Paphiopedilum PCMYB1 gene and application thereof in changing plant flower color

Abstract

The invention discloses a paphiopedilum PCMYB1 gene and application of the paphiopedilum PCMYB1 gene in changing plant flower color. The amino acid sequence of the PCMYB1 is as shown in SEQ ID NO. 2, and the nucleotide sequence of the coding gene of the PCMYB1 is as shown in SEQ ID NO. 1. Through instantaneous transformation or stable overexpression of the gene, the synthesis level of anthocyanin in the plant can be effectively improved, so that the flower color of the plant is changed. The application provides an innovative thought for plant breeding, the ornamental value and market competitiveness of flowers can be remarkably improved, and a new growth point is brought to the flower industry. Meanwhile, the plant flower color is changed by means of genetic engineering, the biological diversity can be enriched, the increasingly diversified requirements of consumers are met, and the progress of germplasm innovation and sustainable agriculture in China is promoted.

Description

Technical Field

[0001] The invention belongs to the fields of molecular biology and biotechnology, and particularly relates to a Paphiopedilum PCMYB1 gene and an application thereof in changing plant flower color. Background Art

[0002] Anthocyanins are natural water-soluble pigments widely found in plants. They not only give plants’ roots, stems, leaves, flowers, fruits and seeds rich colors, but also enhance plants’ resistance and reproductive capacity in adverse environments. When plants face various stresses, they will synthesize anthocyanins to cope with adversity, thereby reducing the damage caused by strong light, ultraviolet rays and low temperatures, and improving resistance. In addition, anthocyanins can also help prevent pests and diseases, attract insects for pollination, and promote the transport of auxins. On the other hand, as a natural pigment, anthocyanins are safe and non-toxic, and have many health benefits such as antioxidant, anti-mutation, prevention of cardiovascular and cerebrovascular diseases, protection of the liver, and inhibition of tumor cells. They are now widely used in food, medicine, cosmetics and other industries. MYB is the largest transcription factor family in plants, which can be divided into four categories according to the number of domains: R1-MYB, R2R3-MYB, R1R2R3-MYB and 4R-MYB. Among them, R2R3-MYB transcription factors play a key role in the regulation of anthocyanin biosynthesis. They can directly regulate the expression of structural genes related to anthocyanin biosynthesis, and therefore play a core role in the regulation of anthocyanin biosynthesis. At present, R2R3-MYB transcription factors involved in the positive regulation of anthocyanin biosynthesis have been isolated and identified from a variety of model plants and ornamental plants.

[0003] Paphiopedilum, also known as the slipper orchid, has a high ornamental value due to its unique flower shape, gorgeous color, long flowering period and elegant and upright leaves. It has become a popular high-end flower in the international flower market. Paphiopedilum has attracted much attention in the international horticultural community and has won many awards at the World Horticultural Exhibition. As an emerging orchid variety with great development potential, it has a broad market prospect. At present, the cultivation of new flower color varieties of Paphiopedilum is mainly through hybrid breeding, but the breeding cycle is extremely long and the efficiency is low. Since wild Paphiopedilum populations are facing the threat of extinction due to over-collection and habitat destruction, all Paphiopedilum species are listed in Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), and their trade is prohibited, which also makes the development of new flower color Paphiopedilum varieties face greater challenges. Using genetic engineering to improve flower color is a cutting-edge technology in the field of breeding today. However, at this stage, the research on the molecular mechanism of Paphiopedilum flower color formation is very limited, and the key MYB transcription factor regulating anthocyanin synthesis has not been reported. Therefore, the identification of MYB transcription factors involved in regulating the biosynthesis of Paphiopedilum anthocyanins is of great significance for elucidating the regulatory mechanism of anthocyanin synthesis in Paphiopedilum plants. It can also be applied to the genetic engineering directed flower color improvement of Paphiopedilum and other plants, and is of great significance for the creation of new germplasm of plant flower colors. Summary of the invention

