Plasmid for rescuing and optimizing CVA10 virus in Vero, method and application

Abstract

The invention provides a plasmid for rescuing and optimizing a CVA10 virus in Vero, a method and application, and belongs to the technical field of virus reverse heredity. The invention provides a recombinant plasmid containing a CVA10 virus genome, which can meet the requirement of a Vero cell platform for virus rescue, and can rescue the virus through two methods of in vitro transcription and in vivo transcription. According to the method disclosed by the invention, the CVA10 virus rescued from the Vero cells has similar biological characteristics with the wild CVA10 virus; according to the invention, the CVA10 virus plasmid can be constructed, the codon-optimized CVA10 virus plasmid can also be constructed, compared with the CVA10 virus rescued by using a wild virus sequence, the optimized CVA10 virus has higher virus titer, the problem that the CVA10 virus cannot be packaged in Vero cells is solved, and a theoretical basis and a practical basis are provided for research and development of CVA10 vaccines.

Description

Technical Field

[0001] The invention belongs to the technical field of virus reverse genetics, and particularly relates to a plasmid, method and application for rescuing and optimizing CVA10 virus in Vero. Background Art

[0002] Hand, foot and mouth disease (HFMD) is a highly contagious viral disease worldwide that mainly affects infants and young children. CVA10 virus is one of the main pathogens causing HFMD. Currently, there is no CVA10 virus vaccine that can be used clinically. The development of a new attenuated live vaccine against CVA10 is of great significance for the prevention and control of HFMD.

[0003] Hand, foot and mouth disease caused by CVA10 virus infection usually presents with mild and self-limiting symptoms, including fever, oral ulcers, and mild blisters or small ulcers on the hands, feet and buttocks, but a small number of cases still present with various severe clinical symptoms, such as onychomycosis, herpetic pharyngitis, hyperCKemia, central nervous system complications, and even death. Previous epidemiological studies have shown that EV71 and CVA16 have been the main pathogens of hand, foot and mouth disease worldwide for decades, but in recent years, with the launch of EV71 vaccines, the epidemic spectrum of hand, foot and mouth disease has changed. However, the EV71 vaccine does not have cross-protection against other enterovirus serotypes, leading to an increase in CVA10 infections.

[0004] Currently, researchers are trying to develop CVA10 vaccines using different methods, all of which are still in the laboratory research stage, such as traditional inactivated virus vaccines (formaldehyde inactivated or β-propiolactone inactivated), virus-like particles (VLPs) and subunit vaccines. EV71, CVA6 and CVA16 vaccine strains generally require that vaccine strains cannot be isolated from clinical samples using tumor cells, but it is very difficult to directly isolate CVA10 from clinical samples using vaccine production cells Vero. Except for the Vero cell-adapted CVA10 / S0148b strain, most CVA10 are RD isolates, which cannot meet the requirements of vaccine development well. In addition, traditional inactivated CVA10 virus vaccines will produce more empty virus particles during the production process, and the immunogenicity of empty virus particles is low, and the neutralizing antibody titer produced in mice is low, and antigenic drift may also occur. Summary of the invention

[0005] The present invention provides a recombinant plasmid, method and application for rescuing an optimized CVA10 virus in Vero. The optimized CVA10 virus (CO-CVA10 virus) is successfully rescued on Vero cells, and the rescued CO-CVA10 virus has similar biological properties to the wild CVA10 virus.

[0006] The invention provides a recombinant plasmid containing a CVA10 viral genome. The skeleton structure of the recombinant plasmid comprises a T7 promoter, an optimized CVA10 viral genome, a polyA tail, a linearization restriction site BglⅡ and a T7 terminator.

[0007] Preferably, the backbone structure of the recombinant plasmid further includes a cis-hammerhead ribozyme HHrib between the T7 promoter and the optimized CVA10 viral genome.

[0008] The optimized CVA10 virus genome is derived from the most complete viral genome obtained by the third-generation sequencing of the CVA10 virus candidate vaccine strain K6-19 / XY / CHN / 2017 (MT828547.1), and the 5' and 3' UTR sequences not included in MT828547.1 are obtained. At the same time, the coding sequence (Coding Sequences, CDS) of MT828547.1 is optimized according to the codons and expression characteristics of Vero cells. The most complete 5' and 3' UTR sequences and the optimized CDS sequences obtained by assembly sequencing are finally obtained to obtain a new Vero optimized strain adaptation strain.

[0009] Preferably, the basic plasmid backbone of the recombinant plasmid includes pUC-GW-Kan or pcDNA3.1.

[0010] The present invention also provides the use of the recombinant plasmid in rescuing the optimized strain CO-CVA10 virus on Vero cells.

[0011] Preferably, the optimized strain CO-CVA10 virus is rescued on the Vero cells using an in vitro transcription method or an in vivo transcription method.

[0012] The present invention also provides a method for rescuing the optimized strain CVA10 virus on Vero cells by in vitro transcription, which is characterized in that it comprises the following steps: linearizing the above-mentioned recombinant plasmid by enzyme digestion and then performing in vitro transcription to obtain infectious RNA, and transfecting the infectious RNA into Vero cells to rescue the virus, thereby obtaining the rescued optimized strain CVA10 virus.

[0013] The present invention also provides an optimized strain CVA10 virus rescued by using the in vitro transcription method.

[0014] The present invention also provides a method for rescuing the optimized strain CVA10 virus on Vero cells by in vivo transcription, comprising the following steps: using the above-mentioned recombinant plasmid and a plasmid containing T7 RNA polymerase to co-transfer to Vero cells for virus rescue to obtain the rescued optimized strain CVA10 virus.

