the co-incubation time in step S3 is 24 hours.

[0016] Preferably, the sequence of the DBCO-modified S3 aptamer in step S4 is shown as SEQ ID NO.2; the sequence of the DBCO-modified PD-L1 aptamer is shown as SEQ ID NO.3.

[0017] Preferably, the incubation temperature in step S4 is 37° C. and the incubation time is 2 h.

[0018] Preferably, the co-incubation time in step S6 is 4 hours.

[0019] Based on a general inventive concept, the present invention also provides an application of a drug delivery system in the preparation of drugs for the targeted treatment of nasopharyngeal carcinoma.

[0020] Preferably, the drug delivery system is any pharmaceutically approved preparation.

[0021] Preferably, the drug delivery system is administered in the following order: PD-L1 antibody is first administered after being mixed and incubated with S3-P-NK cells for 4 hours, and then the drug-loaded nanoparticles S3-Lip-DOX are administered 4 hours later.

[0022] The mechanism of treatment of this regimen is as follows:

[0023] This scheme uses the nucleic acid aptamer S3 that specifically targets nasopharyngeal carcinoma (NPC) cells to modify liposomes, and then encapsulates the anticancer drug doxorubicin (DOX) to prepare a nasopharyngeal carcinoma-targeted doxorubicin-loaded liposome nanoparticle (S3-Lip-DOX) for targeted killing of NPC cells and tissues. In addition, NK cells double-modified with nucleic acid aptamers S3 and PD-L1 are prepared for targeted infiltration of NPC tissues, and the double-aptamer-modified NK cells are combined with anti-PD-L1 antibodies to induce "antibody-dependent cell-mediated cytotoxicity" (ADCC). Finally, the targeted delivery system of chemotherapy drugs and immunotherapy (NK cell adoptive therapy and antibody therapy) are organically combined to form a multi-modal treatment scheme, which can not only attack tumors from multiple angles and at multiple levels, but also reduce the toxic side effects on normal cells and tissues, significantly improving the treatment effect of NPC patients.

[0024] Targeted delivery system for chemotherapy drugs: With the help of nucleic acid aptamer S3 to specifically target and recognize the surface molecule CD109 of nasopharyngeal tumor cells and the stable drug delivery system of liposomes, S3 is grafted onto carboxyl-modified distearoylphosphatidylethanolamine-polyethylene glycol-2000 (DSPE-PEG2000-COOH) as the target head, and liposomes are used as drug carriers to encapsulate the chemotherapy drug doxorubicin, thereby efficiently and safely delivering chemotherapy drugs to tumor cells to achieve targeted treatment.

[0025] Targeted immune cells: Utilizing the targeting specificity of nucleic acid aptamer S3 to NPC cells and the targeting specificity of nucleic acid aptamer PD-L1 to tumor cells, NK cells double-modified with nucleic acid aptamers are prepared. Double-modified NK cells are used to accurately target NPC cells, thereby improving the effect of immunotherapy and reducing toxic side effects.

[0026] Blockade therapy combined with PD-L1 antibody: NK92 cells modified with dual aptamers are combined with anti-PD-L1 antibodies to induce ADCC effect, promote ADCC and enhance the anti-tumor response to NPC cells with high PD-L1 expression.

[0027] Combined treatment scheme: The above-mentioned chemotherapy drug targeted delivery system and immunotherapy (NK cell adoptive therapy and antibody therapy) are organically combined to form a multi-modal treatment scheme. This scheme can attack tumors from multiple angles and levels, thereby improving the treatment effect.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) Nucleic acid aptamers have shown multiple advantages in targeted adoptive immunotherapy for tumors. Using sugar metabolism labeling technology, specific chemical groups can be introduced on the surface of NK cells, and then multiple nucleic acid aptamers with high specificity can be effectively coupled to the surface of NK cells through click chemistry reactions. NK cells modified with multiple aptamers can more accurately identify and target multiple tumor-associated antigens to achieve multi-target attacks on tumors and reduce damage to normal cells; at the same time, the combination of PD-L1 antibodies and aptamer-modified NK cells can further enhance the tumor-killing efficiency of aptamer-modified NK cells by utilizing the ADCC effect of antibodies, enabling them to more effectively penetrate the tumor microenvironment and directly attack tumor cells, further enhancing the immunotherapy effect while targeting nasopharyngeal carcinoma.

[0030] (2) Precise targeting: The present invention uses nucleic acid aptamers to achieve precise targeting of tumor cells, avoiding the damage of traditional chemotherapy drugs to normal cells and improving the safety and effectiveness of treatment.

[0031] (3) Highly efficient killing: The NK cells modified with nucleic acid aptamers used in the present invention can more accurately identify and target multiple tumor-associated antigens, achieve multi-target attack on tumors, and improve the treatment effect.

[0032] (4) Synergistic effect: The present invention combines targeted chemotherapy with immunotherapy, achieving targeted drug delivery and enhancing the ability of immune cells to recognize and kill tumors, thus achieving a multi-angle and multi-level attack on tumors, and is expected to achieve significant therapeutic effects in future clinical applications.

