Recombinant porcine circovirus type 3 CAP gene segment and application thereof in double-antigen sandwich ELISA antibody detection

Abstract

The invention discloses a recombinant porcine circovirus type 3 CAP gene segment and application thereof in double-antigen sandwich ELISA antibody detection. The nucleotide sequence of the recombinant porcine circovirus type 3 CAP gene segment is as shown in SEQ ID NO.1. The recombinant porcine circovirus type 3 CAP gene segment has a nucleotide sequence as shown in SEQ ID NO.2. The recombinant porcine circovirus type 3 CAP gene segment has a nucleotide sequence as shown in SEQ ID NO.1. After the recombinant porcine circovirus type 3 CAP gene segment is used for preparing a recombinant porcine circovirus type 3 detection antigen, when the recombinant porcine circovirus type 3 CAP gene segment is used for porcine circovirus type 3 double-antigen sandwich ELISA antibody detection, the recombinant porcine circovirus type 3 detection antigen is not limited by species and antibody subtypes, a specific secondary antibody is not needed, and PCV3 antibodies in different animal species can be detected. The detection method shows relatively good specificity, sensitivity, repeatability and reproducibility, and is relatively wide in applicability.

Description

Technical Field

[0001] The invention relates to a recombinant porcine circovirus type 3 CAP gene fragment and application thereof in double-antigen sandwich ELISA antibody detection, belonging to the field of virus antibody detection. Background Art

[0002] Porcine circovirus type 3 (PCV3) is a new member of the Circoviridae family. After infection, it can cause a variety of clinical symptoms in pigs, including dermatitis and nephropathy syndrome, reproductive disorders in sows, congenital tremor in piglets, multi-system inflammation, etc., posing a serious health threat to the pig industry. The genome consists of 2000 nucleotides and encodes three main open reading frames (ORFs). Among them, the capsid protein (Cap) encoded by ORF1 is the main component of the virus particle and plays a decisive role in the antigenicity of the virus. PCV3 not only infects pigs, but also cattle, dogs, mice and other animals, showing the potential for cross-species transmission. This cross-species transmission characteristic makes the monitoring and prevention of PCV3 more complicated.

[0003] In serological studies, enzyme-linked immunosorbent assay (ELISA) is widely used due to its simplicity, cost-effectiveness and ease of use. Currently, the detection of PCV3 antibodies mainly relies on the indirect ELISA method, which usually uses Cap as the coating antigen. However, the existing detection methods are often limited by the species specificity of the secondary antibody and are not suitable for antibody detection in samples of multiple species.

[0004] There is an urgent need to develop a new, highly sensitive and specific multi-species PCV3 antibody detection method, which is of great significance for the serological monitoring of PCV3. Summary of the invention

[0005] Purpose of the invention: The first purpose of the present invention is to provide a recombinant porcine circovirus type 3 CAP gene fragment and a recombinant vector containing the fragment, and the use thereof in preparing a recombinant porcine circovirus type 3 detection antigen. The second purpose of the present invention is to provide a porcine circovirus type 3 double antigen sandwich ELISA antibody detection method and a kit for detection.

[0006] Technical solution: The present invention provides a recombinant porcine circovirus type 3 CAP gene fragment, the nucleotide sequence of the recombinant porcine circovirus type 3 CAP gene fragment is shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant vector containing the recombinant porcine circovirus type 3 CAP gene fragment.

[0008] The present invention also provides the use of the recombinant porcine circovirus type 3 CAP gene fragment and the recombinant vector in preparing a recombinant porcine circovirus type 3 detection antigen.

