Group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology

Abstract

The invention discloses a group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology, which is characterized in that the group B streptococcus instant detection device comprises a micro-fluidic chip and a matched instant detection device, the micro-fluidic chip comprises two detection liquid channels, the two detection liquid channels are finally intersected in a detection cavity, and the detection liquid channels are communicated with the detection cavity. The two detection liquid channels are respectively used for dropping detection liquid of the isothermal amplification system and the CRSPR / Cas12a system; the instant detection device comprises an upper cover, a shell, a chip groove, an amber light filter plate, an LED light source, a light path channel, an observation window, a PTC heating plate, a battery box and a switch. Nucleic acid amplification and fluorescence detection can be completed within 40 minutes, and aerosol generation can be effectively reduced through a closed micro-fluidic chip reaction system; compared with a large-scale molecular detection device, the group B streptococcus detection device is more convenient for obstetrics and individuals to carry out instant and rapid detection on group B streptococcus.

Description

Technical Field

[0001] The present invention belongs to the field of detection, in particular to the field of group B streptococcus detection, and specifically is a group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology. Background Art

[0002] Group B Streptococcus (GBS) is the main pathogen causing neonatal infection. GBS colonization in the digestive tract and urogenital tract of pregnant women is the main risk factor for early-onset GBS disease (GBS-EOD) in newborns. About 50% of pregnant women colonized with GBS will transmit the bacteria to their newborns. If prophylactic intravenous antibiotics are not used during delivery, 1% to 2% of newborns will develop GBS-EOD.

[0003] At present, the "Expert Consensus on Prevention of Perinatal Group B Streptococcal Disease (China)" recommends that all pregnant women between 35 and 37 weeks of gestation be screened for GBS. Without using a vaginal speculum, a swab is used to collect samples from the lower 1 / 3 of the vagina, and then the same swab is used to collect samples from the rectum through the rectal sphincter. For pregnant women with positive GBS screening, or those with a history of neonatal GBS, or those with GBS bacteriuria during this pregnancy, it is recommended to use antibiotics for GBS prevention after premature rupture of membranes or entering labor.

[0004] In clinical practice, there are still cases where GBS screening results are not returned at the time of delivery. The consensus recommends that if there is at least one of the following high-risk factors: inevitable premature delivery, premature rupture of membranes, rupture of membranes ≥18h, or fever ≥38℃ during delivery, it is recommended to use broad-spectrum antibiotics that can cover GBS, which can effectively prevent the occurrence of GBS-EOD. If there is a more efficient and rapid GBS detection kit that can better deal with the GBS results that have not been returned at the time of delivery, the GBS colonization situation can be clarified in a very short time, which can help the clinic to prevent neonatal GBS infection while avoiding the abuse of antibiotics, and avoid the toxic and side effects caused by the abuse of antibiotics, the emergence of drug-resistant pathogens, superinfection or cross-infection, and low immunity.

[0005] Existing detection technologies, such as live bacterial culture, PCR, and qPCR, are time-consuming and cannot meet the requirements for on-site detection of group B streptococci. Existing rapid detection methods, such as antigen detection, are inaccurate, insensitive, and have high false positive rates. In general, existing detection methods cannot achieve user-friendly detection processes while performing accurate nucleic acid detection.

[0006] The current guidelines recommend that the standard GBS screening should place the swab in a non-nutritional transport medium after sampling and send it for testing as soon as possible within 24 hours. The laboratory should use selective enrichment broth culture for 18 to 24 hours, then inoculate it into blood agar medium, and identify GBS through latex agglutination test, chromogenic culture, DNA probe or nucleic acid amplification test (NAAT) and other techniques. Enrichment culture can improve the detection rate of GBS, but the detection time is long and it is only used for screening at 35-37 weeks of pregnancy. Single-line NAAT takes a short time (1 to 2 hours) and can be used for immediate testing during labor for pregnant women who have not undergone GBS screening. However, due to the lack of enrichment culture, the sensitivity is reduced, and the detection failure rate is 7% to 10%. In addition, in clinical practice, especially in the case of premature labor, there is a situation of urgency. The detection time of 1-2 hours still cannot guarantee the results before the fetus is delivered. Moreover, studies have shown that many infants with severe GBS infection are premature before the recommended screening time. Therefore, a more efficient and rapid GBS detection kit is needed to better deal with the GBS results that have not been returned at the time of delivery, clarify the GBS colonization situation in a very short time, help clinicians prevent neonatal GBS infection, and avoid the abuse of antibiotics, toxic and side effects caused by the abuse of antibiotics, the emergence of drug-resistant pathogens, superinfection or cross-infection, and low immunity.