[0015] The present invention also provides an optimized strain CVA10 virus rescued by using the in vivo transcription method.

[0016] The present invention also provides the use of the rescued CVA10 virus in preparing an optimized strain CVA10 vaccine.

[0017] Beneficial effects: The present invention obtained the complete genome of CVA10 through third-generation sequencing, and after codon optimization, reverse genetics was used to design and synthesize a plasmid containing the CO-CVA10 viral genome.

[0018] The plasmid of the present invention can meet the requirements of the Vero cell platform for virus rescue, that is, through: ① an in vitro transcription scheme, transfecting the infectious RNA of the virus into Vero cells to rescue the virus; ② an in vivo transcription scheme, co-transfecting the viral plasmid containing the T7 promoter and the T7 RNA polymerase plasmid into Vero cells, allowing the viral plasmid to be transcribed into a viral RNA genome in vivo, thereby rescuing the virus.

[0019] The optimized strain CVA10 virus and the optimized virus CO-CVA10 rescued from Vero cells by the method of the present invention have similar biological characteristics to the wild CVA10 virus. Therefore, the present invention can obtain the live CVA10 virus rescued by Vero cells, and solve the dilemma that the CVA10 virus cannot be produced on Vero cells through reverse genetics technology, which is expected to solve the difficulties faced in the development of the above-mentioned CVA10 vaccine, thereby preventing hand, foot and mouth disease and benefiting the people. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of CVA10 viral plasmid design, A: CVA10 plasmid sequence design; B: T7 promoter sequence and hammerhead ribozyme sequence; C: BglⅡ restriction site and T7 terminator sequence; D: cis-hammerhead ribozyme secondary structure and cleavage site; E: CVA10 viral plasmid map; Figure 2 Schematic diagram for designing positive control plasmid sequence for RNA transfection; Figure 3 Schematic diagram of two experimental schemes for CVA10 virus rescue, A: T7 in vitro transcription RNA method; B: T7 in vivo transcription RNA method; Figure 4 This is an agarose gel electrophoresis diagram of the RT-PCR product of CVA10 virus RNA. Sample 1 and sample 2 in the figure are both RT-PCR products of CVA10 virus RNA; Figure 5 This is a partial result of the third generation sequencing of the CVA10 virus. A: 5'UTR end sequencing analysis; B: 3'UTR end sequencing analysis; Figure 6This is the RNA structure prediction diagram of the 1-180bp region of the 5'UTR. In the figure, A: RNA structure prediction of the sequence obtained by first-generation sequencing; B: RNA structure prediction of the sequence obtained by third-generation sequencing; Figure 7 Figure 3'UTR RNA structure prediction diagram, A: first generation sequencing obtained RNA structure prediction; B: third generation sequencing obtained RNA structure prediction; Figure 8 This is a diagram of the partial sequencing results of the CVA10 plasmid; Fig. 9 The linearization results of CVA10 plasmid and T7-GFP plasmid, 1-3 in the figure are linearized CVA10 plasmid; 4-6 are linearized T7-GFP plasmid; Fig.10 The results of cytopathic effects are shown in Figure A: 2G-CVA10 plasmid in vitro transcriptome P4 generation; B: rib-CVA10 plasmid in vitro transcriptome P3 generation CVA10 virus; C: wild CVA10 virus; D: 2G-CVA10 plasmid in vivo transcriptome P4 generation; E: rib-CVA10 plasmid in vivo transcriptome P3 generation CVA10 virus; F: negative control Vero cells; Fig.11 This is a partial sequencing result diagram of RT-PCR products; Fig.12 The results of the CVA10 virus RT-qPCR experiment are shown in Figure A: standard curve made using CVA10 plasmid; B: comparison of genome copy numbers in 1 ml of virus solution; P3RNA and P4RNA in the horizontal axis represent the third and fourth generations of the virus rescued by the T7 in vitro transcribed RNA group, respectively; P3 plasmid and P4 plasmid represent the third and fourth generations of the virus rescued by the T7 in vivo transcribed RNA group, respectively; Fig.13 The western blot analysis results of VP1 protein, A: Western blot results; B: VP1 protein gray value analysis; Res-RNA (sample 1): T7 in vitro transcribed RNA histone; Res-Plasm (sample 2): T7 in vivo transcribed RNA histone; CVA10-WT (sample 3): wild CVA10 virus seed protein (positive control); Vero (sample 4): Vero cell protein (negative control); samples 1-3 are total proteins extracted from virus-infected Vero cells, and sample 4 is Vero cell protein that is not infected with the virus; Fig.14 This is the CO-CVA10 viral plasmid map; Fig.15 Schematic diagram of the experimental scheme for the rescue of CO-CVA10 virus using T7 in vivo transcribed RNA method; Fig.16 This is a partial sequencing result diagram of the CO-CVA10 plasmid; Fig.17 The results of cytopathic effect are shown in the figure below. Left: CO-CVA10 plasmid in vivo transcriptome P2 generation CVA10 virus; Right: negative control Vero cells; Fig.18 Comparison of expression levels of P3 generation CVA10 virus and P3 generation CO-CVA10 virus compared with wild-type virus. DETAILED DESCRIPTION

[0021] The invention provides a recombinant plasmid containing a CVA10 viral genome. The backbone structure of the recombinant plasmid comprises a T7 promoter, a codon-optimized CVA10 viral genome, a polyA tail, a linearization restriction site BglⅡ and a T7 terminator.

