Fusion protein with sequence preference and gene editing system

Abstract

The invention provides a fusion protein with sequence preference and a gene editing system, and relates to the technical field of gene editing. The invention discloses that the key 48th amino acid for binding TadA-8e and substrate DNA influences the overall editing efficiency, editing accuracy and sequence preference of ABE8e for the first time; through rational design, a TadA-8e part in ABE8e is modified, saturation mutation is designed at a key 48th amino acid for combining the TadA-8e and a substrate DNA, and YAY high-precision ABE with sequence preference is developed. According to the method, A in a sequence YAY (Y = T or C) in an editing window can be accurately edited into G, other A is not edited or only low editing is generated, the problem of'adjacent base 'mutation is avoided, and potential safety hazards caused by wrong mutation are reduced.

Description

Technical Field

[0001] The present application relates to the field of gene editing technology, and in particular to a fusion protein with sequence preference and a gene editing system. Background Art

[0002] Studies have shown that about 60% of genetic diseases are currently caused by single base mutations. The new generation of gene editing technology, namely base editing technology, can achieve efficient base conversion, bringing hope for the cure of genetic diseases caused by single base mutations. At present, the main representatives of base editing technology are cytosine base editing technology (CBE) and adenine base editing technology (ABE), which are formed by the fusion of cytosine deaminase or adenine deaminase with Cas9, and can achieve efficient C to T and A to G base conversion at specific sites in the genome.

[0003] ABE is one of the most important basic research tools in base editors. The most efficient adenine base editor currently considered is ABE8e. However, ABE8e still has "neighboring base" mutations within the editing window, and these "neighboring bases" can bring unpredictable safety risks. Summary of the invention

[0004] In an attempt to solve the above problems, the present invention rationally designed TadA-8e based on the crystal structure of ABE8e protein and developed a YAY (Y=T or C) high-precision ABE with sequence preference, which has the function of only editing A in the sequence YAY within the editing window, and does not edit other A or only produces lower editing, which can avoid the above-mentioned "adjacent base" mutation problem and improve editing accuracy.

[0005] On the one hand, the present application provides an adenine deaminase mutant, which is counted sequentially from the N (nitrogen) end of the sequence to the C (carbon) end, and the adenine deaminase mutant is obtained by mutating the 48th alanine residue in the adenine deaminase amino acid sequence to a glutamic acid residue, a phenylalanine residue, a leucine residue, an isoleucine residue, a methionine residue, a valine residue, a serine residue, a proline residue, a threonine residue, a tyrosine residue, a histidine residue, a glutamine residue, an asparagine residue, a lysine residue, an aspartic acid residue, a cysteine ​​residue, a tryptophan residue, an arginine residue or a glycine residue; the adenine deaminase comprises an amino acid sequence as shown in SEQ ID No. 2 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO. 2.

[0006] Preferably, the adenine deaminase comprises an amino acid sequence as shown in SEQ ID No. 2 or an amino acid sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO. 2.

[0007] Preferably, the sequence encoding the adenine deaminase comprises the nucleotide sequence shown in SEQ ID No.1 or a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.1.

[0008] More preferably, the amino acid sequence of the adenine deaminase is shown as SEQ ID No.2, and the nucleotide sequence encoding the adenine deaminase is shown as SEQ ID No.1.

[0009] Furthermore, the adenine deaminase mutant is obtained by mutating the 48th alanine residue in the amino acid sequence of adenine deaminase to a glutamic acid residue.

[0010] Further, the adenine deaminase mutant comprises an amino acid sequence as shown in SEQ ID No.4 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.4; preferably, the sequence encoding the adenine deaminase mutant comprises a nucleotide sequence as shown in SEQ ID No.3 or a nucleotide sequence having at least 98% sequence identity with SEQ ID No.3.

[0011] Preferably, the adenine deaminase mutant comprises an amino acid sequence as shown in SEQ ID No.4 or an amino acid sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID NO.4.

[0012] Preferably, the sequence encoding the adenine deaminase mutant comprises the nucleotide sequence shown in SEQ ID No.3 or a nucleotide sequence having at least 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity with SEQ ID No.3.

[0013] More preferably, the amino acid sequence of the adenine deaminase mutant is shown as SEQ ID No.4, and the nucleotide sequence encoding the adenine deaminase mutant is shown as SEQ ID No.3.

[0014] On the other hand, the present application also provides a fusion protein, which includes the adenine deaminase mutant.

