New mutant protein improves malate production

Abstract

The present invention provides a new mutant protein for increasing malic acid production. Specifically, the present invention provides a new pyruvate carboxylase mutant protein and a malic acid transporter mutant protein or a combination thereof, as well as a preparation method thereof and an application thereof in increasing malic acid production.

Description

[0001] This application is a divisional application of the invention patent application with application date of October 19, 2018, application number 201811223531.1, and invention name “New mutant protein for improving malic acid production”. Technical Field

[0002] The invention belongs to the field of biotechnology, and in particular, relates to new mutant proteins of pyruvate carboxylase and malate transporter in malate synthesis pathway and applications thereof. Background Art

[0003] Malic acid (2-hydroxy-1,4-butanedioic acid) is an important platform compound that is widely used in the pharmaceutical, cosmetic, food and beverage industries. In the past, the synthesis was mainly carried out by chemical methods, but the process mainly produced a mixture of D- and L-malic acid, which was difficult to separate.

[0004] There are five main pathways reported for malic acid synthesis, namely TCA cycle, reduced TCA (or reverse TCA) rTCA, cyclic glyoxylate cycle and non-cyclic glyoxylate cycle, and direct synthesis of malic acid from pyruvate by reverse catalysis of malic enzyme. Among them, the rTCA cycle and malic enzyme pathway are the most effective, with a theoretical conversion rate of glucose to malic acid of 2. However, malic enzyme mainly catalyzes the decomposition of malic acid into pyruvic acid. Therefore, the most commonly used method is the rTCA pathway to synthesize malic acid.

[0005] Glucose is converted into pyruvate through glycolysis, pyruvate is converted into oxaloacetate through pyruvate carboxylase, oxaloacetate is converted into malate through apple dehydrogenase, and malate is transported out of the cell through transporters. The conversion efficiency of each step in the process, the diversion of side reactions, the coenzymes and reducing power that catalyze each step of the reaction, and the energy status of the cell will all affect malate synthesis.

[0006] There are three key indicators in malic acid synthesis, namely yield, production capacity and conversion rate. In order to construct efficient malic acid-producing strains, people have constructed malic acid synthesis pathways in multiple species, such as Saccharomyces cerevisiae, Pichia pastoris, Escherichia coli, Aspergillus spp., Torulopsis glabrata, Ustilago trichophora, Bacillus subtilis and Thermobifida fusca (Dai et al., Current advance in biological production of malic acid using wild type and metabolic engineered strains. Bioresour Technol. 2018, 258: 345-353. Liu et al., Biological production of L-malate: recent advances and future prospects. World J Microbiol Biotechnol. 2017, 34(1): 6.). However, these works mainly attempted to construct malic acid synthesis pathways in different species and perform partial optimization, such as selecting promoters of different strengths to express key enzymes in malic acid synthesis to improve malic acid synthesis capacity. However, this requires a multiple rounds of combination process and overexpression of key enzymes will also impose additional burden on cells.

[0007] Therefore, there is an urgent need in the art to develop a method for directly and efficiently obtaining pure malic acid. Summary of the invention

[0008] The invention provides a new mutant protein of pyruvate carboxylase in malate synthesis pathway and malate transporter and application thereof.

[0009] In a first aspect, the present invention provides a pyruvate carboxylase mutant protein, wherein the pyruvate carboxylase mutant protein is based on the sequence shown in SEQ ID NO: 1 (wild type), and has a core amino acid mutation selected from one or more of the following sites:

[0010] A762D, A762P, A762V, or A762T; and / or

[0011] P826E, P826Q, P826Y, P826T, P826D or P826I;

[0012] The pyruvate carboxylase mutant protein has the activity of carboxylating pyruvate to synthesize oxaloacetate, a precursor of malic acid.

[0013] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation selected from one or more of the following sites:

[0014] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T; and / or

[0015] P1031E, 1031S, P1031N, or P1031G.

[0016] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation selected from one or more of the following sites:

[0017] G837D or G837H;

[0018] A254K, A254E, A254R, or A254F;

[0019] H51N, or H51G; and

[0020] F453E, or F453P.

[0021] In another preferred embodiment, the pyruvate carboxylase mutant protein is derived from wild-type pyruvate carboxylase.

[0022] In another preferred embodiment, the wild-type pyruvate carboxylase is derived from Corynebacterium glutamicum

[0023] In another preferred embodiment, the pyruvate carboxylase mutant protein also includes its active fragment, variant form or derivative protein, which has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the pyruvate carboxylase mutant protein, and has the activity of carboxylating pyruvate to synthesize malic acid precursor oxaloacetate.

[0024] In another preferred embodiment, except for one or more core amino acid mutations, the remaining sequence of the pyruvate carboxylase mutant protein-derived protein is identical or substantially identical to the sequence shown in SEQ ID NO: 1.

[0025] In another preferred embodiment, the sequence of the pyruvate carboxylase mutant protein has core amino acid mutations at the following sites compared with SEQ ID NO: 1 (wild type):

[0026] A762D and P826E;

[0027] A762D and P824V;

[0028] P824V and P826E

[0029] P824V and P1031E; or

[0030] A762D, P826E and P1031E.

[0031] In another preferred embodiment, the pyruvate carboxylase mutant protein is shown in SEQ ID NO: 2-20, 175.

[0032] In a second aspect of the present invention, a malate transporter mutant protein is provided, wherein the malate transporter mutant protein is based on the sequence shown in SEQ ID NO: 22, and has a core amino acid mutation selected from one or more of the following sites:

[0033] I80K, I80W, or I80C; and

[0034] R272A or R272F;

[0035] The malate transporter mutant protein has the activity of transporting malate from inside cells to outside cells.

[0036] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation selected from one or more of the following sites:

[0037] E8Q, E8Y, E8R, or E8P; and / or

[0038] V142I, V142S, or V142C.

[0039] In another preferred embodiment, the pyruvate carboxylase mutant protein further has a core amino acid mutation at one or more sites selected from the following group:

[0040] F97V, or F97R;

[0041] F101Y or F101W;

[0042] Y115E;

[0043] S123K, S123H, S123R, or S123D;

[0044] I301W, I301F, I301H, I301K, or I301Y;

[0045] L140N, L140H, or L140K;

[0046] P163I, P163V, P163F, P163L, P163Q, or P163Y;

[0047] A191R, or A191K;

[0048] F201Q, F201G, F201N or F201K;

[0049] A214V, A214G or A214D;

[0050] E222S or E222H;

[0051] H227F, or H227W; and / or

[0052] M251E, or M251G.

[0053] In another preferred embodiment, the sequence of the malate transporter mutant protein has core amino acid mutations at the following sites compared with SEQ ID NO: 22 (wild type):

[0054] I80K and R272A; or

[0055] I80K, E8Q and R272A.

[0056] In another preferred embodiment, the sequence of the malate transporter mutant protein is as shown in SEQ ID NO: 23-42, 176.

[0057] In another preferred embodiment, the malate transporter mutant protein also includes its active fragment, variant form or derivative protein, and the active fragment, variant form or derivative protein of the malate transporter mutant protein has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the malate transporter mutant protein, and has the activity of transporting malate from inside the cell to outside the cell.

[0058] The third aspect of the present invention provides an isolated polynucleotide or a combination thereof, wherein the polynucleotide or the combination thereof encodes the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention.

[0059] In another preferred embodiment, the isolated polynucleotides respectively encode the pyruvate carboxylase mutant protein described in the first aspect of the present invention or the malate transporter mutant protein described in the second aspect of the present invention.

[0060] In another preferred embodiment, the isolated polynucleotide combination contains polynucleotides encoding both the pyruvate carboxylase mutant protein described in the first aspect of the present invention and the malate transporter mutant protein described in the second aspect of the present invention.

[0061] The fourth aspect of the present invention provides a vector, wherein the vector contains the isolated polynucleotide described in the third aspect of the present invention.

[0062] In another preferred embodiment, the expression vector contains the protein encoding the pyruvate carboxylase mutant protein described in the first aspect of the present invention and the malate transporter mutant protein described in the second aspect of the present invention.

[0063] The fifth aspect of the present invention provides a host cell, wherein the host cell contains the vector described in the fourth aspect of the present invention, or the isolated polynucleotide described in the third aspect of the present invention is integrated into the nucleic acid of the host cell.

[0064] In another preferred embodiment, the host cell includes cells derived from the following microorganisms: Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Saccharomyces pombe, Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipites, Candida shehatae, Candida tropicalis, Escherichia coli, Bacillus subtilis, Torulopsis glabrata), Aspergillus oryzae, Rhizopus oryzae, Ustilago trichophora, Thermobifida fusca, Myceliophthora thermophila, Myceliophthora heterothallica.

[0065] In another preferred embodiment, the host cell includes Saccharomyces cerevisiae, Pichia pastoris or Myceliophthora thermophila.

[0066] In another preferred embodiment, the host cell only expresses pyruvate carboxylase mutant protein.

[0067] In another preferred embodiment, the host cell only expresses a malate transporter mutant protein.

[0068] In another preferred embodiment, the host cell simultaneously expresses a pyruvate carboxylase mutant protein and a malate transporter mutant protein.

[0069] In a sixth aspect, the present invention provides a method for preparing the pyruvate carboxylase mutant protein of the first aspect of the present invention and / or the malate transporter mutant protein of the second aspect of the present invention, comprising the steps of:

[0070] Cultivating the host cell of the fifth aspect of the present invention under conditions suitable for expression, thereby expressing the pyruvate carboxylase mutant protein of the first aspect of the present invention and / or the malate transporter mutant protein of the second aspect of the present invention; and

[0071] The expression product is isolated to obtain the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention.

[0072] In a seventh aspect, the present invention provides a method for increasing malic acid production, comprising the steps of:

[0073] i) introducing the polynucleotide or combination thereof described in the third aspect of the present invention into a suitable host cell;

[0074] ii) culturing the host cell in the presence of a carbon source, thereby increasing the production of malic acid.

[0075] In another preferred embodiment, the carbon source includes glucose, sucrose, galactose, xylose, glycerol, or methanol.

[0076] In another preferred embodiment, the suitable host cells include cells derived from the following microorganisms: Pichia pastoris, Saccharomyces cerevisiae and / or Myceliophthora thermophila, Myceliophthora heterothallus.

[0077] The eighth aspect of the present invention provides a mutant protein combination, wherein the mutant protein combination comprises the pyruvate carboxylase mutant protein described in the first aspect of the present invention, and the malate transporter mutant protein described in the second aspect of the present invention.

[0078] In the ninth aspect, the present invention provides the use of the pyruvate carboxylase mutant protein described in the first aspect of the present invention and / or the malate transporter mutant protein described in the second aspect of the present invention, the isolated polynucleotide or a combination thereof described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, the host cell described in the fifth aspect of the present invention, or the mutant protein combination described in the eighth aspect of the present invention, for increasing malic acid production and / or for preparing malic acid.

[0079] In another preferred embodiment, the increase in malic acid production includes at least a 10% increase in malic acid production compared to a wild-type strain producing malic acid, preferably at least a 20%, 30%, 40%, or 50% increase.

[0080] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1A map of the pyc expression plasmid is shown.