[0007] Currently, the 15-minute clinical method for detecting group B streptococci also includes immunochromatography. This kit is limited to detecting group B streptococci in human vaginal secretion samples. The consensus recommends that vaginal and anal swabs should be taken for GBS testing, and the GBS extract should be improved to a more universal secretion extract that can extract GBS from anal and vaginal secretions. In addition, the immunochromatography method is not amplified, and its lower limit of detection range is 10^5CFU / ml, with poor sensitivity and prone to false negatives. In clinical practice, pregnant women with high-risk factors were given antibiotics to prevent infection. Therefore, in the development of the kit, attention should also be paid to the sensitivity of the test results to avoid missed screening and neonatal GBS. Summary of the invention

[0008] In view of the problems existing in the background technology, the present invention proposes a group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology.

[0009] Technical solution:

[0010] A group B streptococcus instant detection device based on isothermal amplification and CRSPR / Cas12a technology, comprising a microfluidic chip and a matching instant detection device, wherein:

[0011] The microfluidic chip includes two detection liquid channels, which finally intersect in the detection chamber. The two detection liquid channels are respectively used for the isothermal amplification system and the CRSPR / Cas12a system detection liquid to drop into;

[0012] The instant detection device includes an upper cover, an outer shell, a chip slot, an amber filter plate, an LED light source, an optical path channel, an observation window, a PTC heating plate, a battery box and a switch, wherein the outer shell is provided with a chip slot for embedding a microfluidic chip; the PTC heating plate is arranged on the back of the chip slot and is connected to the battery box through a switch for heating the chip slot; in the outer shell, an amber filter plate and an observation window are sequentially stacked on the front of the chip slot to form a horizontal observation channel, and the color change of the microfluidic chip behind the amber filter plate is observed through the observation window; in the outer shell, an optical path channel is arranged at the bottom of the observation channel, an LED light source is arranged in the optical path channel, and the LED light source is connected to the battery box through a switch to provide brightness for the observation channel.

[0013] Preferably, the instant detection device also includes a lens, and the LED light source provides brightness for the observation channel through the lens.

[0014] Preferably, the upper cover of the instant detection device is a rectangular parallelepiped as a whole after being combined with the outer shell, the longitudinal section of the outer shell is L-shaped, and the longitudinal section of the upper cover is rectangular.

[0015] Preferably, a vent is provided on the detection cavity of the microfluidic chip.

[0016] Preferably, the two detection liquid channels and the detection cavity of the microfluidic chip are formed by cutting grooves on the bottom plate and pasting an optical-grade bottom film on the grooved surface.

[0017] Preferably, the base plate is made of PMMA material.

[0018] Preferably, the grooving method is light-curing printing or integral casting.

[0019] Preferably, the first channel of the microfluidic chip includes a first inlet, a first flow channel, a first reaction chamber, and a third flow channel connected in sequence; the second channel of the microfluidic chip includes a second inlet, a second flow channel, a second reaction chamber, and a fourth flow channel connected in sequence.

[0020] Preferably, the depths of the first inlet, the second inlet, the first reaction chamber, the second reaction chamber and the detection chamber are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel and the second flow channel are 0.6 mm; the width and depth of the third flow channel and the fourth flow channel are 0.4 mm; wherein the bottom surfaces of the first reaction chamber and the second reaction chamber are both 4.2 mm in length and 7.5 mm in area. 2The detection cavity is a regular triangle with a cavity height of 2mm and a volume of 15μL; the detection cavity is a cylinder with a diameter of 4mm and a height of 2.5mm, with a total volume of 30μL.