[0009] The present invention also provides a porcine circovirus type 3 double antigen sandwich ELISA antibody detection method, comprising the following steps:

[0010] (1) synthesizing a recombinant porcine circovirus type 3 CAP gene fragment with a nucleotide sequence as shown in SEQ ID NO.1, ligating it into a basic vector, expressing it in Escherichia coli and purifying it to obtain a recombinant PCV3-Cap protein;

[0011] (2) Labeling the recombinant PCV3-Cap protein with horseradish peroxidase to obtain an enzyme-labeled antigen;

[0012] (3) diluting the recombinant PCV3-Cap protein and coating it on an ELISA plate;

[0013] (4) washing and blocking the coated ELISA plate to obtain a blocked ELISA plate;

[0014] (5) adding the diluted serum sample to be tested to the blocked ELISA plate for incubation and washing, and then adding the diluted enzyme-labeled antigen for incubation and washing;

[0015] (6) Add a color developing solution to the ELISA plate for color development in the dark, then add a stop solution, and read the data using an ELISA reader at an absorbance of 450 nm.

[0016] Furthermore, the basic vector in step (1) is pET-28a.

[0017] Furthermore, in step (3), the concentration of the recombinant PCV3-Cap protein after dilution is 50 to 300 ng / well.

[0018] Furthermore, in step (5), the dilution ratio of the serum sample to be tested is 1:8-10.

[0019] Furthermore, the dilution ratio of the enzyme-labeled antigen in step (5) is 1:10,000 to 40,000.

[0020] Furthermore, the species of origin of the serum samples to be detected include pigs and cattle.

[0021] The present invention also provides a porcine circovirus type 3 double antigen sandwich ELISA detection kit, the kit comprising an enzyme labeling plate coated with a recombinant PCV3-Cap protein, an enzyme labeling reagent, a positive control, PBST and PBS, the positive control being OD 450 The pig serum sample with nm being 1; the coding gene sequence of the recombinant PCV3-Cap protein is shown in SEQ ID NO.1.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: after the recombinant porcine circovirus type 3 CAP gene fragment of the present invention is used to prepare the recombinant porcine circovirus type 3 detection antigen, it is not restricted by species and antibody subtypes when used for porcine circovirus type 3 double antigen sandwich ELISA antibody detection, and does not require specific secondary antibodies, and can detect PCV3 antibodies in different animal species. The detection method shows good specificity, sensitivity, repeatability and reproducibility, and has wider applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 SDS-PAGE verification of universal Cap protein expression; M: protein marker; 1: universal Cap protein supernatant before passing through the column; 2: universal Cap protein supernatant after passing through the column; 3: washing solution of universal Cap protein supernatant; 4: eluted and purified universal Cap protein-1; 5: eluted and purified universal Cap protein-2; 6: eluted and purified universal Cap protein-3;

[0024] Figure 2 SDS-PAGE verification of porcine Cap protein expression; M: protein marker; 1: supernatant of porcine Cap protein before passing through the column; 2: supernatant of porcine Cap protein after passing through the column; 3: washing liquid of supernatant of porcine Cap protein; 4: eluted and purified porcine Cap protein-1; 5: eluted and purified porcine Cap protein-2; 6: eluted and purified porcine Cap protein-3. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0026] Example 1: Prokaryotic expression of recombinant Cap protein

[0027] 1. Expression of Cap protein:

[0028] The present invention compares and analyzes the PCV3 gene sequences infecting different species of animals published on NCBI (swine source GenBank: KX778720.1, cattle source GenBank: MH107164.1, dog source GenBank: MH916637.1 and mouse source GenBank: MK746104.1), and designs a universal PCV3-Cap sequence (642 bp). The sequence is optimized for the preference of Escherichia coli to obtain a universal PCV3-Cap sequence, and is connected to a pET-28a vector to construct a recombinant expression plasmid universal pET28a-Cap (the sequence is synthesized and the recombinant vector is constructed by Shanghai Sangon Biotechnology Co., Ltd.). The base sequence of the universal PCV3-Cap sequence is shown in SEQ ID NO.1 (atgcgtcaccgagctatatttaggcggagaccacgtcc).The porcine PCV3-Cap sequence used as a control is shown in SEQ ID NO.2 (atgagacacagagctatattcagaagaagaccccgcccacggag), which was also synthesized by Shanghai Sangon Biotechnology Co., Ltd. and connected into the pET-28a vector to construct the porcine recombinant expression plasmid porcine pET28a-Cap.