[0033] (5) Reduced toxicity: Compared with traditional chemotherapy, the stable drug delivery system of liposomes has lower toxicity; and NK cells modified with nucleic acid aptamers can selectively target tumor cells, which can not only solve the problem of NK cell targeting specificity, but also avoid the risk of insertion mutation caused by CAR-NK technology and achieve targeted immunotherapy effects. Therefore, it has higher safety in clinical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 Schematic diagram of the preparation of nanoparticle S3-Lip-DOX and its anti-NPC activity in Example 1;

[0036] Figure 2 Characterization diagram of liposomes in Experimental Example 1, (a) is the particle size, PDI, Zeta potential, encapsulation efficiency (EE%) and drug loading (DL%) of different liposomes; (b) is the particle size distribution of blank liposomes, Lip-DOX and S3-Lip-DOX; (c) is the Zeta potential statistics of blank liposomes, Lip-DOX and S3-Lip-DOX; (d) is the gel retardation test result of nanoparticles; (e) is the particle size stability of blank liposomes, Lip-DOX and S3-Lip-DOX at 4°C; (f) is the particle size stability of blank liposomes, Lip-DOX and S3-Lip-DOX at 37°C and 10% FBS; (g) is the in vitro release curve of Lip-DOX, S3-Lip-DOX and free doxorubicin hydrochloride in PBS buffer with a pH of 7.4;

[0037] Figure 3 This is the uptake experiment of S3-Lip-DOX by NPC cells in Experimental Example 2. (a) is the fluorescence uptake intensity of the drug detected by flow cytometry when NPC cells were incubated with cells in different drug groups for 12 hours, and (b) is the quantitative graph;

[0038] Figure 4 In vitro antiproliferation study of S3-Lip-DOX in Experimental Example 3, (a) is the CCK8 method to evaluate the effect of nanocarriers on cell proliferation when incubated for 24 h and 48 h; (b) is the CCK-8 method to evaluate the effect of S3-Lip-DOX treatment on cell proliferation rate;

[0039] Figure 5This is the in vitro apoptosis-promoting study of S3-Lip-DOX in Experimental Example 4. (a) is the flow cytometry detection of the effect of S3-Lip-DOX treatment on cell apoptosis;

[0040] Figure 6 The biodistribution and antitumor effect of S3-Lip-DOX in 5-8F tumor xenograft mice in Experimental Example 5, (a) is the whole body distribution image at different time points after tail vein injection of DiR, Lip-DiR or S3-Lip-DiR; (b) is the main tissue image collected 24 hours after injection; (c) is the experimental schedule for tumor xenograft mice designed for antitumor research; (d) is the tumor growth curve of 5-8F tumor-bearing mice with different treatments; (e) is a representative photo of tumors removed on the 22nd day in mice with different treatments; (f) is the weight statistics of tumors removed on the 22nd day in mice with different treatments;

[0041] Figure 7 This is the biosafety analysis of S3-Lip-DOX in Experimental Example 6. (a) is the histological image of the heart, liver, spleen, lung, and kidney stained with hematoxylin and eosin; (b) is the weight record of mice; (c) is the blood biochemical test of liver function ALT and ALB, kidney function UREA and CREA, and heart function CK and LDH.

[0042] Figure 8 Schematic diagram of enhancing adoptive cell immunotherapy of solid tumors by NK cells equipped with nucleic acid aptamers in Example 2;

[0043] Fig. 9 In Experimental Example 7, both nucleic acid aptamers S3 and PD-L1 and NK cells equipped with dual aptamers target NPC cells; (a) nucleic acid aptamers S3 and PD-L1 target NPC cells; (b) NK cells equipped with dual aptamers S3 and PD-L1 (S3-P-NK cells) target NPC cells;

[0044] Fig.10In Experimental Example 8, the aptamer-modified NK cells actively targeted NPC cells, resulting in enhanced in vitro cytotoxicity. (a) After 5-8F and C666-1 cells were incubated with NK, S3-NK, P-NK, and S3-P-NK cells for 4 hours, washed with PBS buffer, and further incubated for 24 hours, Annexin V-FITC and PI staining were used to detect cell apoptosis or necrosis by flow cytometry; (b) After NK, S3-NK, P-NK, and S3-P-NK cells acted on 5-8F and C666-1 cells with an E / T ratio of 10:1, the quantitative analysis of cell apoptosis and necrosis rates (%); (cd) After different types of NK cells were incubated with tumor cells for 4 hours, washed with PBS buffer, and further incubated for 24 hours, the secretion of tumor cytokines was schematically shown (c), and the results of ELISA analysis (d);

[0045] Fig.11 The biodistribution and antitumor effect of S3-P-NK in 5-8F tumor xenograft mice in Experimental Example 9, (a) is the whole body distribution image at different time points after tail vein injection of NK-DIR, S3-NK-DIR, P-NK-DIR and S3-P-NK-DIR cells; (b) is the main tissue image collected 24 hours after injection; (c) is the experimental schedule for tumor xenograft mice designed for antitumor research; (d) is the tumor growth curve of 5-8F tumor-bearing mice with different treatments and the weight statistics of the resected tumor; (e) is a representative photo of the tumor resected on the 22nd day in mice with different treatments;

[0046] Fig.12 For the biosafety analysis in Experimental Example 10, (a) is a histological image of the heart, liver, spleen, lung, and kidney stained with hematoxylin and eosin; (b) is a blood biochemical test of liver function ALT and ALB, kidney function UREA and CREA, and heart function CK and LDH;

[0047] Fig.13 The targeted killing of nasopharyngeal carcinoma cells by the combination of S3-P-NK cells, PD-L1 antibody and S3-Lip-DOX in Experimental Example 11, (a) is the LDH method to detect the killing effect of S3-P-NK cells combined with PD-L1 antibody; (b) is the CCK8 method to detect the effect of S3-P-NK cells combined with PD-L1 antibody on the inhibition of NPC cells; (c) is the CCK8 method to evaluate the effects of S3-Lip-DOX, S3-P-NK cells, PD-L1 antibody, S3-P-NK cells combined with PD-L1 antibody, S3-P-NK cells + PD-L1 antibody combined with S3-Lip-DOX c on the proliferation of 5-8F cells;

[0048] Fig.14Schematic diagram of the combination of S3-P-NK cells, PD-L1 antibodies and S3-Lip-DOX in Experimental Example 11. DETAILED DESCRIPTION

[0049] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0050] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0051] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0052] Example 1

[0053] Preparation of drug-loaded nanoparticles (S3-Lip-DOX) targeting nasopharyngeal tumor cells