[0021] Specific:

[0022] The CRSPR / Cas12a system detection solution is obtained by mixing 1 volume portion of AsCas12a, 1 volume portion of crRNA, 4 volume portions of 10× reaction buffer, 5 volume portions of ssDNA / ssRNA reporter, 1 volume portion of recombinant RNase inhibitor, and 14 volume portions of enzyme-free water;

[0023] The sequence of crRNA is: TTTCACCAGCTGTATTAGAAGTACATG;

[0024] The isothermal amplification system is obtained by mixing 1 volume portion of a forward primer, 1 volume portion of a reverse primer, 3.4 volume portions of a template and enzyme-free water, 8.85 volume portions of a dehydration reaction buffer, and 0.75 volume portions of magnesium acetate;

[0025] The sequence of the forward primer is: ATATGATGTATCTATCTGGAACTCTAGTGGC

[0026] The sequence of the reverse primer is: ATGATTTACCACTTGTGGAGTTGTCACTTGA.

[0027] Beneficial Effects of the Invention

[0028] 1. The present invention can complete nucleic acid amplification and fluorescence detection within 40 minutes, and the closed microfluidic chip reaction system can effectively reduce aerosol generation;

[0029] 2. Compared with large molecular detection devices, the present invention is more convenient for obstetricians and individuals to conduct instant and rapid detection of group B streptococci. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : The overall view of the separation of the instant detection device and the microfluidic chip without the cover, where Figure 1 A. Front view of the instant detection device without the cover installed. Figure 1 B is a front oblique view of the separation of the instant detection device and the microfluidic chip without the cover installed. Figure 1 C is a front oblique view of the microfluidic chip embedded in the real-time detection device without the cover installed. Figure 1 D. Rear oblique view of the instant detection device;

[0031] Figure 2 : Overall view of the instant detection device with the upper cover installed, wherein: Figure 2A is a side view showing the upper cover and the instant detection device separated. Figure 2 B. An oblique view of the upper cover and the instant detection device separated. Figure 2 C vertical posterior oblique view, Figure 2 D is an oblique view after erection;

[0032] Figure 3 : Schematic diagram of the overall microfluidic chip, where: Figure 3 A is an oblique view of the microfluidic chip without the optical-grade bottom film attached. Figure 3 B is the front oblique view of the microfluidic chip standing upright after adhering the optical grade bottom film. Figure 3 C is the rear oblique view of the microfluidic chip standing upright after adhering the optical grade bottom film;

[0033] Figure 4 :Schematic diagram of the operation of the microfluidic chip after the sample liquid is dripped into it;

[0034] Figure 5 :Comparison of the size of the microfluidic chip and the coin;

[0035] Figure 6 : Comparison chart of negative and positive results after chip heating reaction;

[0036] In the accompanying drawings, 1-microfluidic chip includes 101-first inlet, 102-second inlet, 103-first flow channel, 104-second flow channel, 105-third flow channel, 106-fourth flow channel, 107-first reaction chamber, 108-second reaction chamber, 109-detection chamber, 110-vent, 111-optical grade bottom film;

[0037] 2-The instant detection device includes, 201-upper cover, 202-housing, 203-chip slot, 204-amber filter plate, 205-LED light source, 206-light path channel, 207-lens, 208-observation window, 209-PTC heating plate, 210-battery box, 211-switch; DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with embodiments, but the protection scope of the present invention is not limited thereto:

[0039] Combination Figure 3 The microfluidic chip 1 is 33 mm long, 20 mm wide and about 3.5 mm thick;

[0040] The microfluidic chip 1 as a whole is composed of a 0.45 mm optical grade sealing plate and a 3 mm polymethyl methacrylate (PMMA) plate;

[0041] The microfluidic chip 1 is made of PMMA material and can be manufactured by photocuring printing, integral casting and other methods;

[0042] The microfluidic chip 1 is provided with flow channels and chambers, which are composed of a first inlet 101, a second inlet 102, a first flow channel 103, a second flow channel 104, a third flow channel 105, a fourth flow channel 106, a first reaction chamber 107, a second reaction chamber 108, and a detection chamber 109;