[0082] Figure 2 A map of the mdh expression plasmid is shown.

[0083] Figure 3 A map of the mdh and pyc tandem expression plasmids is shown.

[0084] Figure 4 Plasmid maps for comparative expression and directed evolution of dicarboxylate transporters are shown.

[0085] Figure 5 Aomae expression plasmid map is shown.

[0086] Figure 6 The pyc directed evolution transformation plasmid map is shown.

[0087] Figure 7 The results show that overexpression of pyc and mdh produces malate, and the effects of overexpression of different transporters on malate production are shown.

[0088] Figure 8 The initial screening of the modified spot plate for hydrolysis circle-based transporter screening is shown.

[0089] Fig. 9 The effect of Aomae I80 saturation mutation on malic acid production was shown, among which I80K, I80W, and I80C increased malic acid production by 14.3%, 11.3%, and 11.5%, respectively.

[0090] Fig.10 The effect of Aomae V142 saturation mutation on malic acid production was shown, among which V142I, V142S, and V142C increased malic acid production by 21.1%, 16.2%, and 14.1%, respectively.

[0091] Fig.11 The effect of Aomae R272 saturation mutation on malic acid production was shown, among which R272A and R272F increased malic acid production by 21% and 22.1%, respectively.

[0092] Fig.12 The effects of Aomae E8 saturation mutations on malic acid production were shown, among which E8Q, E8Y, E8R, and E8P increased malic acid production by 15.5%, 10.3%, 9.3%, and 10.7%, respectively.

[0093] Fig.13 The results show the effect of Aomae I 109 saturation mutation on malic acid production, among which I 109M and I109P increased malic acid production by 12% and 10.2%, respectively.

[0094] Fig.14The effect of Aomae S123 saturation mutation on malic acid production was shown. S123, S123H, S123R, and S123D increased malic acid production by 27.4%, 28.2%, 23.4%, and 23.6%, respectively.

[0095] Fig.15 The effect of Aomae I301 saturation mutation on malic acid production was shown. I301W, I301F, I301H, I301K, and I301Y increased malic acid production by 25.2%, 18.6%, 18.3%, 17.6%, and 17.6%, respectively.

[0096] Fig.16 The effects of Aomae P163 saturation mutations on malic acid production were shown, among which P163I, P163V, P163F, P163L, P163Q, and P163Y increased malic acid production by 27.4%, 25.2%, 20.6%, 18.1%, 16.5%, and 15.3%, respectively.

[0097] Fig.17 The effect of Aomae F101 saturation mutation on malic acid production was shown, among which F101Y and F101W increased malic acid production by 25% and 21%, respectively.

[0098] Fig.18 The effect of Aomae L140 saturation mutation on malic acid production was shown, among which L140N, L140K, and L140H increased malic acid production by 22%, 10%, and 20%, respectively.

[0099] Fig.19 The effect of Aomae F97 saturation mutation on malic acid production was shown, among which F97V and F97R increased malic acid production by 25% and 22.7%, respectively.

[0100] Fig. 20 The effect of Aomae A191 saturation mutation on malic acid production was shown, among which A191R and A191K increased malic acid production by 29.2% and 22.6%, respectively.

[0101] Fig.21 The effect of Aomae Y115 saturation mutation on malic acid production was shown, among which Y115E and Y115L increased malic acid production by 28% and 16%, respectively.

[0102] Fig. 22 The effect of Aomae A214 saturation mutation on malic acid production was shown, among which A214V, A214G, and A214D increased malic acid production by 25%, 22.1%, and 21.3%, respectively.

[0103] Fig.23 The effects of Aomae F201 saturation mutations on malic acid production were shown, among which F201Q, F201G, F201K, and F201N increased malic acid production by 32%, 22%, 18%, and 19%, respectively.

[0104] Fig.24 The effect of Aomae H227 saturation mutation on malic acid production was shown, among which H227F and H227W increased malic acid production by 22% and 18%, respectively.

[0105] Fig.25 The effect of Aomae E222 saturation mutation on malic acid production was shown, among which E222S and E222G increased malic acid production by 22% and 22%, respectively.

[0106] Fig.26 The effect of Aomae M251 saturation mutation on malic acid production was shown, among which M251E and M251G increased malic acid production by 28% and 23% respectively.

[0107] Fig. 27 The effects of Aomae combined mutations on malic acid production were shown, among which I80K / R272A could increase malic acid production by more than 30%.

[0108] Fig.28 The results show the influence of pyc from different sources on malic acid production, among which the highest malic acid production by Corynebacterium glutamicum reached 53.2 g / L.

[0109] Fig.29 Shown is a spot plate screening of PYC based on hydrolysis circles

[0110] Fig.30 The effect of CgPyc H51 saturation mutation on malic acid production was shown, among which H51N and H51G increased malic acid production by 19% and 18%, respectively.

[0111] Fig.31 The effect of CgPyc F453 saturation mutation on malic acid production was shown, among which F453E and F453P increased malic acid production by 17% and 17%, respectively.

[0112] Fig.32 The effect of CgPyc A254 saturation mutation on malic acid production was shown, among which A254K, A254E, A254R, and A254F increased malic acid production by 19%, 17%, 16%, and 15%, respectively.

[0113] Fig.33The effect of CgPyc G837 saturation mutation on malic acid production was shown, among which G837D and G837H increased malic acid production by 24% and 17%, respectively.

[0114] Fig.34 The effects of CgPyc P824 saturation mutations on malic acid production were shown, among which P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, and P824T increased malic acid production by 29.4%, 28.2%, 25.9%, 22.4%, 23.5%, 23.5%, 23.6%, 23.2%, and 20%, respectively.

[0115] Fig.35 The effects of saturated mutations of CgPyc A762 on malic acid production were shown, among which A762D, A762P, A762V, and A762T increased malic acid production by 33.5%, 30.6%, 29.6%, and 22.4%, respectively.

[0116] Fig.36 The effects of CgPyc P826 saturation mutations on malic acid production were shown, among which P826E, P826Q, P826Y, P826T, P826D, and P826I increased malic acid production by 28.3%, 20.9%, 24.1%, 22.9%, 20.9%, and 21.6%, respectively.

[0117] Fig.37 The effect of CgPyc P1031 saturation mutation on malic acid production was shown, among which P1031E, P1031N, P1031S, and P1031G increased malic acid production by 34.2%, 30.8%, 128.2%, and 122.2%, respectively.

[0118] Fig.38 The effects of CgPyc combination mutations on malic acid production were shown, among which A762D / P826E, A762D / P824V, P824V / P826E, P824V / P1031E, and A762D / P826E / P1031E increased malic acid production by 41.4%, 38.6%, 36.7%, 37.1%, and 42.3%, respectively.

[0119] Fig.39 It was shown that Saccharomyces cerevisiae expressed PYC, AoMae and MDH to produce malic acid, among which the strain co-expressing the three genes could produce 22 g / L malic acid.

[0120] Fig.40 The malic acid production of the strain after overexpression of the modified malic acid transporter. Among them, the malic acid production increased by 9.5% by overexpressing the mutant AomaeI80K / R272A.

[0121] Fig.41 The malic acid production of the pyruvate carboxylase overexpression-modified strain, wherein the overexpression mutant CgPYCA762D / P826E / P1031E increased the malic acid production by 16%. DETAILED DESCRIPTION

[0122] The inventors, through extensive and in-depth research, unexpectedly discovered for the first time that the catalytic machinery and transporter for malic acid synthesis are transformed, that is, the core amino acids at specific sites of pyruvate carboxylase and malic acid transporter are mutated, and the ability of microbial strains to produce malic acid is significantly improved, so that more pyruvic acid precursors can flow to the target product malic acid, thereby effectively increasing the yield of malic acid. Specifically, the inventors first constructed a high-throughput screening scheme for malic acid synthesis coupling in Pichia pastoris, compared pyruvate carboxylase and malic acid transporter from different sources, found the target protein to be transformed, constructed random mutation libraries for the two target proteins, obtained pyruvate carboxylase and malic acid transporter mutants with improved malic acid yield after multiple screenings, then carried out single amino acid saturation mutation and combined mutation, obtained pyruvate carboxylase mutants with improved catalytic activity and malic acid transporter mutants with improved malic acid transport capacity, and constructed a series of engineering strains for efficiently synthesizing malic acid. On this basis, the present invention has been completed.

[0123] Malic acid and its synthesis

[0124] Malic acid (2-hydroxy-1,4-butanedioic acid) is an important platform compound that is widely used in the pharmaceutical, cosmetic, food and beverage industries.

[0125] There are five main pathways reported for malic acid synthesis, namely TCA cycle, reduced TCA (or reverse TCA) rTCA, cyclic glyoxylate cycle and non-cyclic glyoxylate cycle, and direct synthesis of malic acid from pyruvate by reverse catalysis of malic enzyme. Among them, the rTCA cycle and malic enzyme pathway are the most effective, with a theoretical conversion rate of glucose to malic acid of 2. However, malic enzyme mainly catalyzes the decomposition of malic acid into pyruvic acid. Therefore, the most commonly used method is the rTCA pathway to synthesize malic acid.

[0126] Glucose is converted into pyruvate through glycolysis, pyruvate is converted into oxaloacetate through pyruvate carboxylase, oxaloacetate is converted into malate through apple dehydrogenase, and malate is transported out of the cell through transporters. The conversion efficiency of each step in the process, the diversion of side reactions, the coenzymes and reducing power that catalyze each step of the reaction, and the energy status of the cell will all affect malate synthesis.

[0127] In the past, the synthesis mainly adopted chemical methods, but the process mainly produced a mixture of D and L-malic acid, which was difficult to separate. However, the present invention adopts a microbial method to synthesize high-purity L-malic acid.

[0128] Pyruvate carboxylase

[0129] Pyruvate carboxylase (Pyruvate carboxylase, PYC) is one of the key enzymes participating in the central metabolic pathway in the organism, and forms oxaloacetic acid by carboxylating pyruvate to participate in the TCA cycle, and this step reaction is also the first step reaction of the gluconeogenesis pathway simultaneously. Most of pyruvate carboxylases are composed of four identical subunits, and the molecular weight of a single subunit is 120-130kDa, and the tetramer molecular weight of its function is about 520kDa. Pyruvate carboxylase needs tetramerization to function, and the protein after this tetramerization has as much as 520kDa, and it is difficult to be secreted into the extracellular, although pyruvate carboxylase can be screened by the method for measuring enzyme activity, but it can only reside in the cell, and broken cells are needed to carry out enzyme activity determination, and it is difficult to implement if all mutants in a mutant library are subjected to wall-breaking treatment, and it is very difficult to transform this protein. Currently, there are only a few site-directed mutagenesis based on crystal structures targeting specific sites in the modification of this type of complex-forming proteins, and the mutants involved are very few. Protein engineering has not been performed on CgPYC, which has no crystal structure.

[0130] The pyruvate carboxylase of the present invention is derived from Corynebacterium glutamicum, and its wild type (named as CgPYC) sequence number is WP_011013816.1, the sequence is shown in SEQ ID NO:1, and the encoding nucleic acid is shown in SEQ ID NO:21. It is used for the first time in the strain of malic acid synthesis. By constructing random mutation, site-directed mutation and combined mutation, a plurality of single-point mutations that can significantly improve the synthesis of malic acid by more than 30% of Pichia pastoris and two double mutations and triple mutations that can improve malic acid by more than 40% are obtained. At the same time, the mutant protein can also improve malic acid by 16% in thermophilic myceliophthora.