[0022] The basic plasmid backbone of the recombinant plasmid of the present invention preferably includes pUC-GW-Kan. The pUC-GW-Kan described in the embodiment is purchased from Suzhou Jinweizhi Biotechnology Co., Ltd. The present invention preferably inserts the entire backbone structure into the BgIII site of the pUC-GW-Kan.

[0023] The present invention preferably constructs two recombinant plasmids, wherein the structure of the recombinant plasmid 2G-CVA10 is preferably as follows: Figure 1 As shown, it includes the following: T7 promoter-CVA10 viral genome-polyA-linear restriction site BglⅡ-T7 terminator connected in sequence; the structure of the recombinant plasmid rib-CVA10 is preferably as follows Figure 1 As shown, it includes T7 promoter-cis hammerhead ribozyme HHrib-CVA10 viral genome-polyA-linear restriction site BglⅡ-T7 terminator connected in sequence. The polyA tail of the present invention is preferably 50A.

[0024] The codon-optimized CVA10 virus genome of each structure in the recombinant plasmid of the present invention preferably includes the most complete viral genome obtained by the third-generation sequencing of the CVA10 virus candidate vaccine strain K6-19 / XY / CHN / 2017 (MT828547.1), including the 5' and 3'UTR sequences not included in MT828547.1. At the same time, the coding sequence (Coding Sequences, CDS) of MT828547.1 was optimized according to the codons and expression characteristics of Vero cells. The 5' and 3'UTR sequences obtained by sequencing and the optimized CDS sequence were assembled to finally obtain a new Vero optimized strain adaptation strain. (The optimized strain is hereinafter referred to as CO-CVA10). The vaccine candidate strain K6-19 / XY / CHN / 2017 is a Vero cell-adapted strain, has high sensitivity to Vero cells, fast proliferation rate, high virus infectivity titer, good immunogenicity and genetic stability, and does not have the problem of CVA10 virus adapting to Vero cells. The rescued virus obtained is more in line with the requirements of the candidate vaccine strain, and has been published in the Chinese Journal of Viral Diseases (Zhang Jie et al. Study on the genetic stability of a Vero cell-adapted Coxsackievirus group A type 10 strain. Chinese Journal of Viral Diseases 3(2019):7.); T7 promoter (SEQ ID No.5: TAATACGACTCACTATAGGG); 50A as the polyA tail, the polyA tail at the 3′ end is crucial to the stability and infectivity of the viral RNA; linearization restriction site BglⅡ (CYCGRG); cis-hammerhead ribozyme HHrib: (SEQ ID No.6: TGTTTTAACTGATGAGGCCGAAAGGCCGAAAACCCGGTATCCCGGGTTC), which can produce viral RNA with a real 5′ end through self-cleavage function, and the infectious RNA produced is consistent with the sequence of the wild strain; T7 terminator (SEQ ID No.7: ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg).

[0025] The recombinant plasmid (CO-CVA10 plasmid) of the present invention is codon-optimized on the wild CVA10 virus genome sequence. The optimized virus (CO-CVA10) is rescued by the method provided by the present invention, and can be rescued from Vero cells and adapted to growth. The obtained virus strain has a higher virus titer than the wild sequence.

[0026] The basic plasmid backbone of the recombinant optimized plasmid of the present invention preferably includes pcDNA3.1. The pcDNA3.1 described in the embodiment is purchased from Suzhou Jinweizhi Biotechnology Co., Ltd. The present invention preferably replaces the 863-977 base pairs of the pcDNA3.1 with the backbone structure as a whole to form the final pcDNA3.1-CO_CVA10 plasmid. The structure of the recombinant plasmid pcDNA3.1-CO_CVA10 is preferably as follows Fig.14 As shown, it includes T7 promoter-cis-hammerhead ribozyme HHrib-optimized CVA10 virus genome-polyA-linear restriction site BglⅡ-T7 terminator connected in sequence.

[0027] The present invention also provides the use of the recombinant plasmid in rescuing the optimized strain CO-CVA10 virus on Vero cells.

[0028] Since the T7 promoter, the linearization restriction site after the A tail and the T7 terminator sequence are added to the recombinant plasmids of the present invention, the recombinant plasmids 2G-CVA10, the recombinant plasmids rib-CVA10 and the CO-CVA10 plasmids can obtain infectious RNA for transfection of Vero cells through in vitro transcription (IVT), and can also rescue the virus by being co-transfected into Vero cells with the T7 RNA polymerase plasmid.

[0029] The present invention also provides a method for rescuing the optimized strain CO-CVA10 virus on Vero cells by in vitro transcription, comprising the following steps: linearizing the above-mentioned recombinant plasmid by enzyme digestion, and then transfecting in vitro to obtain infectious RNA, and transfecting the infectious RNA into Vero cells to rescue the virus, thereby obtaining the rescued optimized strain CO-CVA10 virus.

[0030] When the in vitro transcription method is used for rescue, the in vitro transcription method of the present invention preferably first obtains the infectious RNA of the optimized strain CO-CVA10 by in vitro transcription and then transfects it into Vero cells. The in vitro transcription method of the present invention can directly provide the genetic material required by the virus, thereby realizing the rescue of the virus.

[0031] The present invention also provides an optimized strain CO-CVA10 virus rescued by using the in vitro transcription method.