[0054] (1) Construction of nanoliposome drug delivery system: Liposomes were prepared by thin film dispersion method. 49.6 mg of distearoylphosphatidylcholine (DSPC), 24.8 mg of cholesterol (Cholesterol), and 5.6 mg of DSPE-PEG were weighed. 2000 (Distearoylphosphatidylethanolamine-polyethylene glycol-2000) was placed in a 500mL pear-shaped bottle, 20mL chloroform was added to dissolve, and the solvent was removed by rotary evaporation at 37°C for 1h. A uniform phospholipid film was formed at the bottom of the bottle, and then 10mL, 250mM (NH4)2SO4 was added and hydrated at 65°C for 30min to generate multi-compartment liposomes (MLV). In order to obtain more uniform liposome particles, the initially prepared liposomes were granulated by a liposome extruder, and then the treated liposomes were transferred to a dialysis bag and dialyzed at room temperature for 6h to remove the unencapsulated ammonium sulfate solution to obtain blank liposomes.

[0055] Weigh 10 mg of doxorubicin hydrochloride (DOX·HCl), add 1 mL of deionized water to dissolve and mix, and prepare a 10 mg / mL doxorubicin hydrochloride aqueous solution. Add the prepared doxorubicin hydrochloride solution to the blank liposomes at a drug-lipid ratio of 1:10, hydrate at 65°C for 30 minutes, add it to a dialysis bag and dialyze for 6 hours to remove the unencapsulated DOX·HCl, and prepare Lip-DOX, which is stored at 4°C.

[0056] (2) Construction of aptamer-drug conjugate delivery system: DSPE-PEG2000-COOH and amino-modified nucleic acid aptamer S3 were mixed at room temperature for 30 minutes under the action of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) to produce a condensation reaction between amino and carboxyl groups, thereby cross-linking S3 to DSPE-PEG2000 to form DSPE-PEG2000-S3. After multiple ultrafiltration centrifugation, free EDC and NHS in the mixed solution were removed to prevent interference with the subsequent binding efficiency of DSPE-PEG2000-S3 and liposomes. DSPE-PEG2000-S3 was connected to Lip-DOX by post-insertion method, and incubated in a metal bath at 60°C for 1 hour to obtain a relatively stable S3-Lip-DOX.

[0057] The particle size and morphology can be determined by DLS and TEM. The preparation of drug-loaded nanoparticles S3-Lip-DOX is as shown in reference Figure 1 shown.

[0058] The nucleic acid sequence of aptamer S3 is:

[0059] 5'-ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTGGGCGTTGAAAGAGGGGTGGACACGGTGGCTTAGT-3'(SEQ ID NO.1)

[0060] Example 2

[0061] Preparation of engineered NK cells targeting nasopharyngeal tumor cells

[0062] (1) Preparation of azide-modified NK92 cells: Add 50 μM N-azidoacetylmannosamine-tetraacylated (Ac4ManNAz) to NK92 cells and incubate with the NK92 cells for 24 h. Then, collect the cells and wash them three times with PBS.

[0063] (2) Preparation of engineered NK cells: 2×10 6 Azide-labeled NK92 cells were incubated with 100 μM FAM-labeled, DBCO-modified S3 aptamer (DBCO-S3-FAM) or cy5-labeled, DBCO-modified PD-L1 aptamer (DBCO-PDL1-Cy5) in PBS buffer supplemented with 1% fetal bovine serum at 37°C for 2 h, and then washed three times with PBS buffer. Due to their amphiphilicity, hydrophilic aptamers can be embedded in the cell membrane and embedded on the surface of NK92 cells. Fluorescence microscopy was used to detect the successful coupling of aptamers in S3-NK cells, P-NK cells, and S3-P-NK cells.

[0064] The preparation of engineered NK cells was as described in reference Figure 8 shown.

[0065] The sequence of the FAM-labeled DBCO-S3 aptamer is as follows: (sequence from 5' to 3'):

[0066] DBCO-(C6)-ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTGGG CGTTGAAAGAGGGGTGGACACGGTGGCTTAGT-(c6)-FAM

[0067] The sequence of the Cy5-labeled DBCO-PDL1 aptamer is as follows: (from 5' to 3' sequence):

[0068] DBCO-(C6)-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT-(C6)-Cy5

[0069] The sequence of the DBCO-S3 aptamer is as follows: (sequence from 5' to 3'):

[0070] DBCO-(C6)-ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTGGG CGTTGAAAGAGGGGTGGACACGGTGGCTTAGT(SEQ ID NO.2)

[0071] The sequence of the DBCO-PDL1 aptamer is as follows: (sequence from 5' to 3'):

[0072] DBCO-(C6)-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT(SEQ ID NO.3)

[0073] Experimental Example 1

[0074] Characterization of liposomes

[0075] After the liposomes prepared in Example 1 were added with ethanol and ultrasonically broken, the encapsulation efficiency (EE%) and drug loading (DL%) of Lip-DOX and S3-Lip-DOX were measured by UV-visible spectroscopy. The results are as follows: Figure 2 As shown in a, the encapsulation efficiencies of Lip-DOX and S3-Lip-DOX were 90.5% and 87.7%, and the drug loadings were 6.37% and 6.05%, respectively, indicating that the encapsulation efficiency and drug loading efficiency were good, and they were good drug delivery materials.

[0076] 1 mL of blank liposome, Lip-DOX and S3-Lip-DOX solution was taken and the particle size and Zeta potential were measured by Malvern particle size analyzer. The results are as follows: Figure 2 As shown in Fig. bc, the particle sizes of blank liposomes, Lip-DOX and S3-Lip-DOX were approximately 133.1±22.58, 188.9±30.76 and 218.7±36.37 nm, respectively, with low polydispersity index (PDI<0.5). The above three sample solutions were diluted to a certain multiple, dropped on a 300-mesh copper grid, dried in an oven at 37°C, and observed by transmission electron microscopy. Figure 2 As shown in b, the prepared liposomes are round and spherical in shape and have relatively uniform sizes.