[0131] Malate transporter

[0132] Malic acid transporter plays an important role in the synthesis of malic acid. The transporter for malic acid production of the present invention mainly includes transporters derived from Aspergillus oryzae (AO090023000318 (C4T318)), the protein sequence of the wild type (named as AoMae) is shown in SEQ ID NO: 22, and the encoding nucleic acid thereof is shown in SEQ ID NO: 43; transporters derived from Schizosaccharomyces pombe (NM_001020205.2) and DCT derived from Aspergillus carbonarius (AQW79505.1), wherein the key AoMae protein has a theoretical molecular weight of 42.2 kDa.

[0133] The malate transporter Aomae is a membrane protein. The usual evaluation standard for membrane proteins is to measure the substrate transport ability. The protein needs to be purified and constructed in liposomes, or constructed in a multi-gene knockout strain without a similar functional transport protein, and then measured using isotope-labeled substrates. In addition, transport is divided into efflux and endosome types, and the protein consistency of membrane proteins is generally low. These factors have caused great difficulties in modifying membrane proteins.

[0134] The present invention obtains a series of mutation sites through random mutation, site-directed mutation and combined mutation, which can significantly improve the level of malic acid synthesis, among which I80K / E8Q / R272A and I80K / R272A can improve the malic acid synthesis of Pichia pastoris by more than 30%, and can also improve the malic acid synthesis in thermophilic Myceliophthora by 10.5%.

[0135] Mutant proteins and their derivatives

[0136] Those skilled in the art know that if a certain enzyme is to be mutated in order to obtain a mutant with improved activity, the key is to find a site that can improve the activity after mutation. In the present invention, the enzyme of the amino acid sequence such as SEQ ID NO:1 and 22 is mutated at a specific site to obtain a corresponding mutant with significantly improved activity. As used herein, the terms "mutant" and "mutant" are used interchangeably and refer to a mutant of pyruvate carboxylase and / or malate transporter, and its correspondence with pyruvate carboxylase mutant or malate transporter mutant can be obtained in the context of the context. Specifically, pyruvate carboxylase mutant of the present invention generally refers to the sequence shown in SEQ ID NO:1 and / or 22 (wild type), and has a core amino acid mutation selected from one or more of the following sites after modification:

[0137] ① When the sequence shown in SEQ ID NO: 22 is mutated, the core amino acid mutation may be selected from one or more of the following sites:

[0138] A762D, A762P, A762V, or A762T;

[0139] P826E, P826Q, P826Y, P826T, P826D or P826I;

[0140] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T;

[0141] P1031E, 1031S, P1031N or P1031G;

[0142] P824V, P824A, P824I, P824Y, P824L, P824M, P824N, P824R, or P824T;

[0143] P1031E, 1031S, P1031N or P1031G;

[0144] G837D or G837H;

[0145] A254K, A254E, A254R, or A254F;

[0146] H51N, or H51G; and / or

[0147] F453E, or F453P.

[0148] The pyruvate carboxylase mutant protein has the activity of carboxylating pyruvate to synthesize oxaloacetate, a precursor of malic acid;

[0149] A preferred pyruvate carboxylase mutant protein, based on the sequence shown in SEQ ID NO: 1, has a core amino acid mutation selected from one or more of the following sites:

[0150] A762D and P826E;

[0151] A762D and P824V;

[0152] P824V and P826E

[0153] P824V and P1031E; or

[0154] A762D, P826E and P1031E.

[0155] A preferred sequence of a pyruvate carboxylase mutant protein is shown in any one of SEQ ID NOs: 2-20 and 175.

[0156] ② When the sequence shown in SEQ ID NO: 22 is mutated, the core amino acid mutation may be selected from one or more of the following sites:

[0157] I80K, I80W, or I80C;

[0158] R272A or R272F;

[0159] E8Q, E8Y, E8R, or E8P;

[0160] V142I, V142S or V142C;

[0161] F97V, or F97R;

[0162] F101Y or F101W;

[0163] Y115E;

[0164] S123K, S123H, S123R, or S123D;

[0165] I301W, I301F, I301H, I301K, or I301Y;

[0166] L140N, L140H, or L140K;

[0167] P163I, P163V, P163F, P163L, P163Q, or P163Y;

[0168] A191R, or A191K;

[0169] F201Q, F201G, F201N or F201K;

[0170] E222S or E222G;

[0171] H227F, or H227W; and / or

[0172] M251E, or M251G.

[0173] The malate transporter mutant protein has the activity of transporting malate from inside the cell to outside the cell.

[0174] A preferred malate transporter mutant protein, based on the sequence shown in SEQ ID NO: 22, has a core amino acid mutation selected from one or more of the following sites:

[0175] I80K and R272A; or

[0176] I80K, E8Q and R272A.

[0177] The sequence of a preferred malate transporter mutant protein is shown in any one of SEQ ID NOs: 23-42 and 176.

[0178] In view of the teachings of the present invention and the prior art, those skilled in the art should understand that the mutant protein of the present invention should also include active fragments, modified or unmodified variant forms or derivative proteins thereof.

[0179] Specifically, the active fragment, variant form or derivative protein of the pyruvate carboxylase mutant protein includes a sequence based on SEQ ID NO: 2-20, and has one or more (for example, usually 1-30, preferably 1-10, more preferably 1-6, more preferably 1-3, and most preferably 1) amino acid residues deleted, inserted and / or substituted, and still has the activity (cA1) of carboxylating pyruvate to synthesize malic acid precursor oxaloacetate, and the activity is significantly higher than the corresponding activity (cA0) of the wild-type pyruvate carboxylase shown in SEQ ID NO: 1, and the significantly higher is any value in the range of (cA1-cA0) / cA0≥10%-500%, for example ≥15%, 20%, 25%, 30%, 40%, 50%, or 100%.

[0180] The active fragment, variant form or derivative protein of the malate transporter mutant protein includes a protein based on the sequence shown in SEQ ID NO: 23-42, and has one or several (for example, usually 1-30, preferably 1-10, more preferably 1-6, more preferably 1-3, and most preferably 1) amino acid residues deleted, inserted and / or substituted, and still has the activity (aA1) of transporting malate from inside the cell to outside the cell, and the activity is significantly higher than the corresponding activity (aA0) of the wild-type malate transporter shown in SEQ ID NO: 22, and the significantly higher is any value in the range of (cA1-cA0) / cA0≥10%-500%, for example ≥15%, 20%, 25%, 30%, 40%, 50%, or 100%.

[0181] Those skilled in the art can generate conservative variation mutants by performing conservative amino acid substitutions, for example, as shown in the following table.

[0182] Initial residue Representative substituted residues Preferred substitution residues Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu

[0183] As used herein, modified (usually without changing the primary structure) forms of proteins include: chemical derivatization forms of proteins in vivo or in vitro such as acetylation or carboxylation. Modifications also include glycosylation. Modified forms also include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to improve their resistance to proteolysis or optimize their solubility. These techniques are known to those skilled in the art.

[0184] In addition, the derivative proteins of the mutant protein of the present invention also include fusion proteins or conjugates formed by the mutant protein of the present invention or its active fragments and other proteins or markers.

[0185] Preferably, the active fragment, variant form or derivative protein of the mutant protein of the present invention has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with SEQ ID NO: 1 or 22, respectively.

[0186] The mutant proteins of the present invention can be combined to further improve the yield of malic acid.

[0187] Encoding nucleic acids and combinations thereof

[0188] On the basis of the pyruvate carboxylase mutant protein or malate transporter mutant protein of the present invention, the present invention also provides a polynucleotide encoding the separation of the pyruvate carboxylase mutant protein or the malate transporter mutant protein or a degenerate variant thereof. The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be the same as the nucleotide sequence encoding the pyruvate carboxylase mutant protein and / or the malate transporter mutant protein in the embodiment of the present invention or a degenerate variant. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes the pyruvate carboxylase mutant protein and / or the malate transporter mutant protein in the claims of the present invention, but is different from the nucleotide sequence encoding the pyruvate carboxylase mutant protein or the malate transporter mutant protein in the embodiment of the present invention.

[0189] Vector, host cell

[0190] The coding polynucleotide sequence can be inserted into a recombinant expression vector or genome. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In short, any plasmid and vector can be used as long as they can replicate and be stable in the host. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0191] Those skilled in the art can use well-known methods to construct expression vectors containing "pyruvate carboxylase mutant protein and / or malate transporter mutant protein" encoding DNA sequence and suitable transcription / translation control signals, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively connected to a suitable promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation.

[0192] The host cells described herein include host cells containing the above expression vector or a host cell in which the mutant protein coding sequence of the present invention is integrated into the genome. The host cells include those derived from ascomycetes hosts, which have a very high evolutionary relationship and have a high similarity in the sequence and functionality of pyruvate carboxylase and malate transporter. The preferred microbial cells are as follows:

[0193] Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Saccharomyces pombe, Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipites, Candida shehatae, Candida tropicalis, Escherichia coli, Bacillus subtilis, Torulopsis glabrata, Aspergillus oryzae oryzae), Rhizopus oryzae, Ustilago trichophora, Thermobifida fusca, Myceliophthora thermophila, Myceliophthora heterothallica.

[0194] Can be through the conventional recombinant transformation method of this area, and described mutant protein can be expressed in cell or on cell membrane or secreted into extracellular.If necessary, can utilize its physical, chemical and other characteristics by various separation methods to separate and purify the protein of recombinant.These methods are well known to those skilled in the art.The example of these methods includes but is not limited to: conventional renaturation treatment, protein precipitation agent treatment (salting out method), centrifugation, osmotic bacteria breaking, ultrasonic treatment, high pressure homogenization, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and the combination of these methods.Obtaining host cell described in the present invention can express pyruvate carboxylase mutant protein and malate transporter mutant protein respectively and / or simultaneously.

[0195] Preparation of mutant proteins

[0196] The present invention also provides a method for preparing a pyruvate carboxylase mutant protein and a malate transporter mutant protein, comprising culturing the host cell of the present invention under conditions suitable for expression, thereby expressing the pyruvate carboxylase mutant protein and / or the malate transporter mutant protein; and

[0197] The pyruvate carboxylase mutant protein and / or the malate transporter mutant protein are isolated.

[0198] The obtained mutant protein can also be optionally purified to obtain a purer mutant protein product.

[0199] Preferably, the conditions suitable for expression include conventional techniques in the art, and purification techniques include nickel column purification, ion exchange chromatography, and the like.

[0200] Carbon source

[0201] The carbon source that can be used for the present invention is not particularly limited, is a class of nutrients for the growth of microorganisms (such as host cells of the present invention), and is a carbon-containing compound. Preferably, the carbon source that can be used for the present invention includes glucose, sucrose, cellobiose, lactose, galactose, xylose, glycerol, or methanol.