[0015] Furthermore, the fusion protein also includes a nuclease; the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the amino acid sequence of Cas9 includes the amino acid sequence shown in SEQ ID No.43 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.43; more preferably, the coding sequence of Cas9 includes the nucleotide sequence shown in SEQ ID No.44 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.44.

[0016] Specifically, the amino acid sequence of the Cas9 includes the amino acid sequence shown in SEQ ID No.43 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.43; the coding sequence of the Cas9 includes the nucleotide sequence shown in SEQ ID No.44 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO. NO.44 has a nucleotide sequence with 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9% sequence identity.

[0017] More preferably, the amino acid sequence of the Cas9 is shown as SEQ ID No.43; the coding sequence of the Cas9 is shown as SEQ ID No.44.

[0018] Furthermore, the fusion protein also includes NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein; more preferably, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.41 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.41; more preferably, the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.42 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.42.

[0019] Specifically, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.41 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.41; the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.42 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO. NO.42 has a nucleotide sequence with 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9% sequence identity.

[0020] More preferably, the amino acid sequence of the NLS is shown as SEQ ID No.41; the coding sequence of the NLS is shown as SEQ ID No.42.

[0021] Furthermore, in the fusion protein, the adenine deaminase mutant and the nuclease are sequentially connected starting from the N (nitrogen) end of the sequence toward the C (carbon) end.

[0022] In a preferred embodiment, starting from the N-terminus of the sequence toward the C-terminus, the NLS, the adenine deaminase mutant, the nuclease, and the NLS in the fusion protein are connected in sequence.

[0023] It will be understood by those skilled in the art that a known linker can be added between the NLS, the adenine deaminase mutant and the nuclease for connection, and that the fusion protein can also be subjected to known modifications, including phosphorylation, acetylation, ubiquitination, glycosylation, etc., without affecting the function of the fusion protein itself.

[0024] In a preferred embodiment, the amino acid sequence of the Linker is shown as SEQ ID No.45, and the nucleotide sequence is shown as SEQ ID No.46.

[0025] On the other hand, the present application also provides a biomaterial, which comprises any one of the following A)-D):

[0026] A) a gene encoding the adenine deaminase mutant, or the fusion protein;

[0027] B) an expression cassette, the expression cassette comprising the gene described in A);

[0028] C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette;

[0029] D) a recombinant cell or recombinant bacterium, comprising the adenine deaminase mutant, the fusion protein, A) the gene, B) the expression cassette or C) the recombinant vector.

[0030] The expression cassette described herein may also include functional elements such as promoters, terminators, and marker genes, and those skilled in the art may make routine selections based on actual conditions, as long as the expression of the gene described in A) can be achieved. The structure and composition of the expression cassette are not excessively restricted here.

[0031] The vector described in this article refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and expression. The vector can be a cloning vector or an expression vector. Those skilled in the art can choose according to actual conditions, and no excessive restrictions are imposed here.

[0032] It is understandable that those skilled in the art can select appropriate gene editing systems and gene editing methods according to actual conditions to complete the transformation of the above-mentioned mutants.

[0033] On the other hand, the present application also provides a single-base gene editing system with sequence preference, the single-base gene editing system includes the fusion protein; preferably, the single-base gene editing system also includes sgRNA, the sgRNA guides the fusion protein to perform single-base gene editing on the target gene in the target cell; more preferably, the target sequence of the sgRNA includes at least one of SEQ ID No.47-SEQ ID No.51; preferably, the single-base gene editing system edits adenine at a specific position, and the adjacent base of adenine at the specific position is thymine or cytosine; more preferably, the bases on both sides of the adenine at the specific position are thymine and / or cytosine.

[0034] Preferably, the adenine (A) at the specific position includes adenine flanked by thymine (T) and thymine, cytosine (C) and cytosine, or thymine and cytosine.

[0035] Preferably, the single-base gene editing system edits adenine at a specific position into guanine (G).

[0036] The present invention discloses for the first time that the critical 48th amino acid for TadA-8e binding to substrate DNA affects the overall editing efficiency, editing accuracy and sequence preference of ABE8e. The preference is reflected in the fact that the single-base gene editing system can edit A to G in the sequence YAY (Y=T or C) within the editing window, while A at other positions is not edited or only produces lower editing.

[0037] In a specific implementation, the target sequence of the sgRNA includes any one, any two, any three, any four or all five of SEQ ID No. 47, SEQ ID No. 48, SEQ ID No. 49, SEQ ID No. 50, and SEQ ID No. 51.

[0038] In a preferred embodiment, the editing target is one or more of HEK2, CCR5-sg1p, TIM3-sg1, PPP1R12Csite11, and PD-1-sg4.