[0029] The two recombinant expression plasmids pET28a-Cap were transformed into competent cells of the expression bacteria E.coli BL21 (DE3), and the recombinant transformants were selected by kanamycin resistance. Single colonies were first picked and activated overnight in LB medium, and then transferred to fresh LB medium containing 50 mg / mL kanamycin at a ratio of 1:1,000. When the OD600 was about 0.4-0.6, IPTG with a final concentration of 1mM was added to induce expression, and the culture was shaken at 220rpm and 37℃ for 4-5h. The cells were collected by centrifugation at 3,000rpm at 4℃ for 5min, resuspended in PBS, ultrasonically broken, and centrifuged at 12,000rpm at 4℃ for 15min. The supernatant and precipitate were collected, and the protein expression was identified by SDS-PAGE. The expression position of the induced protein was subsequently identified, and the target protein was expressed in the supernatant by SDS-PAGE.

[0030] 2. Purification of Cap protein:

[0031] 1. Transfer the bacterial solution before IPTG induction of the target protein to a conical flask containing 400mL kanamycin-resistant LB at a ratio of 1:50. After induction, centrifuge at 8,000rpm for 10min, discard the supernatant, wash twice with PBS, centrifuge at 5,000rpm for 10min, discard the supernatant, and store the cells in separate tubes at -80℃.

[0032] 2. Add 8-10 mL of supernatant LE buffer to the bacteria expressing soluble Cap protein (400 mL of bacterial solution) and resuspend them in 2 tubes. Ultrasonicate (power 200 W, ultrasonicate for 2 seconds, rest for 4 seconds, ultrasonicate for 30-40 minutes per tube). Centrifuge the ultrasonicated bacterial solution at 12,000 rpm for 25 minutes and take the supernatant for column purification.

[0033] 3. Pipette 1ml of medium into the column, add 8-20mL LE buffer to balance the column, put the supernatant into the balanced column, shake at 4℃ for 30min, then drop the supernatant at a speed of 6s / drop, and repeat the column 3 times. The above is the purification of protein under non-deformation conditions using the nickel column purification kit of Nanjing GenScript Biotechnology Co., Ltd.

[0034] 4. Rinse the column with approximately 40 mL of washing solution at a drip rate of 4 seconds per drop.

[0035] 5. Add 1-2 mL of eluent to the column, bind at 4°C for 20-30 min, and drop at a rate of 6 s / drop. Collect the eluent and add 1-2 mL of eluent to the column again. Elute three times in total to obtain the purified target protein.

[0036] 6. Protein concentration determination Protein quantification was performed using a BCA protein concentration determination kit (Thermo, 23227). The concentration of the universal PCV3-Cap recombinant protein was 1.07 mg / mL, and the concentration of the porcine PCV3-Cap recombinant protein was 1.3 mg / mL. The protein was purified as follows: Figure 1 and Figure 2 shown.

[0037] Example 2: Preparation of enzyme-labeled antigen:

[0038] The enzyme-labeled antigen of HRP-coupled Cap was prepared using a commercial kit (Biolon, BF06095). After labeling, the enzyme-labeled efficiency was calculated, and the best enzyme-labeled antigen was screened based on the enzyme-labeled efficiency.

[0039] Calculation steps of enzyme labeling efficiency:

[0040] 1. Dilute the enzyme-labeled antigen: 360μL PBS + 40μL enzyme-labeled antigen;

[0041] 2. Add 100 μL of enzyme-labeled antigen diluent to the cuvette and use a UV spectrophotometer to measure the A405 and A280 wavelengths; the A405 / A280 ratio is the enzyme labeling efficiency, as shown in Table 1;

[0042] Table 1: Efficiency verification of PCV3-Cap protein conjugated to HRP label

[0043]

[0044]

[0045] Example 3: Establishment and optimization of ELISA conditions

[0046] (1) Establishment of the DAgS-ELISA process, specifically:

[0047] 1. PCV3 Cap recombinant protein was serially diluted to 50, 75, 100, 150, 200 and 300 ng / well (diluent was carbonate buffer at pH = 9.6), HRP-Cap was diluted to 1:10,000, 1:20,000 and 1:40,000 (diluent was PBST at pH = 7.2), serum samples were diluted to 1:10 (diluent was PBS at pH = 7.2), and two PCV3 antibody-positive pig sera (screened by commercial kit (BIOSTONE, 10086-05)) and two PCV3 antibody-negative pig sera (sera of piglets that did not eat colostrum and tested by commercial kit (BIOSTONE, 10086-05)) were screened by the checkerboard method.

[0048] 2. Coat the ELISA plate with carbonate coating buffer containing PCV3 Cap recombinant protein at a volume of 100 μL / well and incubate at 4°C for 24 h. The coating buffer contains 1× carbonate buffer (20× carbonate buffer ratio: 29 g NaHCO 3 +16g NaCO 3 , dilute to 1L, filter after fully dissolving);

[0049] 3. Wash the plate once with PBST (PBS buffer containing 0.05% Tween-20) at a volume of 300 μL / well, then add 150 μL 2.5% BSA to each well and block at 4°C for 24 h.

[0050] 4. Incubate the diluted serum samples at 37°C for 30 minutes. After washing with PBST five times, add the diluted HRP-Cap and incubate at 37°C for 30 minutes. After washing with PBST five times, add 100 μL TMB to each well to start the color development reaction.

[0051] 5. Add 50 μL 2M HO to each well. 2 SO 4 Stop solution, stop the reaction at 37℃ for 15min, and measure OD 450 The absorbance value at nm was used to calculate the absorbance value of the positive sample / the absorbance value of the negative sample (P / N value), and the optimal antigen coating amount and the optimal HRP-Cap dilution ratio were selected based on the principle that the maximum P / N value means the best conditions.

[0052] 6. According to the results shown in Table 2, the coating amount of universal Cap protein was set to 200 ng / well, and the optimal dilution ratio of the enzyme-labeled antigen for universal Cap was set to 1:20,000.

[0053] 7. According to the results shown in Table 3, the coating amount of porcine Cap protein was set to 200 ng / well, and the optimal dilution ratio of enzyme-labeled antigen for enzyme-labeled porcine Cap was set to 1:20,000.

[0054] Table 2: Checkerboard method to screen the best universal Cap antigen coating amount and universal Cap enzyme-labeled antigen dilution

[0055]

[0056]

[0057] Table 3: Checkerboard method to screen the optimal coating amount of porcine Cap antigen and the dilution of porcine Cap enzyme-labeled antigen

[0058]

[0059] The present invention uses 200 ng / well universal Cap protein coating, the serum sample dilution is set to 1:10, the enzyme labeling reagent dilution is 1:20,000, the optimal sample reaction time and the enzyme labeling reagent reaction time are both 30 minutes, and the optimal TMB color development time is 15 minutes.

[0060] The optimized ELISA conditions are:

[0061] 1. Coating: PCV3 Cap recombinant protein was used as the coating antigen, with a coating amount of 200 ng / well; coating was carried out in carbonate coating buffer at 4°C for 24 hours;

[0062] 2. Washing: Wash once with phosphate buffered saline (PBST) at pH 7.2 containing 0.05% Tween-20 by volume, shake gently for 1 min and then discard;

[0063] 3. Blocking: Block with PBST buffer (pH 7.2) containing 2.5% BSA at 4°C for 24 h;

[0064] 4. Serum action conditions: Add the serum dilution mixture to be tested (serum: PBS = 1:10) to each well, incubate at 37°C for 30 minutes, spin dry, and wash 5 times with PBST;

[0065] 5. Enzyme-labeled antigen reaction conditions: dilute HRP-Cap at 1:20,000 with PBST at pH 7.2, add 100 μL to each well, react at 37°C for 30 minutes, spin dry, and wash 5 times with PBST;

[0066] 6. Substrate color development: TMB substrate color development solution 100 μL / well, color development at 37°C in the dark for 15 minutes;

[0067] 7. Stop the reaction: add 50 μL 2M H 2 SO 4 The color development reaction was terminated with the stop solution; the data were read using an enzyme-labeled instrument at an absorbance of 450 nm.