[0202] application

[0203] The mutant proteins of the present invention can be used separately or simultaneously to increase the production of malic acid. The pyruvate carboxylase mutant protein of the present invention can increase malic acid synthesis by at least 10% after a single mutation at a specific site, and can reach more than 30% in a preferred strain, while double and triple mutations can increase malic acid production by 40%. For the malic acid transporter mutant protein, the malic acid production is increased by at least 10% after a mutation at a specific site, and can reach more than 30% in a preferred strain. After the two proteins of the present invention are modified and combined, the production of malic acid is synergistically improved.

[0204] Beneficial effects of the present invention

[0205] The present invention, by constructing a malic acid synthesis pathway in Pichia pastoris, couples the synthesis capacity of pyruvate carboxylase and malic acid transporter in the malic acid synthesis pathway with the malic acid output, and then the size of the CaCO3 hydrolysis circle, realizes the directed evolution transformation of the two proteins for the first time, and significantly improves the malic acid synthesis level. The pyruvate carboxylase mutant protein of the present invention improves malic acid synthesis by at least 10% after a single mutation at a specific site, and the mutation in a preferred strain can reach more than 30%, while the malic acid output can be increased by 40% after double mutation and triple mutation. For the malic acid transporter mutant protein, the malic acid output is at least increased by 10% after a mutation at a specific site, and the mutation in a preferred strain can reach more than 30%. After the two proteins of the present invention are transformed and combined, the output of malic acid has a synergistic improvement.

[0206] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 2001), or under conditions recommended by the manufacturer.

[0207] All primers used were synthesized by GeneWeizhi Biotechnology Co., Ltd., and the genes to be synthesized were also synthesized by GeneWeizhi. The sequences involved in the present invention are shown in the sequence table.

[0208] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0209] In the present invention, malic acid and succinic acid were purchased from Sigma Reagent Company.

[0210] Example 1 Construction of a screening platform for dicarboxylic acid transporters in Pichia pastoris

[0211] 1. Construction of Pichia pastoris overexpression vector for pyruvate carboxylase and malate dehydrogenase:

[0212] PCR was performed using primers AvrII-F (SEQ ID NO: 44): (CCACCGCCCGTTACCGTCCGAAGGAAATTTTACTCTGCTGGAG) and AvrII-R (SEQ ID NO: 45): (CTCCAGCAGAGTAAAATTTCCTTCGGACGGTAACGGGCGGTGG) with pGAPzA as template. The PCR reaction system was: 5×phusion HF buffer 10μl 10mM dNTPs 1μl, AvrII-F 1μl, AvrII-R 1μl, pGAPzA 1μl, Phusion DNA polymerase 0.5μl, water 35.5μl. The PCR reaction conditions were: 98℃ for 30s first; then 98℃ for 10s, 60℃ for 30s, 72℃ for 3min, 30 cycles; finally 72℃ for 10min, 4℃ for 10min. After the PCR reaction, the product was purified by purification column. 1 μg of plasmid was added with 1 μl restriction endonuclease DpnI to digest and remove the template. Then, the product was heat-inactivated at 85°C for 5 min. 5 μl of the product was transformed into Escherichia coli competent cells DH5α and spread on low-salt LB medium plates containing 25 μg / ml Zeocin to screen positive clones. The sequencing results showed that the AvrII restriction site on pGAPzA had been successfully removed and it was named pGAPzAm. The pyruvate carboxylase PYC and malate dehydrogenase MDH genes were amplified by PCR using the Pichia pastoris GS115 genome as a template using primers PYC-F (SEQ ID NO:46): (GGGTTCGAAACG ATGGCCGAAGAAGACTACTCCC) / PYC-R (SEQ ID NO:47): (GGGGCGGCCGCTTACTCAGCCTTGACGATTTTGGCGATC), MDH-F (SEQ ID NO:48): (GGGTTCGAAACGATGGTTAAAGTCACAGTTTGCGGAG) / MDH-R (SEQ ID NO:49): (GGGGCGGCCGCTTAGTTGCCAGCAATGAAGGCAGTTCC). The PCR reaction conditions were: first 98°C for 30s; then 98°C for 10s, 60°C for 30s, 72°C for 3min (PYC) or 1min (MDH), 30 cycles; finally 72°C for 10min, 4°C for 10min.After the PCR product was purified by purification column, it was double-digested with BstBI and NotI. The plasmids pGAPzA and pGAPzAm were double-digested with the same enzymes. Then, PYC and pGAPzA, MDH and pGAPzAm were connected by T4 DNA ligase at 22°C for 1h. 10μl of the ligation product was transformed into Escherichia coli competent cells DH5α, and the positive clones were screened on a low-salt LB medium plate containing 25μg / ml Zeocin. Sequencing was performed. The sequencing results showed that pGAPzA-PYC ( was successfully constructed. Figure 1 ) and pGAPzAm-MDH( Figure 2 ) plasmid. pGAPzAm-MDH was further double-digested with BglII and BamHI to obtain the expression frame of MDH, which was then connected to the plasmid of pGAPzA-PYC digested with BamH1. The ligation product was transformed into E. coli competent cells DH5α, and the positive clones were screened on a low-salt LB medium plate containing 25 μg / ml Zeocin and sequenced to construct the pGAPzA-PYC-pGAPzAm-MDH expression plasmid. The plasmid schematic diagram is shown in the figure. Figure 3 shown.

[0213] 2. Construction of Pichia pastoris strains overexpressing pyruvate carboxylase and malate dehydrogenase:

[0214] 1. Streak the Pichia pastoris GS115 strain stored at -80°C onto a YPD (1% yeast extract, 2% peptone, 2% glucose, 2% agar) plate and culture at 30°C until a single colony grows.

[0215] 2. Pick a single colony and place it in 250 ml of liquid YPD medium with a filling volume of 30 ml. Culture and activate it at 200 rpm and 30°C for 2 days.

[0216] 3. Transfer the activated Pichia pastoris GS115 strain to a medium containing 30 ml of liquid YPD. The inoculation volume is controlled at 1 / 1000. Culture at 200 rpm and 30°C for about 16-20 hours. 600 Grow to 1.0.

[0217] 4. Centrifuge at 3000 rpm and 4°C to collect the cells and wash twice with pre-cooled sterile water.

[0218] 5. Then wash once with pre-cooled 1M sorbitol and collect the precipitate by centrifugation.

[0219] 6. Add about 400 μl of 1 M sorbitol to resuspend the cells, then dispense 80 μl into pre-cooled 1.5 ml centrifuge tubes to make Pichia pastoris GS115 competent cells and store at -80°C for later use.

[0220] 7. Extract the pGAPzA-PYC-pGAPzAm-MDH plasmid, linearize the plasmid with AvrII, and then transform it into Pichia pastoris GS115 competent cells by electroporation. Then add 1 ml of pre-cooled 1 M sorbitol, let it stand at 30°C for 2 h, and then spread it on a YPD plate containing 50 or 75 μg / ml. After the colonies grow, it is used for malic acid production. This strain is named P0.

[0221] 3. Determination of malic acid synthesis capacity

[0222] The malic acid-producing strain was first activated with YPD medium for 48 h and then cultured at an initial OD 600 =1.0, inoculated into malic acid producing medium (100g / L glucose, 1.24g / L KNO3, 0.64g / L KH2PO4, 0.04g / L ZnSO4·7H2O, 0.25g / LMgSO4·7H2O, 0.0005g / L FeSO4·7H2O 4g / L peptone, 0.1g / L CaCl2, 75g / L CaCO3, 0.1g / L histine), 30ml of liquid in a 250ml Erlenmeyer flask, 200rpm, 30℃ culture, every 24h, take 1ml of sample, add 1ml of 20% (V / V) H2SO4, acidify at 80℃ for 30min, add a certain amount of water for dilution, then centrifuge, take the supernatant and use HPLC Aminex 87H column to determine the malic acid content. HPLC parameters are as follows: column temperature 35°C, detector temperature 40°C, mobile phase 5mM H2SO4, flow rate 0.5ml / min, malic acid standard for quantification. Figure 7 As shown, compared with the GS115 strain, the P0 strain can produce 3.0 g / L malic acid, while GS115 produces 1.0 g / L malic acid.

[0223] Example 2 Construction and screening of a dicarboxylate transporter mutant library.

[0224] 1. Construction of dicarboxylate transporter expression vector:

[0225] The primers are:

[0226] Hph-BamH1 SEQ ID NO:50 GGGGGATCCTGTACAGCTTGCCTCGTCCCC

[0227] Hph-R SEQ ID NO:51 GTCGACACTGGATGGCGGCGTTAG

[0228] Using the pAG34 plasmid as a template, PCR amplified the hygromycin gene. The PCR reaction conditions were: 98°C for 30s, then 98°C for 10s, 60°C for 30s, 72°C for 2min, 30 cycles, and finally 72°C for 10min, 4°C for 10min. After the PCR reaction, the product was purified by a purification column, digested with BamH1, and connected to the pGAPzA plasmid digested with BamH1 and EcoRV. The ligation product was transformed into Escherichia coli competent cells DH5α, and the single clone was sequenced correctly to obtain pGAP-hph.

[0229] The primers are:

[0230] his-BglII SEQ ID NO:52GGGAGATCTGTTGTAACACTGGCAGAGCATTACG

[0231] his-BamH1 SEQ ID NO:53GGGGGATCCGTCCCAGTTTCTCCATACGAACC)

[0232] Using pPIC9K plasmid as template, his gene was amplified by PCR. The PCR fragment was digested with BglII and BamH1 and ligated with pGAP-hph digested with BglII to obtain pGAP-hph-his.

[0233] The primers are:

[0234] SpMae-ClaI SEQ ID NO:54 GGGATCGATATGGGTGAACTCAAGGAAATCTTG

[0235] SpMae-NotI SEQ ID NO:55 GGGGCGGCCGCTTAAACGCTTTCATGTTCACTACTAGG

[0236] The SpMae gene was amplified by PCR using Schizosaccharomyces pombe genomic DNA as template.

[0237] The primers are:

[0238] AoMae-BstBI SEQ ID NO:56 GGGTTCGAAATGCTGACACCTCCCAAGTTTG

[0239] AoMae-NotI SEQ ID NO:57 GGGCGGCCGCCTAATCAGATACATCCTCATCTTTAC

[0240] The AoMae gene was amplified by PCR using the cDNA of Aspergillus oryzae DSM1863 (DSMZ, purchased from German Microorganism and Cell Culture GmbH) as a template;

[0241] The primers are:

[0242] Kljen2-EcoRI SEQ ID NO:58 GGGGAATTCATGGCTGCAGAATCAATAGTGTCTC

[0243] Kljen2-NotI SEQ ID NO:59GGGGCGGCCGCTTATGTTGAATTTCTTGCTTGAAATTTAGATC

[0244] Kljen2 was obtained by PCR amplification using Kluyveromyces lactis genomic DNA as a template. The PCR products of SpMae, AoMae and Kljen2 were purified by ClaI / NotI, BstBI / NotI, and EcoRI / NotI digestion and ligated with the vector pGAP-hph-his (digested with the corresponding enzymes (ClaI and BstBI are the same tail enzymes). The ligated products were transformed into Escherichia coli competent cells DH5α, and the single clones were sequenced correctly to obtain pGAP-hph-his-SpMae, pGAP-hph-his-AoMae and pGAP-hph-his-Kljen2 ( Figure 4 )

[0245] 2. Comparison of malic acid production ability of candidate dicarboxylic acid transporter proteins: The vectors pGAP-hph-his-SpMae, pGAP-hph-his-AoMae and pGAP-hph-his-Kljen2 were linearized with AvrII, transformed into P0 strain by electroporation, and plated on MD (YNB 13.4 g / L, biotin 4×10 -4 g / L, agar 2.0g / L, glucose 2.0g / L), and when all the plants have grown out, shake flask culture is carried out with acid-producing medium. The results are as follows Figure 7 As shown, AoMae derived from A. oryzae is more conducive to the synthesis of organic acids such as malic acid. It can synthesize 55g / L malic acid using 100g / L glucose as substrate. The obtained strain was named P1, and protein engineering was carried out using it as the starting protein.