[0077] To investigate the stability of liposomes under storage conditions and in vivo circulation, liposomes were incubated in PBS at pH 7.4 at 4°C. The changes in liposome size were recorded at predetermined time intervals over a week. Figure 2 As shown in Figure e, the particle size of each liposome did not change significantly within 7 days, indicating that the liposome has good storage stability and can be stored for a long time. In a constant temperature oven at 37°C, the liposomes were incubated in PBS containing 10% fetal bovine serum (FBS), and the particle size changes were measured at predetermined time points within 96 hours. The results are shown in Figure 5. Figure 2 As shown in FIG. 5 , in PBS containing 10% FBS, the particle size of the liposomes did not change significantly during the 96 h incubation, which indicates that the liposomes have good blood circulation stability.

[0078] The dialysis method was used to study the in vitro release effect of liposomes. 1 mL of DOX·HCl solution, Lip-DOX solution and S3-Lip-DOX solution (all with a concentration of 500 μg / mL) were placed in dialysis bags (MW: 1000Da), and then the dialysis bags were placed in centrifuge tubes containing 5 mL of PBS buffer (pH 7.4). The centrifuge tubes were then placed on an incubation shaker at 37°C and the speed was set to 150 rpm / min. Quantitative sampling was performed at different time points of 12h, 24h, 36h, 48h, 60h, and 72h. Each time 3 mL of release medium was taken out, an equal volume of the corresponding release medium was added. The absorbance of doxorubicin at 480 nm at each time point was detected by a UV-visible spectrophotometer and the cumulative release amount was calculated. The results are shown in the figure. Figure 2 As shown in Figure g, in the buffer solution at pH 7.4, DOX was almost completely released after 12 h, while the release amounts of Lip-DOX and S3-Lip-DOX in PBS at pH 7.4 were only nearly 30%, and they maintained a slow release, indicating that the release rate of DOX in liposomes was significantly reduced, and the liposomes had the characteristics of slow release, which also showed that the liposomes had good blood circulation stability.

[0079] Experimental Example 2

[0080] Flow cytometry analysis of the targeted uptake ability of S3-Lip-DOX in NPC cells

[0081] The culture medium containing 10 μg / mL concentration of free DOX, Lip-DOX, and S3-Lip-DOX was co-incubated with normal nasopharyngeal epithelial cells NP69 and NPC cells 5-8F and C666-1, and the uptake capacity of different cells for S3-Lip-DOX was detected by flow cytometry.

[0082] The results are as follows Figure 3 As shown in a, since free DOX is a small molecule that can passively diffuse through the cell membrane and enter NPC cells, the DOX group shows strong fluorescence. The fluorescence of NP69 cells to Lip-DOX and S3-Lip-DOX is weak, while the fluorescence intensity of the S3-Lip-DOX group of NPC cells 5-8F and C666-1 is significantly higher than that of the Lip-DOX group, and the uptake efficiency tends to the DOX group, indicating that S3-Lip-DOX can be better taken up by NPC cells, which may be due to the targeting of nucleic acid aptamer S3 to NPC cells, which enhances the cell's uptake of drugs.

[0083] Experimental Example 3

[0084] To investigate the effect of drug-loaded nanoparticles S3-Lip-DOX on the proliferation of normal nasopharyngeal epithelial cells and NPC cells

[0085] In order to evaluate the cytotoxicity of the nanocarriers, blank liposomes and DSPE-PEG-S3 were co-incubated with NP69, 5-8F, and C666-1 cells, and their effects on the proliferation of different cells were detected by CCK8 assay. Figure 4 As shown in a, blank liposomes and DSPE-PEG-S3 had no effect on the proliferation of NP69, 5-8F and C666-1 cells, indicating that the vector has good biosafety.

[0086] In addition, DOX, Lip-DOX and S3-Lip-DOX were co-incubated with NP69, 5-8F and C666-1 cells, respectively, and then the CCK8 method was used to detect the effects of DOX, Lip-DOX and S3-Lip-DOX on the proliferation of 5-8F and NP69 cells, respectively.

[0087] The results are as follows Figure 4As shown in (b), compared with the free DOX group, the toxicity of Lip-DOX and S3-Lip-DOX groups to NP69 was significantly reduced, while the inhibitory efficiency of S3-Lip-DOX group on 5-8F and C666-1 cells was significantly stronger than that of Lip-DOX group, indicating that S3-Lip-DOX has good targeted anti-proliferation activity on NPC cells.

[0088] Experimental Example 4

[0089] Effects of drug-loaded nanoparticles S3-Lip-DOX on apoptosis of normal nasopharyngeal epithelial cells and NPC cells

[0090] DOX, Lip-DOX and S3-Lip-DOX were co-incubated with NP69, 5-8F and C666-1 cells, respectively, and then flow cytometry was used to detect the effects of DOX, Lip-DOX and S3-Lip-DOX on the apoptosis of 5-8F and NP69 cells.

[0091] The results are as follows Figure 5 As shown in a, compared with the free DOX group, the apoptosis rates of NP69 cells in the Lip-DOX and S3-Lip-DOX groups were 20% and 16%, respectively, indicating that the toxicity of drug-loaded nanoparticles to normal nasopharyngeal epithelial cells was significantly reduced. The apoptosis rates of 5-8F and C666-1 cells in the S3-Lip-DOX group were significantly stronger than those in the Lip-DOX group, indicating that S3-Lip-DOX enhanced the ability to induce apoptosis of NPC cells.

[0092] Experimental Example 5

[0093] Biodistribution and antitumor effects of S3-Lip-DOX in 5-8F tumor xenograft mice

[0094] (1) Establishment of BALB / c nude mouse subcutaneous transplant tumor model: 2×10 7 A number of 5-8F cells were used to construct a nude mouse subcutaneous transplant tumor model, and subsequent experiments were performed after the tumor was formed 2 weeks later.