[0068] (2) Determination of the critical value of the universal Cap as the coating source

[0069] The porcine serum and bovine serum used in this example were provided by the Comprehensive Prevention and Control Team of Emerging and Major Animal Diseases, College of Veterinary Medicine, Yangzhou University.

[0070] Determination of the critical value of pig serum: 140 PCV3 antibody positive serum samples and 140 negative serum samples of pigs stored in the laboratory were tested using the optimized ELISA conditions mentioned above, and the ROC curve was drawn. The Youden index (sensitivity + specificity - 1) was calculated to obtain the optimal cut-off value of pig serum with universal PCV3 Cap recombinant protein as the coating antigen, which was 0.5375. When OD 450 It was judged as positive when it was above 0.5375. According to ROC curve analysis, the diagnostic sensitivity of this method was 100% and the diagnostic specificity was 98.57%;

[0071] Determination of the critical value of bovine serum: 221 PCV3 antibody negative serum samples of cattle stored in the laboratory were used according to the formula: OD of negative samples 450 The cut-off value of bovine serum with universal PCV3 Cap recombinant protein as coating antigen was calculated as 0.058 based on the mean value + 3 × standard deviation.

[0072] (3) Determination of the critical value of porcine Cap as coating source

[0073] Determination of the critical value of porcine serum: The method is the same as above. The cut-off value of porcine serum with porcine PCV3 Cap recombinant protein as the coating antigen is 0.485. According to the ROC curve analysis, the diagnostic sensitivity of this method is 100% and the diagnostic specificity is 98.36% at this time.

[0074] Determination of the critical value of bovine serum: The cut-off value of bovine serum with porcine PCV3 Cap recombinant protein as coating antigen is 0.049.

[0075] Example 4: Evaluation of DAgS-ELISA conditions

[0076] (1) Comparison with the commercial kit (BIOSTONE, 10086-05):

[0077] 100 clinical pig sera in 2023 (provided by the Comprehensive Prevention and Control Team of Emerging and Major Animal Diseases, School of Veterinary Medicine, Yangzhou University) were simultaneously tested using the method (universal Cap) established in Example 3 (1) and a commercial kit (blocking method). The PCV3 antibody positivity rate of the samples detected by this method was 68%, while that of the commercial kit was 62%. The PCV3 antibody positivity rate was 6% higher than that of the commercial kit, and the positive coincidence rate of the two was 91.1%. The PCV3 antibody negative rate of the samples detected by this method was 32%, while that of the commercial kit was 38%. The PCV3 antibody negative coincidence rate of the two was 84.2%, and the total coincidence rate of the two was 90%, demonstrating that the method has high sensitivity and specificity, as shown in Table 4.

[0078] Table 4: Comparison of DAgS-ELISA and commercial kits

[0079]

[0080] (2) Analysis sensitivity

[0081] The method (Universal Cap) established in Example 3 (1) and a commercial kit (BIOSTONE, 10086-05) were used to detect two serially diluted PCV3 antibody-positive pig sera, No. 001 (weak positive) and No. 002 (moderate positive). As shown in Table 5, the detection limits of the established double antigen sandwich method and the commercial kit were consistent. According to the cut-off value greater than 0.5375, it was considered positive. The detection limit of serum No. 001 was 16 times diluted and the detection limit of serum No. 002 was 81 times diluted.

[0082] Table 5: Comparison of detection limits

[0083]

[0084] (3) Analytical specificity

[0085] Using the method established in Example 3 (1) (Universal Cap), the antibody-positive sera for common swine diseases (PCV2 / PCV3 / PCV4 / PRRSV / ASFV / PEDV / CSFV / PCV3-) and the antibody-positive sera for common cattle diseases (FMDV-A / FMDV-O) were detected. The sera were provided by the Comprehensive Prevention and Control Team of Emerging and Major Animal Diseases of the School of Veterinary Medicine of Yangzhou University. As shown by the results, the established method has good specificity and no cross-reaction occurs with antibody-positive sera of other pathogens.