[0039] It has been demonstrated in this application that in the case of multiple targets, the fusion protein exhibits the ability to edit from A to G and maintains considerable activity. Therefore, those skilled in the art can choose to design other editing targets for gene editing operations on this basis, and no excessive restrictions are imposed here.

[0040] On the other hand, the present application also provides the use of the adenine deaminase mutant, or the fusion protein, or the biomaterial, or the single-base gene editing system in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products.

[0041] Furthermore, the gene editing is to edit adenine at a specific position, and the adjacent bases of adenine at the specific position are thymine or cytosine; preferably, the bases on both sides of adenine at the specific position are thymine and / or cytosine.

[0042] Preferably, the adenine (A) at the specific position includes adenine flanked by thymine (T) and thymine, cytosine (C) and cytosine, or thymine and cytosine.

[0043] Preferably, the single-base gene editing system edits adenine at a specific position into guanine (G).

[0044] The present invention has the following beneficial effects:

[0045] 1. The present invention discloses for the first time that the key amino acid 48 for TadA-8e to bind to substrate DNA affects the overall editing efficiency, editing accuracy and sequence preference of ABE8e;

[0046] 2. In view of the technical defects existing in the existing adenine base editing technology, the present invention, for the first time, rationally designed and modified the TadA-8e part in ABE8e, designed a saturation mutation at the key 48th amino acid for TadA-8e to bind to the substrate DNA, mutated the original alanine to glutamate, and developed a high-precision ABE with sequence preference (YAY), named ABE10. It can accurately edit A to G in the sequence YAY (Y=T or C) within the editing window, and does not edit other A or only produces low editing, which can perform selective editing in specific scenarios, thereby improving the editing accuracy, avoiding the "adjacent base" mutation problem, and reducing the safety risks caused by erroneous mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0048] Figure 1 is a schematic diagram of the construction of the ABE8e A48 mutation, wherein bpNLS is a nuclear localization signal (its amino acid sequence is shown in SEQ ID No.41, and its nucleotide sequence is shown in SEQ ID No.42), SpCas9 (D10A) is a nuclease (its amino acid sequence is shown in SEQ ID No.43, and its nucleotide sequence is shown in SEQ ID No.44), and Linker (its amino acid sequence is shown in SEQ ID No.45, and its nucleotide sequence is shown in SEQ ID No.46);

[0049] Figure 2 This is a comparison of the editing efficiency of different ABE8e mutants at the endogenous human target site HEK2;

[0050] Figure 3 It is a comparison chart of the editing efficiency of ABE10 (i.e., ABE8e A48E) at four endogenous human target sites containing YAY (Y=T or C) sequences. DETAILED DESCRIPTION

[0051] Technical terms:

[0052] Sequence preference: Sequence preference in this application refers to the ability of the single-base gene editing system to accurately edit A to G in the sequence YAY (Y = T or C) within the editing window, while not editing A at other positions or only producing lower editing.

[0053] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules in molecular evolution research.

[0054] Recombination: Broadly speaking, any gene exchange process that causes genotype changes is called recombination.

[0055] Expression cassette: An expression cassette is a group of DNA sequences consisting of a promoter, a target gene, and a reporter gene, which can be expressed in specific tissues and easily detected.

[0056] Recombinant vector: A recombinant vector is a vector that transfers the target gene into the basic skeleton of a cloning vector, thereby enabling the target gene to be expressed.

[0057] Recombinant bacteria: A fungal cell strain that uses genetic engineering methods to efficiently express exogenous genes.

[0058] Recombinant cell: The term "recombinant cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "recombinant cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0059] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0060] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0061] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0062] The processes, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention has no particular limitations, such as those described in Sambrook et al., Molecular Cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the recommended conditions of the manufacturer.

[0063] 1.1 Plasmid design and construction

[0064] 1.1.1. The adenine base editor currently considered to be the most efficient is ABE8e, which has lost the original YAC sequence preference and brought about more "adjacent base" mutations, posing potential safety risks.

[0065] In this example, the TadA-8e part of ABE8e was modified. According to the protein crystal structure of adenine deaminase TadA-8e, a saturation mutation was designed at the 48th amino acid, which is critical for TadA-8e to bind to substrate DNA. Another 19 mutant plasmids A48X (X represents 19 natural amino acids other than A, which are represented by the general amino acid abbreviation symbols as follows) were constructed by the Gibson assembly method. Figure 1 ): ABE8e A48F, ABE8e A48L, ABE8e A48I, ABE8e A48M, ABE8e A48V, ABE8e A48S, ABE8e A48P, ABE8e A48T, ABE8e A48Y, ABE8e A48H, ABE8e A48Q, ABE8e A48N, ABE8e A48K, ABE8e A48D, ABE8e A48E, ABE8e A48C, ABE8e A48W, ABE8e A48R, ABE8e A48G (sequences are shown in Table 1). Taking ABE8e A48F as an example, "A48F" means that the 48th amino acid alanine (A) in TadA8e is mutated to phenylalanine (F).