[0095] (2) Preparation of liposomes loaded with cell membrane near-infrared fluorescent probe (DiR): Weigh 49.60 mg DSPC, 24.80 mg Cholesterol, 5.60 mg DSPE-PEG2000, and 1.00 mg DiR, put them into a 250 mL round-bottom flask, add 10 mL chloroform to dissolve the phospholipids and drugs, and perform rotary evaporation at 37°C to remove the solvent. After 40 minutes, a uniform phospholipid film is formed at the bottom of the flask, and then 10 mL PBS is added and rotated at 65°C for 30 minutes to form liposomes encapsulating DiR. The prepared DiR liposomes are granulated by a liposome extruder, dialyzed for 6 hours using a dialysis bag, and the unencapsulated DiR solution is removed to prepare Lip-DiR liposomes.

[0096] Subsequently, DSPE-PEG2000-COOH and amino-modified nucleic acid aptamer S3 were mixed at room temperature for 30 minutes under the action of EDC and NHS to cause condensation reaction between amino and carboxyl groups, thereby cross-linking S3 to DSPE-PEG2000 to form DSPE-PEG2000-S3. After multiple ultrafiltration centrifugation, free EDC and NHS in the mixed solution were removed to prevent interference with the subsequent binding efficiency of DSPE-PEG2000-S3 and liposomes. DSPE-PEG2000-S3 was connected to Lip-DiR liposomes by post-insertion method, and incubated in a metal bath at 60°C for 1 hour to obtain relatively stable S3-Lip-DiR liposomes.

[0097] (3) In vivo distribution experiment: For in vivo fluorescence imaging, 200 μL of free DiR, Lip-DiR and S3-Lip-DiR (DiR concentration was 5 μg / kg) were first injected into each group of BALB / c nude mice via tail vein injection. In vivo fluorescence distribution images of mice were captured by small animal in vivo fluorescence imaging at 1 h, 8 h, and 24 h after injection. Secondly, 24 h after injection, the heart, liver, spleen, lung, kidney and tumor were dissected and photographed.

[0098] The experimental results are as follows Figure 6 As shown in a, NPC mice injected with S3-modified S3-Lip-DiR nanoparticles showed stronger fluorescence at the tumor site than non-targeted Lip-DiR and free DIR, and the fluorescence generated at the tumor site reached a maximum 24 hours after injection. The main organs and tumors were dissected for fluorescence imaging to study the in vivo distribution 24 hours after injection. The results are shown in Figure 6 As shown in Figure b, the fluorescence of the tumor site in the S3-Lip-DiR group was much higher than that in other groups, which was consistent with the results of the whole body distribution, and the liver also had strong fluorescence, which was the result of liver metabolism. In summary, the S3-modified liposomes have good targeting to NPC, which provides a feasibility basis for subsequent research on NPC treatment.

[0099] (4) S3-Lip-DOX inhibits the growth of nude mouse transplanted tumors: The treatment process of S3-Lip-DOX on nasopharyngeal tumors in vivo is as follows: Figure 6 As shown in c, one week after tumor inoculation, the tumor volume at the inoculation site was approximately 10-100 mm 3 Every 2 days, each nude mouse was injected with 200uL PBS, DOX, Lip-DOX, S3-Lip-DOX liquid (DOX concentration was 2mg / kg) for 7 times. During the treatment period, the nude mice were weighed and the tumor volume of each group was measured. After 14 days of administration, the nude mice were killed by cervical dislocation, and the nude mouse heart, liver, spleen, lung, kidney and tumor tissues were obtained by dissection. The volume and weight of the tumor after different drug treatments were analyzed based on the recorded values.

[0100] The experimental results are as follows Figure 6 As shown in df, after drug treatment, compared with the PBS control group, the size and volume of the tumor in the nude mice treated with DOX, Lip-DOX, and S3-Lip-DOX were reduced, and the tumor in the nude mice treated with S3-Lip-DOX was the smallest, indicating that S3-Lip-DOX can effectively inhibit the growth of tumors in nude mice.

[0101] Experimental Example 6

[0102] Biosafety analysis of S3-Lip-DOX

[0103] (1) Histological evaluation: 14 days after administration, the mice were killed and the heart, liver, spleen, lung, kidney and other major organs were removed by dissection. They were stored in 4% paraformaldehyde and embedded in paraffin to prepare immunohistochemical sections. The specimens were then sliced, stained with hematoxylin and eosin (H&E), and the slides were observed using an inverted microscope.

[0104] The experimental results are as follows Figure 7 As shown in a, the main internal organs were histologically evaluated after the treatment. The pathological morphology of the heart, liver, spleen, lung and kidney of the mice in the S3-Lip-DOX treatment group was normal, but the heart tissue of the free DOX group was damaged, which may be due to its cardiotoxicity, indicating that the liposome material has a toxicity-reducing effect and good biocompatibility.

[0105] The weight of nude mice in the PBS treatment group continued to increase, while the weight of nude mice in the DOX, Lip-DOX, and S3-Lip-DOX treatment groups decreased, indicating that the nude mice were all affected by the chemotherapy drug DOX. Compared with the DOX treatment group, the weight changes of nude mice in the Lip-DOX and S3-Lip-DOX treatment groups were smaller, indicating that liposomes can effectively reduce the toxic side effects of chemotherapy drugs.

[0106] (2) Blood biochemical test: To evaluate the drug toxicity of each group, after the end of treatment, blood was collected from the mouse orbits and centrifuged to obtain serum for serum biochemical analysis. The liver function indicators ALB and alanine aminotransferase (ALT), the kidney function indicators urea (UREA) and creatinine (CREA), and the heart indicators creatine kinase (CK) and lactate dehydrogenase (LDH) were tested.