[0043] The depths of the first inlet 101, the second inlet 102, the first reaction chamber 107, the second reaction chamber 108 and the detection chamber 109 are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel 103 and the second flow channel 104 are 0.6 mm, and the width and depth of the third flow channel 105 and the fourth flow channel 106 are 0.4 mm; wherein the bottom surfaces of the first reaction chamber 107 and the second reaction chamber 108 are both 4.2 mm in length and 7.5 mm in area. 2 The detection cavity 109 is a regular triangle with a cavity height of 2 mm and a volume of 15 μL; the detection cavity 109 is a cylinder with a diameter of 4 mm and a height of 2.5 mm, and a total volume of 30 μL;

[0044] The first inlet 101 and the second inlet 1022 are connected to each other at the upper ends of the first flow channel 103 and the second flow channel 104, respectively, and the whole is in an "L" shape;

[0045] The upper parts of the first reaction chamber 107 and the second reaction chamber 108 are connected and communicated with the upper ends of the first flow channel 103 and the second flow channel 104;

[0046] The upper parts of the third flow channel 105 and the fourth flow channel 106 are connected to and communicated with the upper parts of the first reaction chamber 107 and the second reaction chamber 108, and then extend parallel to the ground of the microfluidic chip, and finally converge in a "Y" shape with mirror symmetry;

[0047] The detection cavity 109 intersects with the converging third flow channel 105 and the fourth flow channel 106;

[0048] The vent 110 is located at the detection cavity 109 near the outer edge of the microfluidic chip, has a diameter of 0.4 mm, leads to the bottom surface of the chip, that is, the side without the bottom film adhered, and communicates with the outside.

[0049] Combination Figure 1 and Figure 2 The instant detection device 2 is about 7.3 cm long, 4.0 cm wide and 5.0 cm high, and is composed of an upper cover 201, a battery box 210, a PTC heating plate 209, a chip slot 203, a housing 202, an amber filter plate 204, an LED light source 205 and a lens 207;

[0050] The upper cover 201 is a cuboid with a length of 73 mm, a width of 20.5 mm, and a height of 17.5 mm. At the lower edge, i.e., the side in contact with the housing 202, there is a protrusion with a thickness of 1.5 mm, a length of 20.5 mm, and a height of 2 mm, so as to facilitate the combination with the housing 202;

[0051] After the upper cover 201 and the outer shell 202 are combined, the space formed in the middle can accommodate the circuit, the PTC heating plate 209 and the microfluidic chip 1.

[0052] The battery box 210 contains three 1.5V batteries to supply power to the PTC heating plate 209 with a rated voltage of 4.5V.

[0053] The PTC heating plate 209 is 30 mm long, 30 mm wide and 6 mm high. The rated voltage of the heating plate is 4.5 V, the rated power is 1 W, and the temperature can be maintained at 37°C.

[0054] The amber filter plate 204 has a thickness of 5 mm, a filtering wavelength of 470 nm, a length of 33.3 mm, and a width of 4 mm, and is just embedded in the observation window of the housing 202;

[0055] The LED light source 205 emits light with a wavelength of 460-470nm, which is blue light. The rated voltage of the light source is 4.5V and the rated power is 1W.

[0056] The lens 207 has a diameter of 21.7 mm, a focal length of 3 mm, a working distance of 3 mm, and a numerical aperture of 0.7 mm. The lens focuses the blue light emitted by the LED light source 205 into the chip slot 203;

[0057] The switch 211 is located on the upper rear side of the battery box 210 and is a three-position switch. The first position is to close the entire circuit, the second position is to turn on the PTC heating plate 209, and the third position is to turn on the LED light source 205.

[0058] The technical features of the present invention are as follows:

[0059] 1. Design of gravity microfluidic chip

[0060] (1) The design of the two reaction chambers, the overall flow path inside the chip, and the "L"-shaped arrangement of the reaction chambers enable the chip to carry out the reaction process with the help of gravity;

[0061] (2) The fully enclosed microfluidic chip design can avoid aerosol contamination;

[0062] (3) The chip is small and can meet the requirements of high speed;

[0063] 2. Combination of gravity microfluidic chip and nucleic acid isothermal amplification detection system

[0064] (1) Combination of isothermal amplification system and CRISPR / Cas detection system;

[0065] (2) Gravity microfluidics combined with isothermal amplification and CRISPR / Cas detection systems can better empower each other;

[0066] 3. Design of supporting testing equipment

[0067] (1) The arrangement of the internal parts of the entire instant detection device and the relative positions of the internal parts;

[0068] (2) The optical pathway is embedded inside the device so that when fluorescence is excited, the LED light beam is more concentrated in the detection cavity.