[0004] The present invention provides an application of using the Paphiopedilum PCMYB1 gene to change the flower color of plants. By transiently transforming or stably overexpressing the gene, the synthesis level of anthocyanins in plants can be effectively increased, thereby changing their flower color. Specifically, the method of the present invention involves the following steps:

[0005] Select the target plant, clone the Paphiopedilum PCMYB1 gene and construct an expression vector. Transform the vector into the target plant and use genetic engineering technology to achieve overexpression. Use real-time quantitative PCR and other technologies to detect gene expression levels, analyze changes in anthocyanin content, and ultimately achieve a change in flower color.

[0006] The first object of the present invention is to provide a Paphiopedilum PCMYB1 protein, whose amino acid sequence is shown in SEQ ID NO.2.

[0007] The second object of the present invention is to provide a gene encoding the above-mentioned Paphiopedilum PCMYB1 protein.

[0008] Preferably, the nucleotide sequence of the encoding gene is as shown in SEQ ID NO.1.

[0009] The third object of the present invention is to provide a recombinant plant expression vector containing the above-mentioned encoding gene.

[0010] The fourth object of the present invention is to provide the use of the above-mentioned Paphiopedilum PCMYB1 protein, the above-mentioned encoding gene or the above-mentioned expression vector in changing the flower color of plants.

[0011] Preferably, the changing of plant flower color is regulating the content of anthocyanins in the plant.

[0012] Preferably, the regulation of the anthocyanin content in the plant is by increasing the expression level and / or activity of the PCMYB1 protein in the plant to increase the anthocyanin content.

[0013] The fifth object of the present invention is to provide a method for changing the flower color of a plant, comprising the following steps: introducing the PCMYB1 gene into plant cells, tissues or organs, and then cultivating the transformed plant cells, tissues or organs into plants so that the PCMYB1 is stably overexpressed in the plant; or transiently transforming the PCMYB1 gene in the flower organs of the plant, wherein the nucleotide sequence of the PCMYB1 gene is shown in SEQ ID NO.1.

[0014] The sixth object of the present invention is to provide a method for increasing the anthocyanin content in plants, comprising the following steps: introducing the PCMYB1 gene into plant cells, tissues or organs, and then cultivating the transformed plant cells, tissues or organs into plants so that the PCMYB1 is stably overexpressed in the plant; or transiently transforming the PCMYB1 gene in plant tissues or organs, the nucleotide sequence of the PCMYB1 gene is shown in SEQ ID NO.1.

[0015] Preferably, the PCMYB1 gene is introduced into plant cells, tissues or organs via a plant expression vector, and the plant is Phalaenopsis or tobacco.

[0016] Advantages of the present invention:

[0017] The present invention provides an application of using the Paphiopedilum PCMYB1 gene to change the flower color of plants. By transiently transforming or stably overexpressing the gene, the synthesis level of anthocyanins in the plant can be effectively increased, thereby changing its flower color.

[0018] At present, there is no report on the PCMYB1 gene of Paphiopedilum at home and abroad, and there is no application of this gene in regulating anthocyanins and changing flower color. The application of the present invention provides an innovative idea for plant breeding, which can significantly improve the ornamental value and market competitiveness of flowers and bring new growth points to the flower industry. At the same time, changing the flower color of plants by means of genetic engineering can enrich biodiversity, meet the increasingly diversified needs of consumers, and promote the process of germplasm innovation and sustainable agriculture in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The full length of the PcMYB1 gene. M is 2000DNAMarker, and the right lane is the PcMYB1 fragment, which is 714bp in size.

[0020] Figure 2 This is the expression pattern of the PcMYB1 gene in different tissues of Paphiopedilum callosum.

[0021] Figure 3 This is a phylogenetic tree analysis of PcMYB1 protein and other known anthocyanin positive regulatory transcription factors.

[0022] Figure 4 It is an amino acid sequence alignment of PcMYB1 and known orchid anthocyanin positive regulatory transcription factors.