[0086] (4) Repeatability and reproducibility verification

[0087] To evaluate the accuracy of DAgS-ELISA for detecting PCV3 antibodies, we evaluated its repeatability within one experiment (within-plate repeat) and reproducibility in different experiments (between-batch repeat). For repeatability evaluation, in one experiment, two pig sera representing moderate and weak positive reactions were tested eight times on a single ELISA plate; in different experiments, each serum was tested eight times on three ELISA plates (ELISA plates from the same batch produced by Xiamen Yijiamei Laboratory Equipment Co., Ltd.). The OD value of each serum was calculated by 450 The standard deviation (SD) of the nm values ​​divided by the mean The coefficient of variation (CV) was calculated to quantify the accuracy. As shown in Table 6, the method had good intra-plate and inter-batch repeatability, with the intra-plate coefficient of variation being less than 10% and the inter-batch coefficient of variation being less than 15%.

[0088] Table 6: DAgS-ELISA intra-plate and inter-batch reproducibility verification

[0089]

[0090] (5) Thermal stability study

[0091] The kit of the present invention comprises: core components: antigen coated plate, enzyme labeled reagent and positive control; other components: 20X PBST (washing liquid), 1X PBS (serum diluent); positive control: OD 450 Pig serum sample with nm of 1.0.

[0092] The kit of the present invention was placed in a 37°C oven for thermal destruction for 7 days. Compared with the kit stored at 4°C, the thermal stability of the antigen-coated plate, the enzyme-labeled reagent and the positive control (PC) reagent were all higher than 90%, and the thermal stability of this method was good.

[0093] Example 5: Establishment of the application of ELISA method

[0094] (1) PCV3 serological survey in pig herds

[0095] The method established using the universal Cap protein of the present invention as the coating source was used to detect 1424 clinical pig sera from 13 cities in Jiangsu Province in 2024, of which 850 were positive sera and the antibody positivity rate was 59.7%, as shown in Table 7;

[0096] The method established using porcine Cap protein as the coating source was used to detect 1424 clinical pig sera from 13 cities in Jiangsu Province in 2024, of which 838 were positive sera and the antibody positivity rate was 58.8%, as shown in Table 8;

[0097] Table 7: Summary and analysis of the PCV3 antibody positive rate of pigs in various cities in Jiangsu Province in 2024 detected by the method established by the invention

[0098]

[0099] Table 8: Summary and analysis of the PCV3 antibody positivity rate of pigs in various cities in Jiangsu Province in 2024 using ELISA developed with porcine Cap protein as the coating source

[0100]

[0101] (2) PCV3 serological survey of cattle

[0102] Using the method established by the present invention, 1523 clinical bovine sera collected from 7 provinces including Beijing, Anhui, Heilongjiang, Inner Mongolia, Shaanxi, Jiangsu and Henan from 2014 to 2024 were detected, of which 118 sera were positive for PCV3 antibodies, and the antibody positive rate was 8.4%, as shown in Table 9;

[0103] The method established using porcine Cap protein as the coating source was used to detect 1523 clinical bovine sera collected from 7 provinces including Beijing, Anhui, Heilongjiang, Inner Mongolia, Shaanxi, Jiangsu and Henan from 2014 to 2024, of which 108 sera were positive for PCV3 antibodies, with an antibody positivity rate of 7.1%, as shown in Table 10;

[0104] Table 9: Summary and analysis of the PCV3 antibody positive rate in cattle herds in different provinces from 2014 to 2024 detected by the method established by the invention

[0105]

[0106]

[0107] Table 10: Summary and analysis of the PCV3 antibody positive rate of cattle herds in different provinces from 2014 to 2024 using ELISA established with porcine Cap protein as the coating source

[0108]