[0107] The experimental results are as follows Figure 7 As shown in Figure c, there was no significant difference in the ALB, ALT, BUN, CREA, CK, and LDH indicators of each group of mice, indicating that the liver, kidney, and heart functions of the mice were normal and the liposomes had good biocompatibility.

[0108] Experimental Example 7

[0109] Targeting of aptamers and aptamer-modified NK cells to NPC cells

[0110] (1) Targeting of nucleic acid aptamers S3 and PD-L1 to NPC cells: Nucleic acid aptamers S3 and PD-L1 were co-incubated with nasopharyngeal epithelial cells (NP69) and NPC cells (5-8F, C666-1) to detect their targeting. The experimental results are as follows: Fig. 9 As shown in a, both S3 and PD-L1 aptamers can target and recognize NPC cells, but have no recognition effect on NP-69 cells, indicating that the selected aptamers have significant targeting effect on NPC cells.

[0111] (2) Targeting of NK cells modified with nucleic acid aptamer S3 and PD-L1 to NPC cells: S3-P-NK cells were co-incubated with nasopharyngeal epithelial cells (NP69) and NPC cells (5-8F, C666-1) at an E / T ratio of 10:1 for 4 h, and the unbound S3-P-NK cells were washed with PBS buffer. The S3-P-NK cells adhered to the nasopharyngeal epithelial cells and NPC cells were imaged using CLSM to observe their active targeting ability. The experimental results are shown in Figure 2. Fig. 9 As shown in b, compared with nasopharyngeal cells NP69 cells, a large number of S3-P-NK cells were able to adhere to NPC cells 5-8F and C666-1 cells.

[0112] Experimental Example 8

[0113] NK cells equipped with aptamers specifically kill NPC cells

[0114] To study the cytotoxicity of S3-P-NK cells, 5-8F and C666-1 cells were isolated at a density of 2×10 5 / well were inoculated in a 6-well plate and left to stand in 5% CO2 for 24 hours before washing with PBS buffer. Then NK, S3-NK, P-NK, S3-P-NK cells were co-incubated with 5-8F and C666-1 cells at an E:T ratio of 10:1 for 4 hours. After the incubation, the unbound NK92 cells were removed and the viability of 5-8F and C666-1 cells was detected by flow cytometry after further incubation for 24 hours. The results are shown in Fig.10 As shown in ab, in 5-8F and C666-1, the killing ability of S3-P-NK cells was significantly enhanced compared with the parental NK92 cells, and was stronger than that of S3-NK and P-NK cells modified with a single aptamer, indicating that S3-P-NK cells have enhanced the ability to induce apoptosis of NPC cells.

[0115] Through the contact between NK cells and tumor cells, NK cells can secrete immunomodulatory cytokines to affect the adoptive immune response. After NPC cells come into contact with S3-P-NK cells, S3-P-NK cells can secrete a variety of cytokines, such as IFNγ, perforin, and granzyme B, which mediate their killing activity against NPC cells. NPC cells were inoculated at 5×10 3 The cells / well were inoculated in a 96-well plate at a density of 1.54 μg / well. After culturing for 24 h in 5% CO2, the aptamer-modified NK92 cells were incubated with NPC cells for 4 h. After the incubation, the unbound NK92 cells were removed and further incubated for 24 h. The culture medium was collected and centrifuged to obtain the supernatant. The secretion of IFNγ, perforin and granzyme B in the supernatant was detected using a quantitative factor ELISA kit.

[0116] The results are as follows Fig.10 As shown in cd, compared with the parental NK92 cells, the cytokine secretion of S3-P-NK cells was significantly increased, and more than that of S3-NK and P-NK cells modified with a single aptamer, indicating that after S3-P-NK cells come into contact with tumor cells, they release cytokines such as IFNγ, perforin and granzyme B to mediate their killing effect.

[0117] Experimental Example 9

[0118] Biodistribution and antitumor effect of S3-P-NK in mice bearing 5-8F tumor xenografts

[0119] (1) Establishment of BALB / c nude mouse subcutaneous transplant tumor model: 2×10 7 A number of 5-8F cells were used to construct a nude mouse subcutaneous transplant tumor model, and subsequent experiments were performed after the tumor was formed 2 weeks later.

[0120] (2) NK cell labeling: 10 μM DiR fluorescent dye was co-incubated with NK, S3-NK, P-NK, and S3-P-NK cells at 37°C for 30 min, and then the NK cells were washed three times with PBS buffer for subsequent experiments.

[0121] (3) In vivo distribution experiment: To study the active targeting ability of adoptive NK cells, S3-NK, P-NK, and S3-P-NK cells in mice, mice were intravenously injected with DiR-labeled NK cells, S3-NK, P-NK, and S3-P-NK cells (5×10 6 Cells / mouse). Fluorescence distribution images of mice were captured by small animal in vivo fluorescence imaging at 1h, 8h, and 24h after injection. Secondly, 24h after injection, the heart, liver, spleen, lung, kidney, and tumor were dissected and photographed.

[0122] The experimental results are as follows Fig.11 As shown in a, nasopharyngeal carcinoma mice injected with dual-aptamer-modified S3-P-NK cells showed stronger fluorescence at the tumor site than non-targeted NK cells and single-targeted S3-NK and P-NK cells, and the fluorescence generated at the tumor site reached a maximum 24 hours after injection. The main organs and tumors were dissected for fluorescence imaging to study the in vivo distribution 24 hours after injection. The results are shown in Fig.11 As shown in Figure b, the fluorescence of the tumor site in the group injected with S3-P-NK cells was much higher than that in other groups, which was consistent with the results of systemic distribution, and the liver also had strong fluorescence, which was the result of liver metabolism. Liposomal NK cells modified with S3 and PD-L1 aptamers have good targeting to NPC, providing a feasibility basis for subsequent research on NPC treatment.