[0023] Figure 5 This is the color change result after transient overexpression of the PcMYB1 gene in white Phalaenopsis orchid petals.

[0024] Figure 6 The expression abundance of PcMYB1 in Phalaenopsis petals with no vector (Super1300) and transient overexpression of PcMYB1 gene.

[0025] Figure 7 This is the result of anthocyanin content in Phalaenopsis petals with no vector (Super1300) and transient overexpression of PcMYB1 gene.

[0026] Figure 8 It is the result of corolla color change in tobacco stably transformed with empty vector (Super1300) and PcMYB1 gene.

[0027] Fig. 9 These are the results of anthocyanin content in the corolla of tobacco stably transformed with empty vector (Super1300) and PcMYB1 gene. DETAILED DESCRIPTION

[0028] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0029] The plant materials in the embodiment include Paphiopedilum callosum, 'Ama' Phalaenopsis, and 'NC89' Nicotiana tabacum, all of which are planted in the resource garden of South China Botanical Garden, Chinese Academy of Sciences.

[0030] Example 1: Application of Paphiopedilum PCMYB1 gene to change plant flower color

[0031] 1. Cloning and basic analysis of the Paphiopedilum PCMYB1 gene

[0032] 1.1 Total RNA extraction from Paphiopedilum

[0033] Since Paphiopedilum is a polysaccharide and polyphenol plant material, RNA is difficult to extract. Therefore, Quick RNA isolation Kit (Beijing Huayueyang Biotechnology Co., Ltd.) was used to extract high-quality total RNA from different tissues of Paphiopedilum.

[0034] 1.2 Quality control of Paphiopedilum total RNA

[0035] Nanodrop 2000 was used to determine the concentration and purity of total RNA from Paphiopedilum, 1% agarose gel electrophoresis was used to detect RNA integrity, and RIN value was determined using Agilent 2100. High-quality RNA (total RNA amount ≥ 1 μg, concentration ≥ 35 ng / μL, OD260 / 280 ≥ 1.8, OD260 / 230 ≥ 1.0) samples were selected for subsequent experiments.

[0036] 1.3 Synthesis of single-stranded cDNA

[0037] use One-Step gDNARemoval and cDNA Synthesis SuperMix (Beijing Quanshijin Biotechnology Co., Ltd.) was used to reverse transcribe the extracted Paphiopedilum total RNA into single-stranded cDNA for subsequent gene cloning and expression pattern analysis experiments.

[0038] 1.4 Cloning of Paphiopedilum PcMYB1 gene

[0039] Through the second and third generation transcriptome databases of Paphiopedilum callosum, an R2R3MYB transcription factor that may regulate anthocyanins was screened out and named PcMYB1. The full length of the gene was obtained by querying the sequence file. Based on this, primers PcMYB1-F and PcMYB1-R in the CDS region were designed. The primer sequences are shown in Table 3. The primer concentration was diluted to 10 μM, and the single-stranded cDNA of the flower organ of Paphiopedilum was used as a template for PCR amplification reaction. The reaction system and procedure are shown in Table 1 below:

[0040] Table 1

[0041]

[0042] PCR products were detected by 1% agarose gel electrophoresis (see the results in Figure 1), the Magen (D2111) kit was used for gel recovery and purification, and the recovered product was connected to the Qingke cloning vector (007VS, pClone007 Versatile SimpleVector Kit, Beijing Qingke Biotechnology Co., Ltd.), and the connected vector was transformed using the Qingke DH5α competent state. After overnight culture, 2-4 single clones were randomly selected on the screening plate, and LB liquid culture medium containing Amp (100 mg / L) was used to expand and shake in a 2mL centrifuge tube until the bacterial solution was turbid, and the bacterial solution PCR enzyme (Cat. No. CW3009M) of Kangwei Century Biotechnology Co., Ltd. was used for positive detection, and the positive samples were sent to Beijing Qingke Biotechnology Co., Ltd. for sanger sequencing. The bacterial solution PCR reaction system and procedure are as shown in Table 2:

[0043] Table 2

[0044]

[0045] The sequencing results were compared with the transcriptome data and the results predicted by ORF finder (https: / / www.ncbi.nlm.nih.gov / orffinder / ). The results showed that the nucleotide sequence of the Paphiopedilum PcMYB1 gene was successfully cloned, as shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO.2.