[0032] In the embodiment of the present invention, it was found that the expression of the viral genome can be completed using the 2G-CVA10 plasmid, whether it is rescued by in vivo transcription method or in vitro transcription method, but the virus assembly cannot be completed, and it was confirmed that the cell culture harvested 7 days after transfection was continuously passaged 3 times, and no cytopathic effect (CPE) appeared, and the transfected culture had no cytopathic effect in the third passage. However, when rib-CVA10 was used for rescue, CAV10 rescued by in vitro transcription or in vivo transcription method showed cytopathic effect in P2 generation, and the pathological rate of cells increased with the increase of passage number. The cytopathic effect (CPE) was initially weak, and an increase in CPE was observed in two passages. In the virus quantification experiment, the virus concentration of the P4 generation in both experimental groups was higher than that of the P3 generation, indicating that the rescued CVA10 virus on Vero cells increases with the increase of passage number, and the infection ability is also gradually increasing.

[0033] The present invention also provides a method for rescuing CVA10 virus on Vero cells by in vivo transcription, comprising the following steps: co-transferring the above-mentioned recombinant plasmid and a plasmid containing T7 RNA polymerase into Vero cells for virus rescue to obtain rescued CVA10 virus.

[0034] When the in vivo transcription method is used for rescue, the present invention utilizes T7 RNA polymerase and CVA10 plasmid co-transfection to allow the viral plasmid to be efficiently transcribed inside the cell using the T7 promoter to produce viral infectious RNA, thereby reducing experimental steps such as RNA in vitro transcription and purification.

[0035] The present invention also provides an optimized strain CO-CVA10 virus rescued by utilizing the in vivo transcription method.

[0036] The present invention also provides the use of the rescued CVA10 virus in preparing an optimized strain CO-CVA10 vaccine.

[0037] The present invention also provides an optimized strain CO-CVA10 virus rescued by utilizing the optimized strain CO-CVA10 plasmid.

[0038] The present invention also provides the use of the optimized strain CO-CVA10 virus in the preparation of CVA10 vaccine.

[0039] To further illustrate the present invention, the plasmid, method and application for rescuing the optimized CVA10 virus in Vero provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] The CVA10 virus strain used in the embodiments of the present invention is the K6-19 / XY / CHN / 2017 strain isolated from RD cells in 2016 and adapted to Vero, and its genome sequence has been submitted to NCBI: MT828547.1, and the strain is deposited in the Ma Shaohui team of the Institute of Medical Biology, Chinese Academy of Medical Sciences.

[0041] The reagents, instruments and methods used in the examples of the present invention are conventional methods in the art unless otherwise specified.

[0042] The names and sources of the reagents involved in the present invention are as follows: DMEM, fetal bovine serum, EasyPure® Viral DNA / RNAKit, PerfectStart® Uni RT&qPCR Kit, and First-Strand cDNA Synthesis SuperMix were purchased from Quanshijin (China); penicillin / streptomycin, glutamine, BS buffer, and 0.25% trypsin were purchased from the Institute of Medical Biology; LB solid / liquid culture medium, cell lysis solution / PMSF / phosphatase inhibitor, and BCA protein concentration determination kit were purchased from Solebao (China); DH5α, DL10000 / DL2000Marker, and restriction endonuclease (BglⅡ / MIUⅠ) were purchased from Takara Bio (Japan); endotoxin-free plasmid extraction kit and Gel Extraction Kit were purchased from Kangwei (China); anhydrous ethanol was purchased from Sinopharm Reagent (China); agarose / nucleic acid dye / TAE solution was purchased from Qingke (China); high-yield T7 RNA in vitro transcription kit RNA was purchased from Biotech / China; Clean&Concentrator™-5 was purchased from ZymoResearch / USA; PAGE precast gel, PVDF membrane / PVDF membrane infiltration activation solution, SDS-PAGE electrophoresis solution, Western transfer solution / TBST / blocking solution, antibody diluent, and ECL color development solution were purchased from Biotech / China; 5× reduced protein loading buffer was purchased from Biosharp / China; protein pre-stained Marker, Lipo2000hermo, and Lipo3000hermo were purchased from Thermo Fisher / USA; 5% skim milk powder was purchased from BD / USA; CVA10-VP1 polyclonal antibody was purchased from Absin / China; HRP-labeled universal secondary antibody (goat source) and GAPDH primary antibody were purchased from Proteintech / China; The names and sources of the instruments involved in the present invention are as follows: biological safety cabinet purchased from Jinjing / China; electric constant temperature incubator purchased from Shanghai Yiheng / China; real-time fluorescence quantitative amplification system CFX96 purchased from Bio-rad / USA; -70℃ low temperature refrigerator and -20℃ low temperature refrigerator purchased from Haier / China; metal bath thermostat purchased from Shanghai Bilang / China; The microplate reader was purchased from TECAN / Austria; the PCR instrument was purchased from Bio-rad / USA; the 3D shaker three-dimensional rotating mixer was purchased from Qun'an Instrument / China; the inverted microscope was purchased from Nikon / Japan; the gel imager was purchased from Bio-rad / USA; the automatic high-pressure sterilizer was purchased from Hitachi / Japan; the EP tube (1.5ml, 2ml) and PCR tube (0.2ml) were purchased from AXYGEN / USA; the pipette was purchased from Dragon / China; the high-speed refrigerated centrifuge was purchased from Beckman Coulter / USA; the vortex mixer was purchased from Scilogex / USA; the constant temperature water bath was purchased from GRANT / UK; the spectrophotometer was purchased from Nanodrop / USA; and the electronic balance was purchased from Sartorius / Germany.

[0043] Example 1 1.1 Virus culture Vero cells (purchased from ATCC, (American Type Culture Collection), USA) were passaged into six-well plates. On the second day, 100 μL of virus solution was seeded in each well and cultured in a 35°C 5% CO2 constant temperature incubator. The cell status was observed every day. After all the cells were diseased, the virus culture medium was frozen and thawed three times. The virus solution was centrifuged at 4°C 1,500×g for 15 min to remove cell debris and stored at -80°C.