[0069] Specific operation process:

[0070] During the specific implementation process, an optical-grade bottom film 111 is used to seal the microfluidic chip 1 for standby use. The sample taken is subjected to preliminary processing (the preliminary processing may include DNA extraction and pathogen nucleic acid release, etc.). The treated sample is mixed with the isothermal amplification system, and the isothermal amplification system and the CRISPR / Cas12a system are dripped into the first inlet 101 and the second inlet 102 with a 15 μL dropper. The first inlet 101 and the second inlet 102 are sealed with a bottom film (or a sealing material such as transparent tape). Open the upper cover 201 of the instant detection device 2, and place the sealed microfluidic chip 1 into the chip slot 203. The chip slot 203 is the same size as the microfluidic chip 1, which can just accommodate the microfluidic chip 1, and make the back of the chip fit tightly with the PTC heating plate 209. Close the upper cover 201. It can be observed through the observation window 208 and the amber filter plate 204 that, driven by gravity, the liquid at the first inlet 101 and the second inlet 102 will flow through the first flow channel 103 and the second flow channel 104, and finally evenly enter the first reaction chamber 107 and the second reaction chamber 108 respectively.

[0071] Turn on switch 211, dial from one gear to two gears, turn on PTC heating plate 209, wait for the temperature to rise to the set temperature (according to the different isothermal amplification techniques used, it can be adjusted), DNA target is first isothermal amplified in the first reaction chamber 107, Cas12a and crRNA will be pre-combined in the second reaction chamber 108 and pre-obtain the best trans-cutting temperature preheating. After waiting for 15-40 minutes (according to the different isothermal amplification techniques used, it can be adjusted), the instant detection device 2 is rotated clockwise by 90 ° (the surface where the amber filter plate 204 is located is the front of the device). At this time, the chip is in a vertical state, and under gravity drive, the reaction system in the first reaction chamber 107 and the second reaction chamber 108 passes through the third flow channel 105 and the fourth flow channel 106 respectively, and is finally mixed in the detection chamber 109. CRISPR / Cas12a continues to carry out 5 minutes of trans-cutting determination, and Cas12a, under the guidance of crRNA, specifically identifies the amplified product, and the surrounding fluorescent reporter molecules are trans-cut, and then a fluorescent signal is generated.

[0072] When the reaction is finished, the switch 211 is turned from the second gear to the third gear, the PTC heating plate 209 is turned off, and the LED light source 205 is turned on. The LED light source 205 emits blue light in the wavelength range of 460-470nm, and the light passes through the optical path channel 206, through the lens 207, and is focused to the detection cavity 109 to excite the fluorescent reporter molecule to generate a fluorescent signal. The final reaction result can be observed by naked eyes through the observation window 208 and the amber filter plate 204. Specific embodiment 1:

[0074] The total volume of the CRISPR / Cas12a reaction system is 15 μL, including 100 nM AsCas12a, 200 nM crRNA, 1000 nM DNA reporter, 1×NEB r3.1 buffer and 2 U / μL RNase inhibitor;

[0075] The isothermal amplification system (also known as recombinase polymerase amplification (RPA) reaction system) has a total volume of 15 μL, including 1 μL forward primer (Sangon Biotech Co., Ltd.), 1 μL reverse primer (Sangon Biotech Co., Ltd.), 3.4 μL template and enzyme-free water (purchased from New England Biolabs, Inc.), 8.85 μL dehydrated reaction buffer (purchased from TwistDx), and 0.75 μL magnesium acetate (purchased from TwistDx).

[0076] Table 1 CRISPR / Cas12a detection system

[0077]

[0078] The ssDNA reporter is: FAM-CCCCC-BHQ1-3';

[0079] The ssRNA reporter is: FAM-UUUUU-BHQ1-3';

[0080] The present invention selects the sequence on the cfb gene encoding the CAMP factor of group B streptococcus as the target, and we designed a pair of RPA primers and crRNA for guiding Cas12a.