[0046] 1.5 Analysis of the expression pattern of Paphiopedilum PcMYB1 gene

[0047] cDNAs from different tissues of Paphiopedilum, including roots, leaves, pedicels, sepals, petals and lip, were selected as templates to detect the expression pattern of the PcMYB1 gene. Actin was selected as the internal reference gene. The primers used (PcMYB1-qF, PcMYB1-qR, Pcactin-qF and Pcactin-qR) are shown in Table 3. Green qPCR SuperMix (Beijing Quanshijin Biotechnology Co., Ltd.) fluorescent quantitative dye was used for real-time quantitative PCR, and Ct was calculated using the Roche LightCycler 480 (Roche, Switzerland) system. The results showed that the PcMYB1 gene was highly expressed in the pedicels, sepals, petals and lip of Paphiopedilum callosum where anthocyanins were accumulated, while the expression level in the roots and leaves without anthocyanin accumulation was extremely low, indicating that high expression of the PcMYB1 gene in Paphiopedilum can increase the anthocyanin content ( Figure 2 ).

[0048] Table 3

[0049]

[0050] 1.6 Bioinformatics analysis of Paphiopedilum PcMYB1 gene

[0051] GeneDoc (version: v2.7) software was used to compare and analyze the amino acid sequences of genes; Clustal W in Mega software (version: v7.0.26) was used for multiple sequence alignment, and cluster analysis was performed using the neighbor-joining method, with the bootstrap value set to 1000. It was found that PcMYB1 and other orchid homologous proteins with known functions have a conserved domain, namely, R2R3 MYB ( Figure 4 ), so PcMYB1 belongs to the R2R3 MYB transcription factor subfamily. Phylogenetic analysis of PcMYB1 protein with homologous proteins involved in regulating anthocyanin synthesis in other species revealed that PcMYB1 protein is most closely related to the known anthocyanin positive regulatory transcription factor proteins in orchids ( Figure 3 ), so it is speculated that PcMYB1 protein is also involved in regulating the anthocyanin synthesis of Paphiopedilum.

[0052] 2. Construction and transformation of transient expression vector

[0053] 2.1 Construction of transient expression vector

[0054] According to the multiple cloning site region of the Super1300 vector, SpeⅠ was selected for restriction digestion. The coding region of PcMYB1 without the stop codon was seamlessly cloned into the overexpression vector using the Seamless Cloning and Assembly Kit (Beijing Quanshijin Biotechnology Co., Ltd.). The PcMYB1 fragment was amplified using the primers PcMYB1-super300-F and PcMYB1-super300-R (see Table 3) with added homology arms. The enzyme-cut fragment and the PcMYB1 fragment were then recovered and their concentrations were adjusted to be consistent. The homologous recombination reaction system is shown in Table 4:

[0055] Table 4

[0056]

[0057] 2.2 Transient expression vector transformation into Agrobacterium

[0058] Transform the constructed transient vector Super1300-PcMYB1 into competent Agrobacterium EHA105 as follows: Take out 100 μL of EHA105 competent Agrobacterium from the ultra-low temperature refrigerator, add 1 μg of the vector constructed in step 2.1 after melting, mix gently, and place on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes. Add 700 μL of LB liquid medium without antibiotics and shake and culture at 28°C for 2 hours. Centrifuge at 6000×g for 1 minute to collect the bacteria, retain about 100 μL of supernatant, gently blow and resuspend the bacteria, and apply it on the LB solid plate containing antibiotics (50 μg / mL Kan; 20 μg / mL Rif), and invert it in a 28°C incubator for 2 days. After a single clone colony grows, perform colony PCR detection, take the clone identified as positive by colony PCR and inoculate it into 2 mL of LB liquid medium containing antibiotics (50 μg / mL Kan; 20 μg / mL Rif), and culture it at 28°C 200rpm overnight. Then use glycerol to store Agrobacterium containing Super1300-PcMYB1 plasmid in a -80°C refrigerator for later use.