[0109] Since there is currently a lack of national standard detection methods for PCV3 antibodies, there is a certain correlation between PCV3 nucleic acid positivity and antibody positivity. Therefore, in order to eliminate the possibility of false positives in the test results, this study conducted PCV3 nucleic acid tests on clinical pig serum and bovine serum samples that were antibody-positive by universal Cap protein-coated ELISA and antibody-negative by porcine Cap protein-coated ELISA. The test results showed that among the 38 pig serum samples with inconsistent antibody test results, 33 samples had positive nucleic acid test results, and the nucleic acid positivity rate reached 86.8%. In addition, among the 10 bovine serum samples with inconsistent antibody test results, 9 samples had positive nucleic acid test results, and the nucleic acid positivity rate reached 90%. The total positive rate of the two was 87.5. These results are detailed in Table 11.

[0110] Table 11: PCV3 nucleic acid test results summary

[0111]

[0112] The above data show that the method of the present invention, compared with the method using porcine Cap protein as the coating source, increases the positive rate of porcine serum by 0.9% and the positive rate of bovine serum by 1.3%, and has a higher accuracy.

Claims

1. A recombinant porcine circovirus type 3 CAP gene fragment, characterized in that: The nucleotide sequence of the recombinant porcine circovirus type 3 CAP gene fragment is shown in SEQ ID NO.

1.

2. A recombinant vector containing the recombinant porcine circovirus type 3 CAP gene fragment according to claim 1.

3. Use of the recombinant porcine circovirus type 3 CAP gene fragment according to claim 1 and the recombinant vector according to claim 2 in the preparation of recombinant porcine circovirus type 3 detection antigen.

4. A porcine circovirus type 3 double antigen sandwich ELISA antibody detection method, characterized in that: The following steps are involved: (1) synthesizing a recombinant porcine circovirus type 3 CAP gene fragment with a nucleotide sequence as shown in SEQ ID NO.1, ligating it into a basic vector, expressing it in Escherichia coli and purifying it to obtain a recombinant PCV3-Cap protein; (2) Labeling the recombinant PCV3-Cap protein with horseradish peroxidase to obtain an enzyme-labeled antigen; (3) diluting the recombinant PCV3-Cap protein and coating it on an ELISA plate; (4) washing and blocking the coated ELISA plate to obtain a blocked ELISA plate; (5) adding the diluted serum sample to be tested to the blocked ELISA plate for incubation and washing, and then adding the diluted enzyme-labeled antigen for incubation and washing; (6) Add a color developing solution to the ELISA plate for color development in the dark, then add a stop solution, and read the data using an ELISA reader at an absorbance of 450 nm.

5. The porcine circovirus type 3 double antigen sandwich ELISA antibody detection method according to claim 4, characterized in that: The basic vector in step (1) is pET-28a.

6. The porcine circovirus type 3 double antigen sandwich ELISA antibody detection method according to claim 4, characterized in that: The concentration of the recombinant PCV3-Cap protein after dilution in step (3) is 50 to 300 ng / well.

7. The porcine circovirus type 3 double antigen sandwich ELISA antibody detection method according to claim 4, characterized in that: The dilution ratio of the serum sample to be tested in step (5) is 1:8-10.

8. The porcine circovirus type 3 double antigen sandwich ELISA antibody detection method according to claim 4, characterized in that: The dilution ratio of the enzyme-labeled antigen in step (5) is 1:10,000 to 40,000.

9. The porcine circovirus type 3 double antigen sandwich ELISA antibody detection method according to claim 4, characterized in that: The species from which the serum samples to be tested come include pigs and cattle.

10. A porcine circovirus type 3 double antigen sandwich ELISA detection kit, characterized in that: The kit includes an enzyme labeling plate coated with recombinant PCV3-Cap protein, an enzyme labeling reagent, a positive control, PBST and PBS, wherein the positive control is OD 450 The pig serum sample with nm being 1; the coding gene sequence of the recombinant PCV3-Cap protein is shown in SEQ ID NO.1.

Images