[0044] 1.2 CVA10 viral genome sequencing and analysis The viral RNA was extracted, reverse transcribed to obtain cDNA, PCR reaction was performed and gel running was performed for verification. The cDNA was then sent to Beijing Novogene Company for third-generation sequencing and analysis of the results.

[0045] (1) Viral RNA extraction, cDNA synthesis, and PCR ① Extraction of viral RNA (EasyPure®ViralDNA / RNA Kit, Quanshijin, China); ② Synthesis of cDNA: Incubate RNA at 65°C for 5 min, place on ice for 2 min, and then perform reverse transcription according to the instructions of PerfectStart® Uni RT&qPCR Kit.

[0046] ③PCR: The PCR reaction system was prepared according to the instructions of 2×TransStart® FastPfu Fly PCR SuperMix. The primers were VP1-F and VP1-R. The product length was 716 bp. The PCR program was as follows: 98°C for 1 min, 98°C for 10 s, 59°C for 5 s, 72°C for 30 s, 72°C for 1 min, and insulation at 16°C. The PCR products were subjected to agarose gel electrophoresis.

[0047] VP1-F (SEQ ID No. 1): 5'-AGAAACGGGTGCCACTTCTA-3'; VP1-R (SEQ ID No. 2): 5'-CCCGTGCACTGTTGGTAATT-3'.

[0048] The amplification results are as follows Figure 4 As shown, the size of the PCR product fragment was consistent with the expected product (716 bp).

[0049] The first generation sequencing result of CVA10 virus strain K6-19 / XY / CHN / 2017 obtained a sequence length of 7301bp; the third generation sequencing result of the present invention analyzed 7403bp, and some results of the third generation sequencing are as follows Figure 5 As shown. The present invention uses RNAfold to predict RNA secondary structure for the complete 5'UTR sequence and 3'UTR sequence. The stem-loop I cloverleaf structure of the complete 5'UTR ( Figure 6 Middle B); The sequence obtained by previous generation sequencing contained a missing cloverleaf structure ( Figure 6 In addition, the present invention also obtains a complete 3'UTR sequence, and the Z / Y / X stem-loop structure is complete ( Figure 7 Middle B); the previous generation sequencing only obtained the sequence of stem loop Z ( Figure 7 Middle A).

[0050] Example 2 CVA10 plasmid construction (1) Plasmids containing the CVA10 viral genome were designed and constructed by reverse genetics: 2G-CVA10 plasmid and rib-CVA10 plasmid. The vector used was pUC-GW-Kan. The above two plasmids were synthesized by Suzhou Genewise Biotechnology Co., Ltd. The schematic diagram of plasmid design is shown in the figure. Figure 1 shown.

[0051] (2) RNA transfection positive control plasmid: named T7-GFP plasmid, sequence design as follows Figure 2 As shown, the sequence was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and then eGFP (protein ID: WWU03112.1) was cloned into the pUC-GW-Kan vector.

[0052] (3) T7 RNA polymerase plasmid: The nucleotide sequence of the T7 RNA polymerase gene (GeneID: 1261050) was codon-optimized according to the codon preference of African green monkeys, synthesized by Suzhou GeneWeizhi Biotechnology Co., Ltd., and then cloned into the pCAGGS vector (purchased from Suzhou GeneWeizhi Biotechnology Co., Ltd.).

[0053] The partial sequencing results of 2G-CVA10 plasmid and rib-CVA10 plasmid are as follows Figure 8 shown.

[0054] Example 3 Rescue of CVA10 virus Since the CVA10 viral genome is too large, about 7400 bp in size, it is difficult to transfer it into cells. Figure 3 Two experimental schemes are shown for CVA10 virus rescue: (1) T7 in vitro transcribed RNA method: CVA10 plasmid is linearized by restriction digestion and then in vitro transcribed to obtain infectious RNA, which is then transfected into Vero cells for virus rescue; (2) T7 in vivo transcribed RNA method: CVA10 plasmid and T7 RNA polymerase plasmid are co-transfected into Vero cells for virus rescue.

[0055] 3.1 T7 in vitro transcribed RNA group (1) Enzyme digestion: Prepare the reaction solution by adding 2 μL 10 × QuickCut Green Buffer, 1 μg plasmid DNA, 1 μL QuickCut Bgl II (or QuickCut MIuⅠ) and sterile water to a total volume of 20 μL. Mix gently, centrifuge briefly and incubate at 37°C for 5 min.

[0056] (2) Agarose gel electrophoresis: Use 1×TAE to prepare 1% agarose gel. Use a micropipette to add the marker and sample into the sample slot of the gel plate. Add 5μL of marker and adjust the amount of other samples according to the purpose of the experiment. After adding the samples, carefully record the order of adding the samples and immediately start electrophoresis with a voltage of 120 V for 20 minutes. After the electrophoresis is completed, use ultraviolet light to observe the image and take a photo to save. The results are as follows: Fig. 9 shown.

[0057] (3) Gel recovery experiment (DNA purification gel recovery kit, purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0058] (4) RNA in vitro transcription, purification and capping ① RNA in vitro transcription: Vortex and mix all components except Enzyme Mix, centrifuge briefly to collect at the bottom of the tube, and store on ice for later use. Prepare the reaction system, gently mix all components with a pipette, centrifuge briefly to collect, and incubate at 37°C for 3 h.