[0059] The experimental method for transforming empty vector Super1300 into competent Agrobacterium EHA105 was the same as that for transforming Super1300-PcMYB1.

[0060] 3. Transient transformation of PcMYB1 gene in Phalaenopsis

[0061] 3.1 Preparation of Agrobacterium infection solution

[0062] Take 50 μL of Agrobacterium culture containing Super1300-PcMYB1 plasmid and transformation empty vector (Super1300) and transfer them to conical flasks, add 50 mL of MS liquid medium containing antibiotics (50 μg / mL Kan; 20 μg / mL Rif) and continue to expand and shake until the OD value of the culture reaches between 0.6 and 0.8. Collect the bacteria after centrifugation at 5000×g for 5 minutes, discard the supernatant and add 20 mL of sterilized MS liquid medium to resuspend the bacteria, and then centrifuge at 5000×g for 5 minutes to collect the bacteria, discard the supernatant and add an appropriate amount of sterilized tobacco infection solution (10mM MgCl2+10mM MES+200μMAS, pH=5.8) to adjust the OD value of the culture to between 0.8 and 1.0. After standing at room temperature for 0.5 hours, it can be used for the next injection.

[0063] 3.2 Instantaneous transformation in Phalaenopsis petals

[0064] Use a needle to make a small wound on the back of the Phalaenopsis petals, and then use a 1ML syringe to slowly inject the Agrobacterium infection solution into the Phalaenopsis petals from the wound until the bacterial solution fills the entire petal. After the injected Phalaenopsis is cultured in the dark overnight, it returns to normal culture. The culture conditions are 28℃ for 10 hours during the day and 25℃ for 14 hours in the dark, and a high humidity range is maintained. The results showed that after five days of culture, obvious anthocyanin accumulation appeared at the injection site of the Phalaenopsis petals, causing the white Phalaenopsis tepals to turn red. This result shows that PcMYB1 can change the flower color of orchids ( Figure 5 ).

[0065] 3.3 Determination of PcMYB1 expression and anthocyanin content in Phalaenopsis petals

[0066] The expression of PcMYB1 gene in the empty-transformed and over-expressed Phalaenopsis was detected by real-time quantitative PCR (the detection method was the same as step 1.5, the primers were PcMYB1-qF, PcMYB1-qR, Peactin-qF and Peactin-qR, the sequences were shown in Table 3). The results showed that the expression level of PcMYB1 gene in the over-expressed plants was much higher than that in the empty-transformed materials ( Figure 6 ). The content of anthocyanins in the petals of untransfected and overexpressed Phalaenopsis orchids was determined by pH differential method. The steps are as follows: Take 0.1g of fresh leaf and petal materials, grind the sample into powder using a ball mill in a liquid nitrogen environment, then transfer all the samples to a 5mL centrifuge tube, add anthocyanin extract (1% hydrochloric acid methanol, v / v) and vortex to mix it thoroughly, place it in a refrigerator at 4℃ away from light for 24h, and centrifuge it at 12000×g for 5min to remove impurities to obtain anthocyanin extract. The extract and two buffers (KCl buffer at pH 1 and NaAc buffer at pH 4.5) were mixed in a volume ratio of 1:4, and the solvent was used as a blank control. It was placed at room temperature away from light for 20-30min. Add it to a 500μL cuvette with a light path of 1cm, and measure the absorbance values ​​at 520nm and 700nm using a UV spectrophotometer.