[0081] The gene sequences involved are as follows:

[0082] GBS cfb gene target sequence:

[0083] ACCAACATGGGCCCTGTAAATTAAAAATACTGCAGTAGAAGTGATTTTAGTTTTAAAGGAGGAAATTTATTATGAACGTTACACATATGATGTATCTATCTGGAACTCTAGTGGCTGGTGCATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGACAACTCCACAAGTGGTAAATCATGTAAATAGTAATAATCAAGCCCAGCAAATGGCTCAAAAGCTTGATCAAGA

[0084] RPA forward primer: ATATGATGTATCTATCTGGAACTCTAGTGGC

[0085] RPA reverse primer: ATGATTTACCACTTGTGGAGTTGTCACTTGA

[0086] crRNA sequence: TTTCACCAGCTGTATTAGAAGTACATG

[0087] Use the gravity microfluidic chip and supporting detection equipment of the present invention, and the specific operation process of the invention.

[0088] Add the sample and the configured RPA reaction reagent to the first inlet 101, add the CRISPR / Cas12a reaction reagent to the second inlet 102, and then use a piece of optical-grade bottom film 111 to seal the first inlet 101 and the second inlet 102. When the microfluidic chip 1 is in a horizontal state, the two reagents will flow into the first reaction chamber 107 and the second reaction chamber 108 respectively under the action of gravity. Under incubation at 37°C, the synthetic cfb gene sequence with a concentration of 100 copies / μL in the first reaction chamber 107 is RPA amplified. In the second reaction chamber 108, Cas12a and crRNA will be pre-combined and pre-heated to the optimal trans-cutting temperature. After rotating the chip 90°, the chip is in a vertical state. Driven by gravity, the two reagents will mix in the detection chamber 109, and CRISPR / Cas12a will continue to perform trans-cutting assays for 5 minutes. The specific process is as follows Figure 4 .

[0089] The PTC heating plate 209 can reach 37°C in about 5 minutes, and the temperature remains relatively stable within 30 minutes, fluctuating at 37±0.5°C. Under the stimulation of the LED light source 205, the naked eye can clearly distinguish between positive and negative results. The final reaction result can be observed by the naked eye through the orange filter. The result is as follows Figure 6 .

[0090] Compared with the prior art, the present invention has obvious advantages:

[0091] 1. Existing detection technologies, such as live bacterial culture, PCR, qPCR, etc., are time-consuming and cannot meet the requirements for on-site detection of group B streptococci. The present invention combines isothermal amplification technology with CRISPR / Cas12a to achieve results within 40 minutes;

[0092] 2. Existing rapid detection methods, such as antigen detection, have problems such as inaccuracy, insensitivity, and high false positive rate. The present invention combines isothermal amplification technology with CRISPR / Cas12a to achieve a sensitive detection accuracy of 1 copy;

[0093] 3. In general, existing detection methods cannot achieve a user-friendly detection process while performing accurate nucleic acid detection. The instant detection device provided by the present invention is compact and portable. During the operation, it only needs to mix the treated sample solution with the reaction system and add it to the chip inlet, incubate at a constant temperature, and then invert it. After sufficient mixing, the results can be observed.

[0094] Summary: Pregnant women will give birth within 1-2 hours, and the entire process from sampling to GBS determination can be controlled to 40 minutes at the fastest and completed at the bedside. This is simple and acceptable, and can provide an important window of time for clinicians to make a diagnosis, choose treatment and delivery methods.

[0095] The specific embodiments described herein are merely examples of the spirit of the present invention. Those skilled in the art may make various modifications or additions to the specific embodiments described or replace them in similar ways, but they will not deviate from the spirit of the present invention or exceed the scope defined by the appended claims.