[0059] 20μL reaction system: 5×Transcription Buffer 4μL, ATP Solution 1.5μL, CTPSolution 1.5μL, GTP Solution 1.5μL, UTP Solution 1.5μL, Enzyme Mix 1.5μL, RNaseInhibitor 0.5μL, Template DNA 8μL.

[0060] ②RNA purification: Unless otherwise specified, perform all steps at room temperature and centrifuge at 13,000×g for 30 seconds. Add 2 volumes of RNA Binding Buffer to each sample and mix. Add an equal volume of anhydrous ethanol as in the previous step and mix. Transfer the sample to the Zymo-Spin™ IC column in a collection tube and centrifuge, discarding the flow-through. Add 400μL RNA Prep Buffer to the column, centrifuge, and discard the flow-through. Add 700μL RNA Wash Buffer to the column, centrifuge, and discard the flow-through. To completely remove the elution buffer, add another 400μL RNA Wash Buffer to the column and centrifuge for 1min. Carefully transfer the column to an RNase-free tube. Add 15μLl RNase-Free Water directly to the center of the column and centrifuge. The eluted RNA can be used immediately or stored frozen.

[0061] ③ RNA capping: Use a one-step capping reaction system, and the reaction conditions are: 37℃ for 1h. The efficiency of this capping reaction is affected by the structure of the 5' end of RNA, so the higher-order structure of the 5' end of RNA must be opened by thermal denaturation (heating at 65℃ for 5 min and placing on ice for 5 min). This capping reaction is only used for capping of the positive control GFP mRNA. The CVA10 virus in vitro transcribed RNA used in the experiment does not need to be capped.

[0062] 20μL one-step capping reaction system: 10×Capping Buffer 2μL, Vaccinia Capping Enzyme (10 U / μL) 1μL, mRNA Cap 2'-O-Methyltransferase (50U / μL) 1μL, GTP (10 mM) 1μL, SAM (4 mM) 1μL, Denatured RNA 10μg, RNase-free ddH2O to 20μL.

[0063] (5) RNA transfection and virus rescue The in vitro transcribed and purified RNA and GFPmRNA (positive control) were transfected into cells using lipo2000 reagent. 2.5 μg RNA was used for transfection in each well of the six-well plate, and the cells were placed in a 37°C, 5% CO2 constant temperature incubator. After 6 hours of transfection, fresh DMEM medium was replaced. Observe the expression of fluorescent protein in the wells transfected with GFPmRNA (positive control) 48 hours after transfection to confirm whether the transfection was successful. The experimental wells were frozen and thawed 3 times 7 days after transfection and the supernatant virus liquid was collected by centrifugation. This is the first generation P1 of the rescued virus. The P1 generation virus was inoculated into a six-well plate and placed in an incubator for culture. The cell pathology was observed. The harvested virus was the P2 generation, and the subsequent virus generations were named by analogy.

[0064] 3.2 T7 in vivo RNA transfection group Use lipo3000 reagent to co-transfect rib-CVA10 plasmid (or 2G-CVA10 plasmid or T7-GFP plasmid) and T7pol plasmid (commissioned by Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis) into Vero cells. Use 2.5μg plasmid per well in a six-well plate for transfection. The molecular quantity ratio of the above two plasmids for transfection is 1:1. Place in a 37℃, 5% CO2 constant temperature incubator for culture. After 6 hours of transfection, replace with fresh DMEM medium. After 48 hours of transfection, observe the expression of fluorescent protein in the wells transfected with T7-GFP plasmid + T7pol plasmid (positive control) to confirm whether the transfection is successful. Subsequent experiments are the same as the treatment method of the experimental wells after transfection in step (5) of 3.1.

[0065] When the 2G-CVA10 plasmid was used for the experiment, no cytopathic effect (CPE) was observed in the cell cultures harvested 7 days after transfection in the T7 in vitro transcribed RNA group and the T7 in vivo transcribed RNA group. Fig.10 A and D).

[0066] When the rib-CVA10 plasmid was used for the experiment, no cytopathic effect was produced when the P1 virus was harvested 7 days after transfection in both the T7 in vitro transcribed RNA group and the T7 in vivo transcribed RNA group. After the P1 virus solution was subcultured for 7 days, cytopathic effect appeared in both experimental groups. The harvested P2 virus was subcultured, and all cells became diseased within 48 hours, and the P3 virus was harvested. The results of cytopathic effect caused by the P3 rescue virus are shown in the figure. Fig.10 As shown in B and E. The cytopathic effect of wild-type CVA10 virus is shown in Fig.10 As shown in C. Fig.10It can be found that the P3 generation rescued viruses obtained by the two experimental groups using rib-CVA10 plasmid for virus rescue showed the same severe cytopathic effect as the wild-type CVA10 virus.

[0067] Example 4 Study on the biological characteristics of rescued viruses 4.1 RT-PCR verification of rescued viruses The viral RNA extraction, cDNA synthesis and PCR process were the same as in Example 1, and the PCR product was sent for first-generation sequencing.

[0068] The Sanger sequencing results of RT-PCR products are as follows Fig.11 As shown, the partial VP1 sequence of CVA10 virus rescued by T7 in vitro transcribed RNA group and T7 in vivo transcribed RNA group was consistent with the wild CVA10 virus sequence.

[0069] 4.2 Quantitative experiment of rescued virus RT-qPCR experiments can quantify viral nucleotides. RNA from the virus solution was extracted for RT-qPCR experiments. The product length was 219 bp and real-time fluorescence quantitative PCR analysis was performed. The real-time PCR program was as follows: 94°C, 30 s, then 94°C, 5 s, 60°C 30 s for 40 cycles. The quantified rib-CVA10 plasmid was diluted in multiples and used as a standard to generate a standard curve. The amount of virus was expressed as copies / ml virus solution.