[0123] (4) S3-P-NK cells inhibit the growth of nude mouse transplanted tumors: The treatment process of S3-P-NK cells on nasopharyngeal tumors in vivo is as follows: Fig.11 c, each nude mouse was subcutaneously injected with 5-8F cells (2×10 6 ), when the tumor size reaches about 100 mm 3 Every 4 days, each nude mouse was intravenously injected with PBS (200 μL), NK cells (200 μL, 5×10 6 cells) and IL-2 (2000 units / mouse), S3-NK cells (200 μL, 5×10 6 cells) and IL-2 (2000 units / mouse), P-NK cells (200 μL, 5×10 6 cells) and IL-2 (2000 units / mouse), S3-P-NK cells (100 μL, 5×10 6Cells) and IL-2 (1000 units / mouse). This was continued for 4 times, and the body weight of the nude mice was weighed and the volume of the tumor of each group of nude mice was measured during the treatment. After 16 days of administration, the nude mice were killed by cervical dislocation, and the heart, liver, spleen, lung, kidney and tumor tissues of the nude mice were obtained by dissection. The volume and weight of the tumor of the mice after treatment with NK cells modified with different aptamers were analyzed based on the recorded values.

[0124] The experimental results are as follows Fig.11 As shown in Figure 5, after NK cell adoptive therapy, various NK cells used could inhibit tumor growth compared with the PBS control group. It is worth noting that compared with NK cells in other groups, S3-P-NK cells had the most significant inhibitory effect on tumors, suggesting that the active targeting ability of S3-P-NK cells plays an important role in tumor treatment to a certain extent.

[0125] Experimental Example 10

[0126] Biosafety Analysis of S3-P-NK Cells

[0127] (1) Histological evaluation: To evaluate the toxic and side effects of NK cell therapy, the weight changes of mice were detected during the treatment period. After the treatment, the mice were killed and the heart, liver, spleen, lungs, kidneys and other major organs were removed by dissection. The mice were fixed with 4% paraformaldehyde and embedded in paraffin to prepare immunohistochemical sections, which were then stained with hematoxylin and eosin (H&E) and observed under an inverted microscope.

[0128] The experimental results are as follows Fig.12 As shown in a, after the treatment, the main internal organs were histologically evaluated, and the pathological morphology of the heart, liver, spleen, lung and kidney of the mice in the control group and each NK cell treatment group was normal, indicating that NK cell adoptive therapy had no obvious toxic side effects and good biological safety.

[0129] (2) Blood biochemical test: To evaluate the drug toxicity of each group, after the end of treatment, blood was collected from the mice’s orbits and centrifuged to obtain serum for serum biochemical analysis. The liver function indicators ALB and alanine aminotransferase (ALT), kidney function indicators urea (BUN) and creatinine (CREA), and heart indicators creatine kinase (CK) and lactate dehydrogenase (LDH) were tested.

[0130] The experimental results are as follows Fig.12 As shown in b, there was no significant difference in the ALB, ALT, BUN, CREA, CK, and LDH indicators of each group of mice, indicating that the liver, kidney, and heart functions of the mice were normal, and the NK cells equipped with aptamers had good biosafety.

[0131] Experimental Example 11

[0132] Anti-PD-L1 monoclonal antibody-mediated ADCC enhances NK cell cytotoxicity against human NPC cells

[0133] (1) The LDH method was used to determine the cytotoxicity of S3-P-NK cells against 5-8F mediated by ADCC mediated by anti-PD-L1 monoclonal antibodies. 5-8F cells were seeded in a 96-well plate at a density of 6000 cells / well. After culturing for 24 hours, PD-L1 antibodies were used at concentrations of 10, 20, and 40 μg / mL to co-culture with S3-P-NK cells at an effector-target ratio of 5:1 with 5-8F cells. The culture supernatant was collected at 6 hours, 12 hours, and 24 hours, and the LDH content in the 5-8F cell culture medium was detected by the LDH method to evaluate its killing effect. The results are shown in Figure 2. Fig.13 As shown in a, at 24 h, the LDH release of 5-8F cells in combination with 10, 20, and 40 μg / mL concentrations of PD-L1 antibodies and S3-P-NK cells reached 40.35 U / mL, 44.06 U / mL, and 45.27 U / mL, respectively, which were all higher than 5-8F cells treated with single S3-P-NK cells (33.94 U / mL), indicating that the combination of PD-L1 antibodies and S3-P-NK cells can jointly induce ADCC effect, promote ADCC and enhance its anti-tumor response.

[0134] (2) The CCK-8 method was used to evaluate the effect of anti-PD-L1 monoclonal antibody-mediated ADCC enhancement on the inhibition of 5-8F cells by S3-P-NK cells. 5-8F cells were seeded in a 96-well plate at a density of 6000 cells / well. After culturing for 24 hours, PD-L1 antibodies were used at concentrations of 10, 20, and 40 μg / mL, respectively, and co-cultured with effector cells at an effector-target ratio of 5:1 with tumor cells. The inhibition rate of 5-8F cells was detected at 6 hours, 12 hours, and 24 hours, respectively. The results are shown in Figure 2. Fig.13 As shown in b, at 24h, the inhibition rates of 5-8F cells in combination with PD-L1 antibodies at concentrations of 10, 20, and 40 μg / mL and S3-P-NK cells were 45.59%, 58.28%, and 60.41%, respectively, which were much higher than those of 5-8F cells treated with single S3-P-NK cells (26.65%), indicating that PD-L1 antibodies enhanced the cytotoxicity of S3-P-NK cells to 5-8F cells in a dose-dependent manner. However, when the dose increased from 20-40 μg / mL, the cytotoxicity reached a plateau, indicating that the best killing effect could be achieved when 20 μg / mL of PD-L1 antibodies were used in combination with S3-P-NK cells. This concentration was then used to conduct targeted therapy studies on NPC by combining chemotherapy drug targeted delivery systems and immunotherapy (NK cell adoptive therapy and PD-L1 antibody therapy).