[0067] Anthocyanin content (mg / g) = ΔD*V*F*M*1000 / (ε*m), where

[0068] ΔD=(A520 nm-A700 nm)pH 1.0-(A520 nm-A700 nm)pH 4.5;

[0069] V: dilution volume (unit L);

[0070] F: dilution factor;

[0071] M: The relative molecular mass of cyanidin-3-glucoside is 449.2 g / mol;

[0072] ε: The molar extinction coefficient of cyanidin-3-glucoside is 26900 L / (mol*cm);

[0073] m: sample mass (unit: g).

[0074] The results showed that the anthocyanin content in the petals of PcMYB1 gene overexpression was 110.65 μg / g, while no anthocyanin was detected in the petals of the unexpressed plants ( Figure 7 ). This indicates that PcMYB1 successfully induced anthocyanins in white Phalaenopsis, thereby changing the flower color.

[0075] 4. Stable overexpression of PcMYB1 gene in tobacco

[0076] 4.1 Tobacco Agrobacterium infection solution

[0077] The constructed PcMYB1 gene overexpression vector Super1300-PcMYB1 and the empty vector Super1300 were transformed into competent Agrobacterium EHA105, and the infection solution for transforming tobacco leaf discs was prepared in the same steps as the instantaneous transformation infection solution for Phalaenopsis (step 3.1). The prepared Agrobacterium infection solution was allowed to stand at room temperature for 2-3 hours in the dark before being used for the next transformation.

[0078] 4.2 Leaf disc method for tobacco transformation

[0079] Select the aseptic tobacco seedlings that have been cultivated for about two months, cut the main vein of the leaves with sterilized scissors, and cut the leaf discs on both sides into 0.2-0.5cm 2 The cubes were immediately transferred to a sterile culture dish containing Agrobacterium infection solution, stirred gently, and the infection time was controlled at about 10-15 minutes. After that, the bacteria solution was dried with sterile filter paper, and then transferred to the co-culture medium, with the leaves facing up, and co-cultured in a dark environment (25℃ shaded) for 3 days. 1L co-culture medium contains: 4.43g MS + 30g sucrose + 6g agar + 2mg 6-BA + 0.2mg NAA, pH = 5.8.

[0080] Washing bacteria and screening culture: The leaf discs after co-cultivation need to be sterilized, and the leaf discs are washed 3-4 times with sterile water containing 400 mg / L cephalosporin, and then washed once with sterile water. After drying with sterile filter paper, they are inoculated into tobacco screening medium. 1L screening medium contains: 4.43g MS + 30g sucrose + 6g agar + 2mg 6-BA + 0.2mg NAA + 20μL 10% Basta + 400mg cephalosporin, pH = 5.8.

[0081] Rooting culture: When the adventitious buds that survived in the screening medium grew to more than 3 cm, they were cut and inoculated into the rooting medium for rooting culture (26°C, 8000 Lux during the day and 25°C, 0 Lux at night). After rooting, the seedlings were transplanted into a light culture box at 28°C, 10000 Lux during the day and 25°C, 0 Lux at night for culture. The transplanting matrix selected a volume ratio of peat soil: vermiculite = 3:1. PCR-identified positive tobacco (reference: Construction of sweet potato IbNPR1 gene expression vector and transformation of tobacco, Chen Guanshui et al., 2009) was cultured until the flowering stage. The results showed that the corolla of tobacco transformed with the PcMYB1 gene was significantly darker than that of the untransfected flowers, showing a dark red color ( Figure 8 ). 1L rooting medium contains: 4.43g MS + 30g sucrose + 6g agar + 20μL 10% Basta + 200mg cephalosporin, pH = 5.8.

[0082] 4.3 Determination of anthocyanin content in tobacco corolla

[0083] The method for determining anthocyanin content in tobacco corolla is the same as that for determining anthocyanin content in Phalaenopsis petals, both of which are pH differential method. The results showed that the anthocyanin content in tobacco corolla with PcMYB1 gene was significantly increased, which was 3.66 times higher than that in untransfected corolla ( Fig. 9 ).