[0070] Primers used: Forward (SEQ ID No. 3): 5′-CCTCAAACACAACGTACGGG-3′; Reverse (SEQ ID No. 4): 5′- CCCGTGCACTGTTGGTAATT-3′.

[0071] In the experiment, the volume of virus solution used in all experimental groups was 400 μL, the volume of RNA solution dissolved during RNA extraction was 40 μL, 10 μL RNA extraction solution was taken for reverse transcription, and the reverse transcription system was 20 μL. 1.5 μL cDNA was used for each group of qPCR experiments. The final result conversion formula for calculating the RNA copy number in the virus solution is: 133.3×copy number / ml. The standard curve made by using CVA10 plasmid multiple dilution is shown in the figure. Fig.12 As shown in A, the genome copy number in 1 ml of virus solution is as follows Fig.12 As shown in B. The concentrations of P3 and P4 viruses in the T7 in vitro transcribed RNA group and P3 and P4 viruses in the T7 in vivo transcribed RNA group all reached 10 8 copies / ml, although it was lower than that of the wild-type CVA10 virus group (concentration 1010 The P4 virus concentrations of the T7 in vitro transcribed RNA group and the T7 in vivo transcribed RNA group were higher than those of the corresponding P3 virus concentrations. Therefore, with the increase in the number of passages, the number of copies of the viral genome tended to increase.

[0072] 4.3 Rescued virus protein immunoblotting experiment Vero cells were infected with CVA10 virus rescued by T7 in vitro transcribed RNA group and T7 in vivo transcribed RNA group, and wild CVA10 virus, respectively. After cytopathic effects appeared, all proteins in the cell culture medium were directly extracted. At the same time, proteins in Vero cells not infected with CVA10 virus were extracted as negative controls.

[0073] (1) Protein extraction: Wash the cells twice with PBS buffer, leaving a small amount of PBS in the six-well plate. Collect the cells with a cell scraper and centrifuge. Discard the supernatant. Add 100 μL of lysis buffer (PMSF should be added within a few minutes before use) to the cell pellet collected in each well. Mix the lysis buffer and cells with a pipette tip. Place on ice for 10 minutes, centrifuge at 13,000 × g for 5 minutes, and take the supernatant for subsequent experiments. Store the protein samples at -80°C.

[0074] (2) Protein concentration determination: The protein concentration was determined using the microplate reader method.

[0075] ① Dilute the standard: prepare a standard with a concentration of 0.5 mg / mL, take 10 μL of BSA standard and dilute it to 100 μL with PBS buffer, and further dilute the standard according to the instructions.

[0076] ② Dilute the sample appropriately and add 20 μL to a 96-well plate.

[0077] ③Prepare the working solution: According to the number of standards and samples, prepare the BCA working solution at the ratio of BCA reagent: Cu reagent = 50:1 and mix thoroughly.

[0078] ④ Use a spray gun to add 200 μL of BCA working solution to each of the standard wells and experimental wells, and incubate in a 37°C constant temperature incubator for 30 minutes. Use an ELISA reader to measure A562nm as soon as possible, organize the data and make a standard curve, and finally determine the actual concentration of the protein.

[0079] (3) Western blotting experiment: ① Denaturation: Preheat a metal bath at 100℃, take 120μL of protein from each experimental group, melt on ice, oscillate to mix, heat at 100℃ in a metal bath for 10min, return to room temperature and oscillate to mix.

[0080] ② Electrophoresis: Use BeyoGelTM Plus Page precast gel for electrophoresis, add 6μL marker with an extended gun tip, and add an equal amount (10μg) of protein sample into the gel well. The electrophoresis voltage is 150V, and the electrophoresis time is determined according to the position of the marker during electrophoresis.

[0081] ③ Transfer: prepare new transfer solution, activate the PVDF membrane, and install the transfer clip according to the sequence of negative electrode - sponge pad - double-layer filter paper - gel - transfer membrane - double-layer filter paper - sponge pad - positive electrode. Set the transfer current and time to 300mA, 40min.

[0082] ④ Blocking: Place the transfer membrane in a TBST membrane washing box and wash for 10 minutes. Block with QuickBlockTM blocking solution at room temperature for 1 hour. Wash the membrane twice with TBST, 10 minutes each time.

[0083] ⑤ Primary antibody incubation: Use antibody diluent to prepare 15 ml CVA10 VP1 primary antibody at a dilution ratio of 1:1000 (or GAPDH primary antibody at a dilution ratio of 1:2000), incubate the transfer membrane in the primary antibody diluent, and place in a 4°C refrigerator overnight (15-17 hours). Wash the membrane three times with TBST, 10 minutes each time.

[0084] ⑥ Secondary antibody incubation: Use antibody diluent to prepare 15ml HRP-labeled universal secondary antibody, dilute at a ratio of 1:4000, place the transfer membrane in HRP-labeled universal secondary antibody diluent, and incubate at room temperature for 1h. Wash the membrane three times with TBST, 10min each time.

[0085] ⑦ Development: Prepare ECL Plus ultra-sensitive luminescent solution (1 ml each of solution A and solution B), incubate for 1 minute, collect images on the imager and record the results.

[0086] Western blot experiments were performed using VP1 polyclonal antibodies. The rescued viruses in both experimental groups expressed VP1 protein, and the size of VP1 protein was consistent with that of the wild-type CVA10 virus. Fig.13 As shown in A. The protein gray value analysis results show ( Fig.13 (B) The VP1 protein expression of the rescued virus was lower than that of the wild-type CVA10 virus, and the VP1 protein expression of the T7 in vitro transcribed RNA group was higher than that of the T7 in vivo transcribed RNA group.