[0066] Table 1 Truncated plasmid sequence (TadA8e part)

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073] 1.1.2. Five endogenous targets from humans, HEK2, CCR5-sg1p, TIM3-sg1, PPP1R12Csite11, and PD-1-sg4, were designed for screening. The DNA of the targets HEK2, CCR5-sg1p, TIM3-sg1, PPP1R12Csite11, and PD-1-sg4 shown in Table 2 were artificially synthesized and connected to the BbsⅠ site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP (used to express the sgRNA of the corresponding target) by restriction cloning to obtain the recombinant target plasmid. The target and sequence are shown in Table 2.

[0074] Taking the target HEK2 (GAACACAAAGCATAGACTGCGGG) as an example, the target has a YAC (Y=T or C) sequence and there are many A's next to it, so it can be used as an ideal screening target.

[0075] Table 2 Targets and sequences used

[0076] Target name Sequence (5'-3') SEQ ID No. HEK2 GAACACAAAGCATAGACTGCGGG 47 CCR5-sg1p TGACATCAATTATTATACATCGG 48 TIM3-sg1 TTCTACACCCCAGCCGCCCCAGG 49 PPP1R12C site11 GTCATACACTGGGCTGGCCAGGG 50 PD-1-sg4 CTTCCACATGAGCGTGGTCAGGG 51

[0077] 1.1.3. Perform Sanger sequencing on the plasmids constructed in 1.1.1 and 1.1.2 to ensure they are completely correct.

[0078] 1.2 Cell transfection

[0079] HEK293T 2×10 5 The cells were plated in 24-well plates. When the cells grew to 70%-80%, the plasmid combination was transfected according to ABE8e A48X:sgRNA=750ng:250ng. Each plasmid combination was transfected in 3 replicates, with 2×10 cells per well. 5 cells. A blank control without transfection of any plasmid was set up at the same time. After 24h and 48h of transfection, the supernatant was discarded and 500μL of complete culture (89% DMEM (Gibco) + 10% FBS (BioVision Technology) + 1% PS (Gibco)) was added until the cell genome was extracted.

[0080] ABE8e A48X is specifically any one of plasmids ABE8e A48F, ABE8e A48L, ABE8e A48I, ABE8e A48M, ABE8e A48V, ABE8e A48S, ABE8e A48P, ABE8e A48T, ABE8e A48Y, ABE8e A48H, ABE8e A48Q, ABE8e A48N, ABE8e A48K, ABE8e A48D, ABE8e A48E, ABE8e A48C, ABE8e A48W, ABE8e A48R, and ABE8e A48G, and plasmid ABE8e is used as a control.

[0081] 1.3. Genome extraction and preparation of amplicon libraries

[0082] 72h after transfection, BIOSEARCH QuickExtract TM The cell genomic DNA was extracted using a DNA extraction kit (QE09050). The corresponding identification primers were then designed (Table 3), i.e., a bridge sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and a bridge sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, to obtain a first-round PCR product. The first-round PCR product was then used as a template for a second round of PCR, mixed together, cut and recovered, purified, and then sent to a sequencing company for NGS sequencing.

[0083] Table 3. Primers used to identify the targets

[0084]

[0085] 1.4 Data Analysis

[0086] www.rgenome.net was used to process the NGS results. According to the tool characteristics, the analysis type of SpCas9 NGG and ABE was selected for adenine base editors. A>G on the PAM sequence (usually 2-14nt) was counted, and the data were summarized and plotted using Graphpad to obtain the final editing efficiency results (such as Figure 2-3 ).

[0087] in conclusion:

[0088] Through screening, it was found that Figure 2As shown in the figure, most mutants of all ABE8e A48X can edit A5, A7, and A8 in the HEK target site with different editing efficiencies. However, only ABE8e A48E can edit A5, i.e., A in YAC, with very low or almost no editing at A7 (the first A in CAA) and A8 (the second A in AAA); and the average editing efficiency at A5 is 41.6%, which is the same as the editing efficiency of ABE8e at this A5 site (43.5%). Therefore, compared with ABE8e, ABE8e A48E may be an ABE with sequence YAC sequence specificity, named ABE10.