[0084] SEQ ID NO.1

[0085] ATGAACAAGAAGACTTGTT GTACCAAAGATGGACTCAACAGGGGGAGCTTGGACTGTTCCCGAGGACAACCTTTTGGTCTCCTACATCAATGCTCATGGAGAAGGCAAATGGAGCAGAGTTCCCATGGAAGCAGGGCTCAAGCGAAGCGGGAAGAGCTGCCGACTTCGGTGGCTGAACTATCTTTCCCCAAACATCAAACGGGGAAACTTCTCCGAGGAAGAGGAGGATCTCATCATCAGACTCCAGAAG CTCCTCGGCAATAGGTGGTC TTTGATTGCTGGAAGGTTACCCGGCCGAACTGACAATGGGATAAAGAACTTCTGGAACACAACATTAGTGAAGAAGGTGCGCAGCCAGCAGCCTTCAACGAAGAAACCGTGC ACTCATGCGACAAGACCGTTATGCAAAACCAAAGTAACCACGGCACCACCGGCGGCATCGCCACCAGCTCCCCAAGATGAAACTGTTTTGATCCGTACCAAGGCCATTAAGTGCAACAGAGCTTATTTCCCTGGTTCCCGTGTGATTTCATCTTCTCCATCTGCAGAGCCGGAAGAGACCCCTGTAGTCCCTCAAATAATGCAACAGGAAGATACCATAGTAAGTAGAGAGAATAACAGTTTCGACCTTCATTTCGACTCTTTGTACGATGCTATGGATTTACAGGGATGGTTCCAGTTTGATGCTGAGGTTG ATGCATGGTGCTTAGGC TGASEQ ID NO.2

[0086] MNKKTCCTKDGLNRGAWTVPEDNLLVSYINAHGEGKWSRVPMEAGLKRSGKSCRLRWLNYLSPNIKRGNFSEEEEDLIIRLQKLLGNRWSLIAGRLPGRTDNGIKNFWNTTLVKKVRSQQPSTKKPCTHATRPLCKTKVTTAPPAASPPAPQDETVLIRTKAIKCNRAYFPGSRVISSSPSAEPEETPVVPQIMQQEDTIVSRENNSFDLHFDSLYDAMDLQGWFQFDAEVDAWCLG

Claims

1. Paphiopedilum PCMYB1 protein, whose amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding the Paphiopedilum PCMYB1 protein according to claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

4. A recombinant plant expression vector containing the coding gene according to claim 2.

5. Use of the Paphiopedilum PCMYB1 protein according to claim 1, the encoding gene according to claim 2 or the expression vector according to claim 4 in changing the flower color of a plant.

6. The use according to claim 5, characterized in that The changing of plant flower color is to regulate the content of anthocyanins in the plant.

7. The use according to claim 6, characterized in that The regulation of the anthocyanin content in the plant is to increase the expression amount and / or activity of the PCMYB1 protein in the plant to increase the anthocyanin content.

8. A method for changing the flower color of a plant, characterized in that: The following steps are involved: The PCMYB1 gene is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are then cultivated into plants to stably overexpress the PCMYB1 in the plants; or the PCMYB1 gene is transiently transformed in the floral organs of the plants, and the nucleotide sequence of the PCMYB1 gene is shown in SEQ ID NO.

1.

9. A method for increasing the anthocyanin content in plants, characterized in that: The following steps are involved: The PCMYB1 gene is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are then cultivated into plants to stably overexpress the PCMYB1 in the plants; or the PCMYB1 gene is transiently transformed in plant tissues or organs, and the nucleotide sequence of the PCMYB1 gene is shown in SEQ ID NO.

1.

10. The method according to claim 8 or 9, characterized in that: The PCMYB1 gene is introduced into plant cells, tissues or organs via a plant expression vector, and the plant is Phalaenopsis or tobacco.

Images