[0087] Example 5 Design and construction of CO-CVA10 plasmid The CVA10 virus protein coding region was optimized, and synonymous codons corresponding to high-abundance tRNA were selected to indicate protein translation efficiency. By comparing the Vero cell gene expression data set, the highly expressed gene set was inferred by programming, and three optimization algorithms, CAI (Codon Adaption Index), ICU (Individual Codon Usage), and CC (Codoncontext) were used for calculation, and the most suitable gene sequence was selected and verified. After experimental verification, the ICU algorithm was selected, and GSE93555 was used as the input data set to optimize other sequences. The final plasmid design schematic is shown below. Fig.14 shown.

[0088] Example 6 Rescue of CO-CVA10 virus CO-CVA10 plasmid (or T7-GFP plasmid) and T7pol plasmid (commissioned by Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis) were co-transfected into Vero cells using lipo3000 reagent. 2.5 μg of plasmid was used for transfection in each well of a six-well plate. The molecular ratio of the two plasmids used for transfection was 1:1. The cells were cultured in a 37°C, 5% CO2 constant temperature incubator. After 6 hours of transfection, fresh DMEM medium was replaced. After 48 hours of transfection, the expression of fluorescent protein in the wells transfected with T7-GFP plasmid + T7pol plasmid (positive control) was observed to confirm whether the transfection was successful. Subsequent experiments were the same as the treatment method of the experimental wells after transfection in step (5) of 3.1.

[0089] When using the CO-CVA10 plasmid for the experiment, in the T7 in vivo transcribed RNA group, when the P1 virus was harvested 7 days after transfection, no cytopathic effect was produced. After the P1 virus solution was passaged for 4 days, the experimental group showed cytopathic effect. The harvested P2 virus was passaged, and all cells became diseased within 48 hours, and the P3 virus was harvested. The results of the cytopathic effect caused by the P2 rescue virus are shown in Fig.17 Middle left picture. The control group was empty load and no pathological effect was observed. Fig.17 Shown right.

[0090] Example 7 Comparison of copy numbers of rescued and optimized viruses RT-qPCR experiments can quantify viral nucleotides. RNA from the virus solution was extracted for RT-qPCR experiments. The product length was 219 bp and real-time fluorescence quantitative PCR analysis was performed. The real-time PCR program was as follows: 94°C, 30 s, then 94°C, 5 s, 60°C 30 s for 40 cycles.

[0091] Primers used: rib-CVA10 virus: SEQ ID No. 3 and SEQ ID No. 4; CO-CVA10 virus: Forward (SEQ ID No. 8): 5′-GTAGGTTGATTGAAGCATCT-3′; Reverse (SEQ ID No. 9): 5′-ATAGCCACTGTAGTCGAAA-3′.

[0092] In the experiment, the volume of virus solution used in all experimental groups was 400 μL, the volume of RNA solution dissolved during RNA extraction was 40 μL, 10 μL RNA extraction solution was taken for reverse transcription, and the reverse transcription system was 20 μL. 1.5 μL cDNA was used in each group for qPCR experiments. Fig.18 As shown, the expression level of the P3 generation CO-CVA10 virus is significantly higher than that of the P3 generation CVA10 virus. Therefore, it can be concluded that the optimized strain has a higher virus titer than the CVA10 virus.

[0093] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant plasmid containing a CVA10 viral genome, characterized in that: The skeleton structure of the recombinant plasmid includes a T7 promoter, a codon-optimized CVA10 viral genome, a polyA tail, a linearized restriction site BglⅡ and a T7 terminator.

2. The recombinant plasmid according to claim 1, characterized in that: The codon-optimized CVA10 virus genome includes a genome optimized according to the codons and expression characteristics of Vero cells, using the most complete viral genome obtained after third-generation sequencing of the CVA10 virus candidate vaccine strain K6-19 / XY / CHN / 2017 as a template.

3. The recombinant plasmid according to claim 1 or 2, characterized in that: The basic plasmid skeleton of the recombinant plasmid includes pUC-GW-Kan or pcDNA3.

1.

4. Use of the recombinant plasmid according to any one of claims 1 to 3 to rescue the optimized strain CO-CVA10 virus on Vero cells.

5. The use according to claim 4, characterized in that: The method comprises rescuing the optimized strain CO-CVA10 virus on the Vero cells by using an in vitro transcription method or an in vivo transcription method.

6. A method for rescuing optimized strain CO-CVA10 virus in Vero cells using in vitro transcription, characterized in that: The method comprises the following steps: linearizing the recombinant plasmid according to any one of claims 1 to 3 by enzyme digestion, and then performing in vitro transcription to obtain infectious RNA; transfecting the infectious RNA into Vero cells to perform virus rescue, and obtaining the rescued optimized strain CO-CVA10 virus.

7. The optimized strain CO-CVA10 virus is rescued by the method of claim 6.

8. A method for rescuing optimized strain CO-CVA10 virus in Vero cells using in vivo transcription, characterized in that: The method comprises the following steps: co-transforming the recombinant plasmid described in any one of claims 1 to 3 and a plasmid containing T7 RNA polymerase into Vero cells for virus rescue to obtain a rescued optimized strain CO-CVA10 virus.

9. The optimized strain CO-CVA10 virus is rescued by the method of claim 8.

10. Use of the optimized strain CO-CVA10 virus according to claim 7 or claim 9 in the preparation of CO-CVA10 vaccine.

Images