[0246] 3. Construction of high-throughput screening method based on hydrolysis circle: Due to the soluble characteristics of 20-30g / L calcium malate (found in the early stage of this study), we established a high-throughput screening method for hydrolysis circle. The specific method is: when the transporter expression plasmid is transferred into P0 competent cells, after the colonies grow, pick the colonies with a sterile toothpick, and then puncture them into the solid culture medium for malic acid production (2.0g / L agar is added to the liquid, and the concentration of CaCO3 is 3g / L), check the size of the hydrolysis circle every day, and use the ratio of the diameter of the hydrolysis circle to the diameter of the colony as the screening standard. The larger the value, the higher the malic acid production.

[0247] 4. Construction of Aomae mutation library and screening of malic acid-producing mutants: AoMae derived from A. oryzae was subjected to protein engineering, and random mutation amplification of AoMae was performed using the random mutation kit GeneMorph II Random Mutagenesis (Agilent) with AoMae-BstBI and AoMae-NotI as primers. The PCR product was digested with BstBI and NotI and then ligated with pGAP-hph-his. The ligated product was transformed into Escherichia coli competent cells DH5α, spread on LB solid plate culture medium containing 125 μg / ml hygromycin, and cultured overnight at 37°C. 20 single clones were randomly selected for sequencing and the mutation rate was analyzed. The results showed that the mutation rate was about 1%. The mutant library was eluted with LB liquid medium containing 125 μg / ml hygromycin, and then revived at 37°C for 2 hours. The mixed plasmid was extracted and transformed into P0 competent cells after AvrII linearization. The cells were spread on MD plates. After a single colony grew out, they were punctured into malic acid-producing solid medium. The wild-type strain P1 of AoMae was used as the control. The strain with a larger hydrolysis circle than P1 in the mutant library ( Figure 8 ), repeated screening and HPLC malic acid content determination by shake flask.

[0248] 5. Determination of AoMae gene copy number in malic acid-producing mutants

[0249] The genomic DNA of the malate-producing mutant was extracted.

[0250] The primers are:

[0251] Actin-RT1-F SEQ ID NO:60 CTGCGATTCTTATTCTTCCGATTG

[0252] Actin-RT1-R SEQ ID NO:61 CAACCGAGGACAACCAACAG

[0253] Amplify Actin gene as internal reference

[0254] The primers are:

[0255] Aomae-RT1-F SEQ ID NO:62 CATCATCTGCGGCTTGTC

[0256] Aomae-RT1-R SEQ ID NO:63 TGAGAAGACGAACGAGTATTG The AoMae gene was amplified, and the results showed that the obtained AoMae transformants were all single copies.

[0257] 6. Identification of mutation sites: For the mutant strains with increased malic acid production, their genomic DNA was extracted, and then PCR amplification was performed using AoMae-BstB1 and AoMae-NotI as primers. The amplified products were recovered through purification columns, connected to the pJET1.2 blunt vector, transformed into Escherichia coli competent cells DH5α, and spread on LB medium containing 100 μg / ml ampicillin. The single clones were sequenced to obtain the mutation sites I80F, V142D, R272P, E8G, I109V, S123R, I301K, P163Q, F101H, L140N, F97G, A191C, Y115I, A214G, F201K, H227F, M251Y and E222H.

[0258] 7. Site-directed saturation mutagenesis and combined mutation of AoMae to improve malic acid synthesis: The sites obtained by random mutation and the key amino acid sites obtained based on structural alignment were subjected to saturation mutation. The method was as follows: the mutation site was introduced in the middle of the primer, and then pGAP-hph-his-AoMae was amplified by PCR. The PCR product was digested with DpnI to remove the template plasmid. Then 5 μl of the transformed Escherichia coli competent cells DH5α were spread on LB medium containing 125 μg / ml hygromycin. The mutation site was obtained by sequencing the single clone. The obtained AoMae mutant expression plasmid was linearized with AvrII and transformed into the P0 strain. It was then cultured in a liquid malic acid production medium shake flask and analyzed by HPLC.

[0259] The I80F mutation was introduced using primers I80F (SEQ ID NO: 64): CCATGGCTATAAGGTTCTTCCTGCACGGCAACCTTCTG and I80-rev (SEQ ID NO: 65): GAACCTTATAGCCATGGTAGAG, and the I80X mutations (X represents 18 amino acids other than F) at other sites were introduced using primers I80X (SEQ ID NO: 66): CCATGGCTATAAGGTTCXXXCTGCACGGCAACCTTCTG (XXX is the codon corresponding to different amino acids) and I80-rev (SEQ ID NO: 65), respectively.

[0260] The V142D mutation was introduced using primers V142D (SEQ ID NO: 67): GCGTCTGCACCTTACTCGACGCAATCATCCAATACTCG and V142-rev (SEQ ID NO: 68): GAGTAAGGTGCAGACGCAGTAG, and V142X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers V142X (SEQ ID NO: 69): GCGTCTGCACCTTACTCXXXGCAATCATCCAATACTCG (XXX is the codon corresponding to different amino acids) and V142-rev (SEQ ID NO: 68), respectively.

[0261] The R272P mutation was introduced using primers R272P (SEQ ID NO: 69): CACGCCCTGGAAGATGGCCCAATCATCGAGCTGCTGGC and R272-rev (SEQ ID NO: 70): GCCATCTTCCAGGGCGTG, and the R272X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers R272X (SEQ ID NO: 71): CACGCCCTGGAAGATGGCXXXATCATCGAGCTGCTGGC (XXX is the codon corresponding to different amino acids) and R272-rev (SEQ ID NO: 70), respectively.

[0262] The E8G mutation was introduced using primers E8G (SEQ ID NO: 72): CTGACACCTCCCAAGTTTGGTGATGAGAAGCAGCTGGG and E8-rev (SEQ ID NO: 73): AAACTTGGGAGGTGTCAGC, and the E8X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers E8X (SEQ ID NO: 74): CTGACACCTCCCAAGTTTXXXGATGAGAAGCAGCTGGG (XXX is the codon corresponding to different amino acids) and E8-rev (SEQ ID NO: 73), respectively.

[0263] The I109V mutation was introduced using primers I109V (SEQ ID NO: 75): TCTCCGTCGCAACCATCGTCTGCGGCTTGTCTCGCTAC and I109-rev (SEQ ID NO: 76): GATGGTTGCGACGGAGAG, and the I109X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers I109X (SEQ ID NO: 77): TCTCCGTCGCAACCATCXXXTGCGGCTTGTCTCGCTAC (XXX is the codon corresponding to different amino acids) and I109-rev (SEQ ID NO: 76), respectively.

[0264] The S123R mutation was introduced using primers S123R (SEQ ID NO: 78): GTGAAGAATCGAATGAGAGATTCCAACTAGCCCTCGAAG and S123-rev (SEQ ID NO: 79): CTCATTCGATTCTTCACCG, and the S123X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers S123X (SEQ ID NO: 80): GTGAAGAATCGAATGAGXXXTTCCAACTAGCCCTCGAAG (XXX is the codon corresponding to different amino acids) and S123-rev (SEQ ID NO: 79), respectively.

[0265] The I301K mutation was introduced using primers I301K (SEQ ID NO: 81): CGCCATTGTCGCCGTCAAGCGCTCGCCCCCCGAGGCC and I301-rev (SEQ ID NO: 82): GACGGCGACAATGGCGATG, and the S123X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers S123X (SEQ ID NO: 83): CGCCATTGTCGCCGTCXXXCGCTCGCCCCCCGAGGCC (XXX is the codon corresponding to different amino acids) and I301-rev (SEQ ID NO: 82), respectively.

[0266] The P163Q mutation was introduced using primers P163Q (SEQ ID NO: 84): GCCTTCAAACCATGATGCAATCATGGATCCTTCCAGCC and P163Q-rev (SEQ ID NO: 85): CATCATGGTTTGAAGGCC, and the P163X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers P163X (SEQ ID NO: 86): GCCTTCAAACCATGATGXXXTCATGGATCCTTCCAGCC (XXX is the codon corresponding to different amino acids) and P163-rev (SEQ ID NO: 85), respectively.

[0267] The F101H mutation was introduced using primers F101H (SEQ ID NO: 87): GGTCTCTTCTTCCCGACCCACTGGCTCTCCGTCGCAACC and F101-rev (SEQ ID NO: 88): GGTCGGGAAGAAGAGACCC, and the F101X mutations (X represents 18 amino acids other than F) at other sites were introduced using primers F101X (SEQ ID NO: 89): GGTCTCTTCTTCCCGACCXXXTGGCTCTCCGTCGCAACC (XXX is the codon corresponding to different amino acids) and F101-rev (SEQ ID NO: 88), respectively.

[0268] The L140N mutation was introduced using primers L140N (SEQ ID NO: 90): TCTACTGCGTCTGCACCAACCTCGTCGCAATCATCC and L140-rev (SEQ ID NO: 91): GGTGCAGACGCAGTAGATC, and the L140X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers L140X (SEQ ID NO: 92): TCTACTGCGTCTGCACCXXXCTCGTCGCAATCATCC (XXX is the codon corresponding to different amino acids) and L140-rev (SEQ ID NO: 91), respectively.

[0269] The F97G mutation was introduced using primers F97G (SEQ ID NO: 93): CATGACCGCGAGGGTCTCGGGTTCCCGACCTTCTGGCTC and F97-rev (SEQ ID NO: 94): GAGACCCTCGCGGTCATG, and the F97X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers F97X (SEQ ID NO: 95): CATGACCGCGAGGGTCTCXXXTTCCCGACCTTCTGGCTC (XXX is the codon corresponding to different amino acids) and F97-rev (SEQ ID NO: 94), respectively.

[0270] The A191C mutation was introduced using primers A191C (SEQ ID NO: 96): CAACAACCCGCTCGCGCATGTCTCCCCATCATCGGCGC and A191-rev (SEQ ID NO: 97): TGCGCGAGCGGGTTGTTG, and the A191X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers F97X (SEQ ID NO: 98): CAACAACCCGCTCGCGCATGTCTCCCCATCATCGGCGC (XXX is the codon corresponding to different amino acids) and A191-rev (SEQ ID NO: 97), respectively.