[0135] (3) The experiment was divided into single treatment groups of S3-Lip-DOX (515.1nM), S3-P-NK (E / T=5:1), PD-L1 antibody (20μg / mL), and a combination group of S3-P-NK and PD-L1 antibody, as well as a triple group of S3-P-NK cells and PD-L1 antibody mixed with 5-8F cells for 4h before adding S3-Lip-DOX (the amount of drugs and cells in the combination group was the same as that in the single drug group). The CCK8 method was used to evaluate the effect of the combination treatment group on the proliferation of 5-8F cells. The results are shown in Figure 2. Fig.13 As shown in c, compared with the individual treatment groups of S3-Lip-DOX, S3-P-NK, and PD-L1 antibody (20 μg / mL), the dual combination of S3-P-NK and PD-L1 antibody had an enhanced killing effect on 5-8F cells, indicating that PD-L1 antibody better mediated the ADCC effect of S3-P-NK cells. After S3-Lip-DOX was added to the dual combination to form a triple system of chemotherapy and immunotherapy, the killing activity against 5-8F reached the best, indicating that combining the targeted chemotherapy drug system with targeted NK cell therapy and PD-L1 antibody at the same time can give play to the dual advantages of targeted drug therapy and targeted adoptive immunotherapy, and achieve a better and more precise targeted treatment effect of NPC. The schematic diagram of the combined treatment is shown in Fig.14 shown.

[0136] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A drug delivery system for combined targeted nasopharyngeal carcinoma treatment, characterized in that: The drug-carrying system includes drug-carrying nanoparticles, engineered NK cells and PD-L1 antibodies. The drug-carrying nanoparticles include nucleic acid aptamer S3, liposomes and doxorubicin. The nucleic acid aptamer S3 modifies the liposomes and then encapsulates the anticancer drug doxorubicin. The engineered NK cells are NK cells double-modified with nucleic acid aptamer S3 and PD-L1, and the sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.

1.

2. A method for preparing the drug delivery system according to claim 1, characterized in that: The following steps are involved: S1. Liposome encapsulation of doxorubicin: distearoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-polyethylene glycol-2000 were dissolved in chloroform, and a phospholipid film was formed after rotary evaporation. Ammonium sulfate solution was then added to hydrate to form multi-compartment liposomes, and unencapsulated ammonium sulfate was removed by dialysis to obtain blank liposomes. A 10 mg / mL aqueous solution of doxorubicin hydrochloride was encapsulated into the blank liposomes at a drug-lipid ratio of 1:

10. After rehydration, unencapsulated doxorubicin hydrochloride was removed by dialysis to obtain Lip-DOX, which was stored at 4°C. S2. Construction of drug-loaded nanoparticles: Carboxyl-modified distearoylphosphatidylethanolamine-polyethylene glycol-2000, amino-modified nucleic acid aptamer S3, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide were mixed at room temperature to cause condensation reaction between amino and carboxyl groups. The nucleic acid aptamer S3 was cross-linked to distearoylphosphatidylethanolamine-polyethylene glycol-2000 to form distearoylphosphatidylethanolamine. Ethanolamine-polyethylene glycol-2000-nucleic acid aptamer S3, ultrafiltration centrifugation to remove free 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, distearoylphosphatidylethanolamine-polyethylene glycol-2000-nucleic acid aptamer S3 and Lip-DOX prepared in step S1 were connected by post-insertion method, and incubated in a metal bath at 60°C for 1h to obtain drug-loaded nanoparticles S3-Lip-DOX; S3. Preparation of azide-modified NK92 cells: incubating NK92 cells with N-azidoacetylmannosamine-tetraacylated, then collecting the NK92 cells and washing them with PBS to obtain azide-modified NK92 cells; S4. Preparation of engineered NK cells: the azide-modified NK92 cells prepared in step S3 were mixed and incubated with the FAM-labeled, DBCO-modified S3 aptamer and the cy5-labeled, DBCO-modified PD-L1 aptamer in a PBS buffer supplemented with 1% fetal bovine serum, and then washed with PBS buffer to obtain S3-P-NK cells; S5. Combined immunization of PD-L1 antibody and engineered NK cells: 20 μg / mL of PD-L1 antibody was mixed and co-incubated with S3-P-NK cells prepared in step S4, wherein the effector-target ratio of PD-L1 antibody to S3-P-NK cells was E / T=5:

1.

3. The preparation method according to claim 2, characterized in that: The hydration temperature in step S1 is 65° C. and the hydration time is 35 min; the dialysis time is 6 h.

4. The preparation method according to claim 2, characterized in that: The total incubation time in step S3 is 24 hours.

5. The preparation method according to claim 2, characterized in that: The sequence of the DBCO-modified S3 aptamer in step S4 is shown in SEQ ID NO.2; the sequence of the DBCO-modified PD-L1 aptamer is shown in SEQ ID NO.

3.

6. The preparation method according to claim 2, characterized in that: In step S4, the incubation temperature is 37° C. and the incubation time is 2 h.

7. The preparation method according to claim 2, characterized in that: The co-incubation time in step S5 is 4 hours.

8. Use of the drug delivery system according to claim 1 or the drug delivery system prepared by the preparation method according to any one of claims 2 to 8 in preparing drugs for targeted treatment of nasopharyngeal carcinoma.

9. The use according to claim 8, characterized in that: The drug delivery system is any pharmaceutically acceptable preparation.

10. The use according to claim 8, characterized in that: The administration order of the drug delivery system is: the PD-L1 antibody is first administered after being mixed and incubated with S3-P-NK cells for 4 hours, and then the drug-loaded nanoparticles S3-Lip-DOX are administered 4 hours later.

Images