Claims

1. A device for real-time detection of group B streptococci based on isothermal amplification and CRSPR / Cas12a technology, characterized in that It comprises a microfluidic chip (1) and a matching instant detection device (2), wherein: The microfluidic chip (1) comprises two detection liquid channels, which eventually intersect in the detection chamber (109), and the two detection liquid channels are respectively used for the isothermal amplification system and the CRSPR / Cas12a system detection liquid to drop into; The instant detection device (2) comprises an upper cover (201), a housing (202), a chip slot (203), an amber filter plate (204), an LED light source (205), an optical path channel (206), an observation window (208), a PTC heating plate (209), a battery box (210) and a switch (211), wherein the housing (202) is provided with a chip slot (203) for embedding the microfluidic chip (1); the PTC heating plate (209) is arranged on the back of the chip slot (203) and is connected to the battery box (210) via the switch (211) for heating the chip. slot (203); in the housing (202), an amber filter plate (204) and an observation window (208) are sequentially stacked on the front of the chip slot (203) to form a horizontal observation channel, and the color change of the microfluidic chip (1) behind the amber filter plate (204) is observed through the observation window (208); in the housing (202), an optical path channel (206) is arranged at the bottom of the observation channel, and an LED light source (205) is arranged in the optical path channel (206), and the LED light source (205) is connected to a battery box (210) through a switch (211) to provide brightness for the observation channel.

2. The device according to claim 1, characterized in that The instant detection device (2) further comprises a lens (207), and the LED light source (205) provides brightness for the observation channel through the lens (207).

3. The device according to claim 1, characterized in that The upper cover (201) of the instant detection device (2) is in the form of a rectangular parallelepiped when combined with the outer shell (202); the longitudinal section of the outer shell (202) is L-shaped, and the longitudinal section of the upper cover (201) is rectangular.

4. The device according to claim 1, characterized in that A vent (110) is provided on the detection cavity (109) of the microfluidic chip (1).

5. The device according to claim 1, characterized in that The two detection liquid channels and the detection cavity (109) of the microfluidic chip (1) are formed by cutting grooves on the bottom plate and pasting an optical-grade bottom sealing film (111) on the grooved surface.

6. The device according to claim 5, characterized in that The base plate is made of PMMA material.

7. The device according to claim 5, characterized in that The grooving method is light-curing printing or integral casting.

8. The device according to claim 1, characterized in that The first channel of the microfluidic chip (1) comprises a first inlet (101), a first flow channel (103), a first reaction chamber (107), and a third flow channel (105) which are connected in sequence; the second channel of the microfluidic chip (1) comprises a second inlet (102), a second flow channel (104), a second reaction chamber (108), and a fourth flow channel (106) which are connected in sequence.

9. The device according to claim 8, characterized in that The depths of the first inlet (101), the second inlet (102), the first reaction chamber (107), the second reaction chamber (108) and the detection chamber (109) are 2 mm, 2 mm, 2 mm, 2 mm and 2.5 mm respectively; the width and depth of the first flow channel (103) and the second flow channel (104) are 0.6 mm; the width and depth of the third flow channel (105) and the fourth flow channel (106) are 0.4 mm; wherein the bottom surfaces of the first reaction chamber (107) and the second reaction chamber (108) are both 4.2 mm in length and 7.5 mm in area. 2 The detection cavity (109) is a regular triangle with a cavity height of 2 mm and a volume of 15 μL; the detection cavity (109) is a cylinder with a diameter of 4 mm and a height of 2.5 mm, and a total volume of 30 μL.

10. The device according to claim 1, characterized in that: The CRSPR / Cas12a system detection solution is obtained by mixing 1 volume portion of AsCas12a, 1 volume portion of crRNA, 4 volume portions of 10× reaction buffer, 5 volume portions of ssDNA / ssRNA reporter, 1 volume portion of recombinant RNase inhibitor, and 14 volume portions of enzyme-free water; The sequence of crRNA is: TTTCACCAGCTGTATTAGAAGTACATG; The isothermal amplification system is obtained by mixing 1 volume portion of a forward primer, 1 volume portion of a reverse primer, 3.4 volume portions of a template and enzyme-free water, 8.85 volume portions of a dehydration reaction buffer, and 0.75 volume portions of magnesium acetate; The sequence of the forward primer is: ATATGATGTATCTATCTGGAACTCTAGTGGC The sequence of the reverse primer is: ATGATTTACCACTTGTGGAGTTGTCACTTGA.

Images