[0271] The Y115I mutation was introduced using primers Y115I (SEQ ID NO: 99): TCTGCGGCTTGTCTCGCATCTTCGGTGAAGAATCGAATG and Y115-rev (SEQ ID NO: 100): GCGAGACAAGCCGCAGATG, and the Y115X mutations (X represents 18 amino acids other than F) at other sites were introduced using primers F97X (SEQ ID NO: 101): TCTGCGGCTTGTCTCGCXXXTTCGGTGAAGAATCGAATG (XXX is the codon corresponding to different amino acids) and Y115-rev (SEQ ID NO: 100).

[0272] The A214G mutation was introduced using primers A214G (SEQ ID NO: 102): TCAGCTTCATGATGTACGGGCACTACATCGGCCGACTG and A214-rev (SEQ ID NO: 103): GTACATCATGAAGCTGATG, and the A214X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers A214X (SEQ ID NO: 104): TCAGCTTCATGATGTACXXXCACTACATCGGCCGACTG (XXX is the codon corresponding to different amino acids) and A214X-rev (SEQ ID NO: 103), respectively.

[0273] The F201K mutation was introduced using primers F201K (SEQ ID NO: 105): CGGCGCCGGCGTCACCAAGCAGGGCCTCGGCTTCTCC and F201-rev (SEQ ID NO: 106): GGTGACGCCGGCGCCGATG, and the F201X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers A214X (SEQ ID NO: 107): CGGCGCCGGCGTCACCXXXCAGGGCCTCGGCTTCTCC (XXX is the codon corresponding to different amino acids) and F201-rev (SEQ ID NO: 106), respectively.

[0274] The H227F mutation was introduced using primers H227F (SEQ ID NO: 108): ATGGAGTCCGGCCTCCCCTTCAGCGACCACAGACCAGGC and H227-rev (SEQ ID NO: 109): GGGGAGGCCGGACTCCATC, and the other site H227X mutations (X represents 18 amino acids other than F) were introduced using primers A214X (SEQ ID NO: 110): ATGGAGTCCGGCCTCCCCXXXAGCGACCACAGACCAGGC (XXX is the codon corresponding to different amino acids) and H227-rev (SEQ ID NO: 109), respectively.

[0275] The M251Y mutation was introduced using primers M251Y (SEQ ID NO: 111): CCCTCGCCCTCGTCGGCTACAGCAAAGGCCTCCCCGAAG and M251-rev (SEQ ID NO: 112): GCCGACGAGGGCGAGGGC, and the M251X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers M251X (SEQ ID NO: 113): CCCTCGCCCTCGTCGGCXXXAGCAAAGGCCTCCCCGAAG (XXX is the codon corresponding to different amino acids) and M251-rev (SEQ ID NO: 112), respectively.

[0276] The E222H mutation was introduced using primers E222Y (SEQ ID NO: 114): TACATCGGCCGACTGATGCACTCCGGCCTCCCCCAC and E222-rev (SEQ ID NO: 115): CATCAGTCGGCCGATGTAG, and the E222X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers M251X (SEQ ID NO: 116): TACATCGGCCGACTGATGXXXTCCGGCCTCCCCCAC (XXX is the codon corresponding to different amino acids) and E222-rev (SEQ ID NO: 115), respectively.

[0277] Each mutant was transformed into P0 strain, and the results of screening for malic acid were as follows: Figure 9-Figure 26 As shown:

[0278] The four optimal points E8Q, I80K, V142I and R272A were selected for combined mutation (which can increase the malic acid synthesis capacity by 15%, 14%, 21% and 21% respectively). The combined mutations were transformed into P0 strains using the same method as saturation mutations. The malic acid production results are shown in Figure 2. Fig. 27 Among them, the I80K / R272A (corresponding to plasmid pGAP-hph-his-AoMaeKA) mutation had the best ability to synthesize malic acid, which was 30% higher than that of the starting strain, reaching 71.5 g / L.

[0279] Example 3 Pyruvate carboxylase screening platform strain construction

[0280] 1. Construction of dicarboxylate transporter expression vector. The primers are as follows:

[0281] Hph-BamH1 SEQ ID NO:117 GGGGGATCCTGTACAGCTTGCCTCGTCCCC

[0282] Hph-R SEQ ID NO:118 GTCGACACTGGATGGCGGCGTTAG

[0283] Using the pAG34 plasmid as a template, PCR amplified the hygromycin gene. The PCR reaction conditions were: first 98°C for 30s; then 98°C for 10s, 60°C for 30s, 72°C for 2min, 30 cycles; and finally 72°C for 10min and 4°C for 10min. After the PCR reaction, the product was purified by a purification column, digested with BamH1, and connected to the pGAPzA plasmid digested with BamH1 and EcoRV. The ligation product was transformed into Escherichia coli competent cells DH5α, and the single clone was sequenced correctly to obtain pGAP-hph. AoMae from Aspergillus oryzae was directly PCR amplified from genomic DNA; AoMae was digested with BstBI and NotI and then connected to the vector pGAP-hph. The ligation product was transformed into Escherichia coli competent cells DH5α, and the single clone was sequenced correctly to obtain pGAP-hph-AoMae ( Figure 5 ).

[0284] 2. Construction of Pichia pastoris strains overexpressing dicarboxylate transporters

[0285] 1. Streak the Pichia pastoris GS115 strain stored at -80°C onto a YPD (1% yeast extract, 2% peptone, 2% glucose, 2% agar) plate and culture at 30°C until a single colony grows.

[0286] 2. Pick a single colony and place it in 250 ml of liquid YPD medium with a filling volume of 30 ml. Culture and activate it at 200 rpm and 30°C for 2 days.

[0287] 3. Transfer the activated Pichia pastoris GS115 strain to a medium containing 30 ml of liquid YPD. The inoculation volume is controlled at 1 / 1000. Culture at 200 rpm and 30°C for about 16-20 hours. 600 Grow to 1.0.

[0288] 4. Centrifuge at 3000rpm, 4℃, collect the cells, and wash twice with pre-cooled sterile water.

[0289] 5. Then wash once with pre-cooled 1M sorbitol and collect the precipitate by centrifugation.

[0290] 6. Add about 400 μl of 1 M sorbitol to resuspend the cells, then dispense 80 μl into pre-cooled 1.5 ml centrifuge tubes to make Pichia pastoris GS115 competent cells and store at -80°C for later use.

[0291] 7. Extract the pGAP-hph-AoMae plasmid, linearize the plasmid with AvrII, and then transform it into Pichia pastoris GS115 competent cells by electroporation. Then add 1 ml of pre-cooled 1 M sorbitol, let it stand at 30°C for 2 h, and then spread it on a YPD plate containing 300 μg / ml. After the colonies grow, it is used for malic acid production. The strain is named P2.

[0292] 3. Determination of malic acid synthesis capacity

[0293] The malic acid-producing strain was first activated with YPD medium for 48 h and then cultured at an initial OD 600 =1.0, inoculated in malic acid production medium (100 g / L glucose, 1.24 g / L KNO3, 0.64 g / L KH2PO4, 0.04 g / L ZnSO4·7H2O, 0.25 g / LMgSO4·7H2O, 0.0005 g / L FeSO4·7H2O. 4 g / L peptone, 0.1 g / L CaCl2, 75 g / L CaCO3, 0.1 g / L histine, biotin 4×10 -4 g / L), 30ml of liquid in a 250ml triangular bottle, 200rpm, 30℃ culture, every 24h, take 1ml of sample, add 1ml of 20% (V / V) H2SO4, acidify at 80℃ for 30min, add a certain amount of water for dilution, then centrifuge, take the supernatant and use HPLC Aminex 87H column to determine the malic acid content. HPLC parameter conditions are as follows: column temperature 35℃, detector temperature 40℃, mobile phase 5mM H2SO4, flow rate 0.5ml / min, quantification with malic acid standard. The results show that P2 strain can produce 5.0 / l malic acid, and GS115 produces 1.0g / L malic acid.

[0294] Example 4 Construction and screening of pyruvate carboxylase mutant library

[0295] 1. Construction of pyruvate carboxylase expression vector. The primers are as follows:

[0296] his-BglII SEQ ID NO:119 GGGAGATCTGTTGTAACACTGGCAGAGCATTACG

[0297] his-BamH1 SEQ ID NO:120 GGGGGATCCGTCCCAGTTTCTCCATACGAACC

[0298] Using pPIC9K plasmid as template, PCR amplified his gene, the PCR fragment was digested with BglII and BamH1 and connected with pGAPzA digested with BglII to obtain pGAPzA-his. Pyruvate carboxylase from Penicillium and Rhizobium was synthesized by Jinweizhi, and the primers are as follows:

[0299] PvPyc-F SEQ ID NO:121 GGGTTCGAAATGGCCGCGCCGCAACGCCAACCCG

[0300] PvPyc-R SEQ ID NO:122 GGGGCGGCCGCTCATCAGGCCTTGCCGATCTTAC

[0301] RePyc-F SEQ ID NO:123 GGGTTCGAAATGCCCATTAGCAAGATCCTCGTGGC

[0302] RePyc-R SEQ ID NO: 124 GGGGCGGCCGCTCAGCCGCCGTAGACCGCGAGGAG Then it was digested with BstBI and NotI and ligated with pGAPzA-his digested with the same enzymes, and transformed into E. coli DH5α. The transformants were sequenced correctly and named pGAPzA-his-PvPyc and pGAPzA-his-RePyc ( Figure 6 ). Pyruvate carboxylase from Aspergillus, Rhizopus oryzae, Corynebacterium glutamicum and Pichia pastoris, the primers are as follows:

[0303] AoPyc-F SEQ ID NO:125 GGGTTCGAAATGGCGGCTCCGTTTCGTCAGCC

[0304] AoPyc-R SEQ ID NO:126 GGGGCGGCCGCCTATTACGCTTTGACGATCTTGC

[0305] RoPyc-F SEQ ID NO:127 AATTGAACAACTATTTCGAAATGCCTGCTGCACC

[0306] RoPyc-R SEQ ID NO:128 AGAAAGCTGGCGGCCGCTTAGGCTTCCTCTTTGAC

[0307] CgPyc-F SEQ ID NO:129 CAATTGAACAACTATTTCGAAATGTCGACTCACAC

[0308] CgPyc-R SEQ ID NO:130 CTAGAAAGCTGGCGGCCGCCTATTAGGAAACGAC

[0309] PpPyc-F SEQ ID NO:131 GGGTTCGAAATGGCCGAAGAAGACTACTCCCCGC

[0310] PpPyc-R SEQ ID NO:132 GGGGCGGCCGCTTACTCAGCCTTGACGATTTTGGC

[0311] PCR amplification was performed using the respective genomic DNA as template. The PCR reaction system was: 5×phusion HFbuffer 10μl 10mM dNTPs 1μl, AvrII-F 1μl, AvrII-R 1μl, pGAPzA 1μl, Phusion DNApolymerase 0.5μl, water 35.5μl. The PCR reaction conditions were: 98℃ for 30s first; then 98℃ for 10s, 60℃ for 30s, 72℃ for 3min, 30 cycles; finally 72℃ for 10min, 4℃ for 10min. The PCR product was purified by purification column, digested with BstBI and NotI (the restriction sites contained in the gene were eliminated by mutation), connected with the vector pGAPzA-his, and transformed into E. coli DH5α. The transformants were sequenced correctly and named pGAPzA-his-AoPyc, pGAPzA-his-RoPyc, pGAPzA-his-CgPyc and pGAPzA-his-PpPyc ( Figure 6 ).