[0089] To further verify this hypothesis, the target sites of four other individuals were compared (e.g. Figure 3 ), and found that ABE8e could edit almost all the A in these four target sites with high efficiency.

[0090] However, ABE10 shows extremely strong sequence preference. Specifically, in CCR5-sg1p, ABE8e can edit almost all A residues, ABE10 can only edit A5 (A in CAT), and other A residues cannot be edited; in TIM3-sg1, ABE8e can edit almost all A residues, ABE10 can only edit A5 (middle A in TAC) and A7 (A in CAC), and other residues cannot be edited; in PPP1R12Csite11, ABE8e can edit almost all A residues, ABE10 can only edit A6 (middle A in TAC), and other A residues cannot be edited or are edited with extremely low efficiency; in PD-1-sg4, ABE8e can edit almost all A residues, ABE10 can only edit A6 (middle A in CAC) and A8 (A in CAT), and other A residues cannot be edited.

[0091] In summary, ABE10 is a base editing tool that can accurately edit A in YAY (Y=T or C) to G.

[0092] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. An adenine deaminase mutant, characterized in that: Counting sequentially from the N-terminus of the sequence to the C-terminus, the adenine deaminase mutant is obtained by mutating the 48th alanine residue in the adenine deaminase amino acid sequence to a glutamic acid residue, a phenylalanine residue, a leucine residue, an isoleucine residue, a methionine residue, a valine residue, a serine residue, a proline residue, a threonine residue, a tyrosine residue, a histidine residue, a glutamine residue, an asparagine residue, a lysine residue, an aspartic acid residue, a cysteine ​​residue, a tryptophan residue, an arginine residue or a glycine residue; the adenine deaminase comprises an amino acid sequence as shown in SEQ ID No. 2 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.

2.

2. The adenine deaminase mutant according to claim 1, characterized in that The adenine deaminase mutant is obtained by mutating the 48th alanine residue in the amino acid sequence of adenine deaminase to a glutamic acid residue.

3. The adenine deaminase mutant according to claim 2, characterized in that The adenine deaminase mutant comprises an amino acid sequence as shown in SEQ ID No.4 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.4; preferably, the sequence encoding the adenine deaminase mutant comprises a nucleotide sequence as shown in SEQ ID No.3 or a nucleotide sequence having at least 98% sequence identity with SEQ ID No.

3.

4. A fusion protein, characterized in that The fusion protein comprises the adenine deaminase mutant according to any one of claims 1-3.

5. The fusion protein according to claim 4, characterized in that The fusion protein also includes a nuclease; the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the amino acid sequence of Cas9 includes the amino acid sequence shown in SEQ ID No.43 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.43; more preferably, the coding sequence of Cas9 includes the nucleotide sequence shown in SEQ ID No.44 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

44.

6. The fusion protein according to claim 4, characterized in that The fusion protein also includes NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein; more preferably, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.41 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.41; more preferably, the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.42 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

42.

7. Biomaterial, characterized in that The biological material includes any one of the following A)-D): A) a gene encoding the adenine deaminase mutant according to any one of claims 1 to 3, or the fusion protein according to any one of claims 4 to 6; B) an expression cassette, the expression cassette comprising the gene described in A); C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette; D) A recombinant cell or recombinant bacterium, comprising the adenine deaminase mutant according to any one of claims 1 to 3, the fusion protein according to any one of claims 4 to 6, the gene according to A), the expression cassette according to B or the recombinant vector according to C).

8. A single-base gene editing system with sequence preference, characterized in that: The single-base gene editing system comprises the fusion protein described in any one of claims 4 to 6; preferably, the single-base gene editing system further comprises sgRNA, and the sgRNA guides the fusion protein to perform single-base gene editing on the target gene in the target cell; more preferably, the target sequence of the sgRNA comprises at least one of SEQ ID No.47-SEQ ID No.51; preferably, the single-base gene editing system edits adenine at a specific position, and the adjacent base of adenine at the specific position is thymine or cytosine; more preferably, the bases on both sides of adenine at the specific position are thymine and / or cytosine.

9. Use of the adenine deaminase mutant as described in any one of claims 1-3, or the fusion protein as described in any one of claims 4-6, or the biomaterial as described in claim 7, or the single-base gene editing system as described in claim 8 in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products.

10. The use according to claim 9, characterized in that: The gene editing is to edit adenine at a specific position, and the adjacent bases of adenine at the specific position are thymine or cytosine; preferably, the bases on both sides of adenine at the specific position are thymine and / or cytosine.

Images