[0312] 2. Comparison of candidate genes for pyruvate carboxylase

[0313] The 6 pyruvate carboxylase expression vectors constructed above from different sources were digested with AvrII and electroporated into Pichia pastoris P2 strain containing dicarboxylic acid transporter AoMae. The vectors were spread on MD plates. After colonies grew out, single colonies were picked and activated with YPD liquid medium for 48 hours. The culture was carried out in shake flasks with acid-producing medium. The results are as follows: Fig.28 As shown, the pyruvate carboxylase CgPyc from Corynebacterium glutamicum is more conducive to the synthesis of organic acids such as malic acid. 53.2 g / L malic acid can be synthesized using 100 g / L glucose as a substrate, and protein engineering is carried out using this as a starting protein.

[0314] 3. Construction of a high-throughput screening method based on hydrolysis circles: Due to the soluble properties of 20-30g / L calcium malate (discovered in the early stage of this study), we established a high-throughput screening method for hydrolysis circles. The specific method is: transform P2 competent cells with pyruvate carboxylase, pick the colonies with a sterile toothpick after the colonies grow, and then puncture them into a solid culture medium for malic acid production (2.0g / L agar is added to the liquid, and the concentration of CaCO3 is 3g / L). Check the size of the hydrolysis circle every day, and use the ratio of the diameter of the hydrolysis circle to the diameter of the colony as the screening standard. The larger the value, the higher the malic acid production ( Fig.29 ).

[0315] 4. Construction of PYC mutant library and screening of malic acid-producing mutants: Protein engineering was performed on pyruvate carboxylase CgPyc from Corynebacterium glutamicum. First, BstBI and NotI contained in CgPyc were mutated using the following primers:

[0316] BstBI-mut-F SEQ ID NO:133 TGGGCCTTGCGGATCGTTTCGAGCTC

[0317] BstBI-mut-R SEQ ID NO:134 ACGATCCGCAAGGCCCAGTGCGGTGGC

[0318] NotI-mut-F SEQ ID NO:135 TGCTGCTTCGCGGTCGCAAC

[0319] NotI-mut-R SEQ ID NO:136CGAAGCAGCATCTGAATGTTTAC

[0320] The method used was the same as that of Example 2 for point mutation, and the plasmid pGAPZA-his-CgPyc (BstBI NotImut) was obtained and used as a template for random mutation and site-directed mutation of CgPyc. The primers were as follows:

[0321] CgPyc-ep-F SEQ ID NO:137 GGGTTCGAAATGTCGACTCACACATCTTC

[0322] CgPyc-ep-R SEQ ID NO:138GGGGCGGCCGCTTAGGAAACGACGACGATCAAG

[0323] The random mutation kit GeneMorph II Random Mutagenesis (Agilent) was used to perform random mutation amplification of CgPyc. The PCR product was digested with BstB1 and NotI and then connected to pGAPzA-his. The ligation product was transformed into Escherichia coli competent cells DH5α, spread on LB solid plate medium containing 25μg / ml Zeocin, cultured overnight at 37℃, and 20 single clones were randomly selected for sequencing. The mutation rate was analyzed, and the results showed that the mutation rate was about 1%. The mutant library was eluted with LB liquid medium containing 25μg / ml Zeocin, then revived at 37℃ for 2h, and then the mixed plasmid was extracted, linearized with AvrII, transformed into P2 competent cells, spread on MD plates, and punctured into malic acid solid medium after single colonies grew. The wild-type strain of CgPyc was used as a control. The strains with larger hydrolysis circles than the wild-type CgPyc in the mutant library were screened by shaking flasks and the malic acid content was determined by HPLC.

[0324] 5. Identification of mutation sites: Genomic DNA was extracted from the mutant strain with increased malic acid production, and then PCR amplification was performed using CgPyc-F and CgPyc-R as primers. The amplified product was recovered through a purification column, connected to the pJET1.2blunt vector, transformed into Escherichia coli competent cells DH5α, and spread on LB medium containing 100 μg / ml ampicillin. The single clones were sequenced to obtain the mutation sites H51E, F453Q, A254N, G837M, A762T, P824L, P826T, and P1031S.

[0325] 6. Site-directed saturation mutation and combined mutation of CgPyc to improve malic acid synthesis: The sites obtained by random mutation were subjected to saturation mutation. The method was as follows: introduce the mutation site in the middle of the primer, then PCR circular amplify pGAPzA-his-CgPyc, use DpnI to digest the PCR product, remove the template plasmid, then take 5μl to transform E. coli competent cells DH5α, apply it to LB medium containing 25μg / ml Zeocin, sequence the single clone to obtain the mutation site, linearize the obtained CgPyc mutant expression plasmid with AvrII, transform the P2 strain, and then use liquid malic acid production medium for shake flask culture and HPLC analysis. The introduction of mutations is as follows:

[0326] The H51E mutation was introduced using primers H51E (SEQ ID NO: 139): GAAGATCGGGGATCATTCGAGCGCTCTTTTGCTTCTG and H51-rev (SEQ ID NO: 140): GAATGATCCCCGATCTTC, and H51X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers H51X (SEQ ID NO: 141): GAAGATCGGGGATCATTCXXXCGCTCTTTTGCTTCTG (XXX is the codon corresponding to different amino acids) and H51-rev (SEQ ID NO: 140), respectively.

[0327] The F453Q mutation was introduced using primers F453Q (SEQ ID NO: 142): AGCGCATCGCCACCGGACAAATTGCCGATCACCCGCAC and F453-rev (SEQ ID NO: 143): TCCGGTGGCGATGCGCTTG, and the F453X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers F453X (SEQ ID NO: 144): AGCGCATCGCCACCGGAXXXATTGCCGATCACCCGCAC (XXX is the codon corresponding to different amino acids) and F453-rev (SEQ ID NO: 143), respectively.

[0328] The A254N mutation was introduced using primers A254N (SEQ ID NO: 145): AGTTGTCGAAATTGCGCCAAACCAGCATTTGGATCCAG and A254-rev (SEQ ID NO: 146): TGGCGCAATTTCGACAAC, and the A254X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers A254X (SEQ ID NO: 147): AGTTGTCGAAATTGCGCCAAACCAGCATTTGGATCCAG (XXX is the codon corresponding to different amino acids) and A254X-rev (SEQ ID NO: 146), respectively.

[0329] The G837M mutation was introduced using primers G837M (SEQ ID NO: 148): TACCGCCACGAAATCCCAATGGGACAGTTGTCCAACCTG and G837-rev (SEQ ID NO: 149): TGGGATTTCGTGGCGGTAG, and the G837X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers G837X (SEQ ID NO: 150): TACCGCCACGAAATCCCAXXXGGACAGTTGTCCAACCTG (XXX is the codon corresponding to different amino acids) and G837-rev (SEQ ID NO: 149), respectively.

[0330] The A762T mutation was introduced using primers A762T (SEQ ID NO: 151): GCTCAAGCTGGTACCGATGCTGTTGACGGTGCTTC and A762-rev (SEQ ID NO: 152): ACCAGCTTGAGCTGCAGC, and the A762X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers A762X (SEQ ID NO: 153): GCTCAAGCTGGTXXXGATGCTGTTGACGGTGCTTC (XXX is the codon corresponding to different amino acids) and A762-rev (SEQ ID NO: 152), respectively.

[0331] The P824L mutation was introduced using primers P824L (SEQ ID NO: 154): TTGAGTCTGGAACCTTGGGCCCAACCGGTCGC and P824-rev (SEQ ID NO: 155): GGTTCCAGACTCAAATGGCAGG, and the P824X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers P824X (SEQ ID NO: 156): TTGAGTCTGGAACCXXXGGCCCAACCGGTCGC (XXX is the codon corresponding to different amino acids) and P824-rev (SEQ ID NO: 155), respectively.

[0332] The P826T mutation was introduced using primers P826T (SEQ ID NO: 157): CTGGAACCCCAGGCACCACCGGTCGCGTCTAC and P826-rev (SEQ ID NO: 158): GCCTGGGGTTCCAGACTC, and the P826X mutations at other sites (X represents 18 amino acids other than F) were introduced using primers G837X (SEQ ID NO: 159): CTGGAACCCCAGGCXXXACCGGTCGCGTCTAC (XXX is the codon corresponding to different amino acids) and P826-rev (SEQ ID NO: 158), respectively.

[0333] The P1031S mutation was introduced using primers P1031S (SEQ ID NO: 160): TGCGATCTCTGAGTCCGACGATAAGGGTATGC and P1031-rev (SEQ ID NO: 161): CTCAGAGATCGCATCCAGGC, and the P1031X mutations (X represents 18 amino acids other than F) at other sites were introduced using primers P1031X (SEQ ID NO: 162): TGCGATCTCTGAGXXXGACGATAAGGGTATGC (XXX is the codon corresponding to different amino acids) and P1031-rev (SEQ ID NO: 161). All mutants were transformed into P2 competent cells, and the results of screening for malic acid were as follows. Figure 30-Figure 37 As shown: For the mutation points with better positive mutation effects, A762D, P824V, P826E and P1031E were selected for combined mutation (these four points can increase malic acid by 35.7%, 29.4%, 28.3% and 34.2%), and the same method as saturation mutation was used to transform the combined mutation into P2 strain, and the results of malic acid production were obtained. Fig.38 Among them, A726D / P826E and A762D / P824E / P1031E can increase malic acid by 41.4% and 42.3%, respectively, and the final malic acid synthesis capacity reaches 75.2 g / L and 75.5 g / L.

[0334] Example 5 Application of Aomae in the synthesis of malic acid by Saccharomyces cerevisiae

[0335] 1. Construction of pyc, mdh and AoMae co-expression plasmid vector, primers are as follows:

[0336]

[0337] Using Saccharomyces cerevisiae CEN PK.2-1C DNA and Aspergillus oryzae cDNA as templates, ScPYC2, AoMae and MDH3 (mitochondrial localization sequence SKL removed) were PCR amplified respectively. The three gene fragments were connected to EcoRI and HindIII of the Prs426-pgk-CYCtt vector by the Gibson method. The three genes formed a single cistron through 2A peptide (raegrgslltcgdveenpg) to obtain the expression plasmid Prs426-PGK-ScPYC2-AoMae-MDH3ΔSKL.

[0338] 2. Construction of malic acid-producing Saccharomyces cerevisiae

[0339] The plasmid Prs426-PGK-ScPYC2-Aomae-MDH3ΔSKL was transformed into Saccharomyces cerevisiae CEN.PK2-1C by the LiAc / SS Carrier DNA method (Methods Mol Biol. 2014; 1205: 1-12.), and malic acid synthesis was carried out using the same medium as that of Pichia pastoris for malic acid production. The results are as follows Fig.39 As shown, the results show that 100g / l glucose can produce 22g / l malic acid.

[0340] Example 6: Modification of the C4-dicarboxylic acid transporter encoding gene mae to improve the malic acid synthesis ability of Myceliophthora thermophila

[0341] 1. Construction of mae overexpression vector

[0342] From the cDNA of Aspergillus oryzae DSM1863 (DSMZ, purchased from German Microorganism and Cell Culture Co., Ltd.) and the plasmid pGAP-hph-his-AoMaeKA, the C4-dicarboxylic acid transporter encoding gene mae (XM_001820829.2, SEQ ID NO: 1) and the mutated gene maeKA were amplified, respectively, and after being digested with BglII, they were connected into the linearized vector pAN52-hph after being digested with BglII and EcoRV. The ligation products were digested and identified with restriction endonucleases to obtain overexpression vectors, named pAN52-Wtmae and pAN52-maeKA. The primers are as follows:

[0343] mae-F SEQ ID NO:169 GGAAGATCTTAATTAACTCGAGCGGCCGCGTTTAAACACTAGTATGCTGACACCTCCCAAGTTTG

[0344] mae-R SEQ ID NO:170 ATCCTAATCAGATACAT CCTCATCTTTA

[0345] Using the gene of the starting strain Myceliophthora thermophila ATCC42464 (purchased from the American type culture collection) as a template, PCR amplified the promoter (named Ptef promoter) 1.4 kb upstream of the translation elongation factor encoding reading frame (MYCTH_2298136), and the primers are as follows:

[0346] tef-F SEQ ID NO:171 CCTTAATTAACATGTACCTTGACGTCCTCCGAG

[0347] tef-R SEQ ID NO:172 GGACTAGTTCTGAAGAACGAAACTGGC GACT

[0348] After the PCR reaction, the product was digested with PacI and SpeI and connected to the linearized vector pAN52-hph-mae that had been double-digested with the same enzymes. The ligation product was digested and identified with restriction endonucleases to obtain the mae gene expression vector under the regulation of the promoter tef, named pAN52-Ptef-Wtmae and pAN52-Ptef-maeKA.

[0349] 2. Introduction of the expression vector into Myceliophthora thermophila

[0350] A. Thermomycete ATCC42464 was cultured in MM slant medium [50×Vogel's salt 20 ml, sucrose 20 g, agar 15 g, histidine (50 mg / ml) 20 ml, fixed volume to 1 liter, autoclaved. 50×Vogel's salt (1 liter): trisodium citrate (1 / 2H2O) 150 g, anhydrous KH2PO4 250 g, anhydrous NH4NO3 100 g, MgSO4·7H2O 10 g, CaCl2·2H2O 5 g, trace element salt solution 5 mL, biotin (0.1 mg / ml) 2.5 mL, fixed volume to 1 liter.

[0351] B. Protoplast transformation of Myceliophthora thermophila

[0352] 1) Mycelium preparation

[0353] The mature spores of Myceliophthora thermophila were collected with 0.05% Tween 80 sterilized water, filtered through lens paper to remove the mycelium, spread on MM plates covered with cellophane, and cultured at 45°C for 14 hours.

[0354] 2) Protoplast preparation

[0355] Place the cellophane with mycelium in 30 mL of lysis solution (formula: 0.15 g of lysis enzyme, add 30 mL of solution A aseptically, filter and sterilize; solution A: 1.0361 g of potassium dihydrogen phosphate, 21.864 g of sorbitol, dissolved in 90 ml of deionized water, adjust the pH to 5.6 with potassium hydroxide, quantify to 100 ml, and sterilize at high temperature), lyse at 28°C for 2 h, and shake gently every 20 min.

[0356] Then, after filtering through cellophane, centrifuge at 2000rpm and 4℃ for 10min, discard the supernatant, add 4mL solution B (0.735g calcium chloride, 18.22g sorbitol, 1ml Tris HCl 1M pH 7.5, dissolved in 90ml deionized water, adjust the pH to 7.6 with hydrochloric acid, quantify to 100ml, and sterilize at high temperature), centrifuge at 2000rpm and 4℃ for 10min; discard the supernatant, and add a certain volume of solution B at 200μl / plasmid.

[0357] 3) Protoplast transformation

[0358] In a pre-cooled 15ml centrifuge tube, add 50ul pre-cooled PEG (12.5g PEG6000, 0.368g calcium chloride, 500μl Tris HCl 1M pH 7.5.), 10μl plasmid linearized with HindIII, and 200μl protoplasts. Place on ice for 20min, then add 2ml pre-cooled PEG, keep at room temperature for 5min, add 4mL solution B, and mix gently. Take 3ml of the above solution and add it to 12ml melted MM medium containing the corresponding antibiotics, place it on a plate, and culture it at 45℃. After 2d-4d, pick a single mycelium under a stereomicroscope and grow it on the corresponding resistance plate, and then verify it by PCR.

[0359] 3. Determination of malic acid production ability of Myceliophthora thermophila transformants

[0360] All the above-verified transformants were inoculated into 50 mL of crystalline cellulose (Avicel) medium as the carbon source in a 250 mL Erlenmeyer flask (formula: carbon source 75 g / l, peptone 6.0 g / l, 0.15 g / l KH2PO4, 0.15 g / l K2HPO4, 0.10 g / l CaCl2·2H2O, 0.10 g / l MgSO4·7H2O, calcium carbonate 80.0 g / l, 1 mL / L 0.5 g / l biotin, 1 ml / l trace element solution; trace element formula (100 ml): 5 g C6H8O·7H2O, 5 g ZnSO4·7H2O, 1 g Fe(NH4)2(SO4)·6H2O, 0.25 g CuSO4·5H2O, 0.05 g MnSO4·H2O, 0.05 g H3BO3, 0.05 g NaMoO4·2H2O, dissolved in water, fixed to 100ml), inoculation volume is 2.5*10 5 / ml, 45℃, 150rpm, and sampled on the eighth day to determine the malic acid content.

[0361] 1) Sample processing:

[0362] Take 1 ml of fermentation liquid in a 15 ml centrifuge tube, add 1 ml of 1M H2SO4, and then place at 80°C for 30 minutes, and shake thoroughly every 10 minutes. Then add 2 ml of double distilled water to the centrifuge tube, shake thoroughly, take 1 ml of liquid in a 1.5 ml centrifuge tube, centrifuge at 12000 rpm for 10 minutes, and take the supernatant to determine the malic acid content.

[0363] 2) Determination of malic acid content

[0364] The treated samples were tested for malic acid content by high performance liquid chromatography, where the detector was an ultraviolet detector, 5mM H2SO4 was the mobile phase, and the flow rate was 0.5ml / min. The results showed that the malic acid transporter could significantly promote the production of malic acid compared with the wild-type transporter after modification. On the eighth day, the malic acid production of the transformant MaeKA was 46g / l, which was 9.5% higher than the control strain WtMae (42g / l). The experiment showed that the C4-dicarboxylic acid transporter could significantly improve the malic acid production capacity of the thermophilic fungus Myceliophthora thermophila after modification.

[0365] Example 7: Modification of the key enzyme pyruvate carboxylase of reduced TCA to improve the ability of Myceliophthora thermophila to synthesize malic acid

[0366] 1. Construction of overexpression vector

[0367] The pyruvate carboxylase gene Cgpyc and its mutated gene CgpycA726D / P826E were amplified from the genome of Corynebacterium glutamicum ATCC13032 and the plasmid pGAPzA-his-CgPycDE, respectively, and after being digested with SpeI and EcoRV, they were connected into the linearized vector pAN52-C1pgdA-neo after being digested with the same endonucleases. The ligation products were digested and identified with restriction endonucleases to obtain overexpression vectors, named pAN52-Wtpyc and pAN52-pycA726D / P826E. The primers are shown below

[0368] CgPYC-F SEQ ID NO:173GGACTAGTATGTCGACTCACACATCTTCA

[0369] CgPYC-R SEQ ID NO:174AAAAAGATATCTTAGGAAACGACGACGATCAAG

[0370] 2. Determination of the ability of Myceliophthora thermophila transformants to produce malic acid

[0371] The overexpression vectors pAN52-Wtpyc and pAN52-pycA726D / P826E were linearized with BglII and integrated into the genome of the thermophilic Myceliophthora WtMae strain, and G418 was used as a screening antibiotic at a final concentration of 100 μg / ml, as described in step 2 of Example 1. Using primers CgPYC-F and CgPYC-R, the transformants were verified and named WtPYC and PYCA726D / P826E.

[0372] All the verified transformants were inoculated into 50 ml of crystalline cellulose (Avicel) as the carbon source medium in a 250 ml Erlenmeyer flask (the recipe is shown in step 3 of Example 1), and the inoculation amount was 2.5*10 5 The samples were cultured at 45°C and 150 rpm, and samples were taken on the eighth day. After the samples were treated by the method described in step 3.2 of Example 1, the malic acid content in the fermentation broth was determined.

[0373] The results showed that compared with the wild-type pyruvate carboxylase, the mutation can significantly increase the malic acid production of the transformant. On the eighth day, the malic acid production of the transformant WtPYC was 49.9 g / l, while the malic acid production of the overexpression mutant pyc transformant reached 57.9 g / l, an increase of 16%. The experiment shows that after the protein modification increases the activity of pyruvic acid, the ability of thermophilic Myceliophthora to synthesize malic acid can be significantly improved.

[0374] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A malate transporter mutant protein, characterized in that The malate transporter mutant protein is based on the sequence shown in SEQ ID NO: 22, and has core amino acid mutations selected from the following: I80K, I80W, or I80C; The malate transporter mutant protein has the activity of transporting malate from inside the cell to outside the cell.

2. The mutant protein according to claim 1, characterized in that The malate transporter mutant protein has the following core amino acid mutations: I80K and R272A.

3. The mutant protein according to claim 1, characterized in that The malate transporter mutant protein has the following core amino acid mutations: I80K, E8Q and R272A.

4. An isolated polynucleotide, characterized in that The polynucleotide or a combination thereof encodes the malate transporter mutant protein according to any one of claims 1 to 3.

5. A carrier, characterized in that The vector contains the isolated polynucleotide of claim 4.

6. A host cell, characterized in that The host cell contains the vector of claim 5, or the isolated polynucleotide of claim 4 is integrated into the nucleic acid of the host cell.

7. A method for preparing the malate transporter mutant protein according to any one of claims 1 to 3, characterized in that: Includes steps: Cultivating the host cell according to claim 6 under conditions suitable for expression, thereby expressing the malate transporter mutant protein according to any one of claims 1 to 3; and The expression product is isolated to obtain the malate transporter mutant protein according to any one of claims 1 to 3.

8. A method for increasing malic acid production, characterized in that: Includes steps: i) introducing the polynucleotide or combination thereof according to claim 4 into a suitable host cell; ii) culturing the host cell in the presence of a carbon source, thereby increasing the production of malic acid.

9. A mutant protein combination, characterized in that: The mutant protein combination contains the propionmalate transporter mutant protein according to any one of claims 1-3.

10. Use of the malate transporter mutant protein according to any one of claims 1 to 3, the isolated polynucleotide according to claim 4, the vector according to claim 5, the host cell according to claim 6, or the mutant protein combination according to claim 9, characterized in that: Used for increasing malic acid yield and / or for preparing malic acid.

Images