Construction method and application of METTL14 gene knockout radiotherapy-resistant lung cancer cell line

Abstract

The invention relates to the technical field of molecular biological cell culture, in particular to a construction method and application of a radiotherapy resistant lung cancer cell line with METTL14 gene knocked out. The method comprises the following steps: constructing a human lung cancer radiotherapy resistant cell strain; determination of a METTL14 gene knockout target site and design of gRNA (guide Ribonucleic Acid); according to the designed gRNA, the METTL14 gene is accurately and efficiently knocked out through a CRISPR / Cas9 system, and a knockout cell line for knocking out the METTL14 gene in the human lung cancer radiotherapy resistant cell strain is effectively constructed. By detecting the expression of METTL14, the knockout efficiency of the constructed METTL14 gene inducible knockout cell line and the control cell line is identified. The METTL14 gene knockout type cell line is established, and an effective cell model is provided for research of radiotherapy resistant cell pan-apoptosis.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological cell culture, and in particular to a method for constructing a radiotherapy-resistant lung cancer cell line with a METTL14 gene knocked out and application thereof. Background Art

[0003] Since Roentgen discovered X-rays in 1895 and applied them to clinical treatment for the first time, radiotherapy (RT) has become one of the important means of cancer treatment. With the continuous advancement of radiotherapy technology, precision radiotherapy can effectively reduce the damage to normal tissues, thereby improving the local control rate of tumor tissues and improving the long-term survival rate of patients. However, although 77% of lung cancer patients have evidence-based indications for radiotherapy, the effectiveness of radiotherapy is only 50%. The main mechanism of action of radiotherapy is to kill cancer cells by inducing DNA double-strand breaks. When DNA damage cannot be effectively repaired, it triggers a cell death response and induces an anti-tumor effect. However, intrinsic or acquired radioresistance to radiotherapy hinders the effectiveness of lung cancer treatment by promoting DNA repair. In recent years, studies have found that DNA damage affects cell fate through a complex signaling network, among which programmed cell death (PCD) plays a vital role in regulating the effect of tumor treatment. PCD covers a variety of cell death mechanisms, such as apoptosis, pyroptosis, and necroptosis. Studies have found that inhibiting CASP8 in lung cancer cells increases the activity of RIPK3 and leads to the initiation of necroptosis, enhancing the anti-tumor effect. In addition, CASP8 and FADD can not only regulate NLRP3 inflammasomes at the same time, but also cooperate with CASP3 and CASP7 to cleave GSDMD, thereby specifically blocking the occurrence of cell pyroptosis. These results indicate that there is a close signal crosstalk between apoptosis, pyroptosis and necroptosis, namely the phenomenon of pan-apoptosis (PANoptosis); further in-depth research on the interaction of these death signals has important clinical significance for improving radiotherapy sensitivity.

[0004] m 6A modification is the most common RNA modification in eukaryotes and is involved in the regulation of a variety of biological processes. This modification mainly completes the mRNA methylation process dynamically under the catalysis of methyltransferases (such as METTL3, METTL14 and WTAP) or demethyltransferases (ALKBH5 and FTO), which in turn affects gene transcription and translation and participates in the regulation of multiple types of biological processes. Studies have found that METTL14-mediated m6A modification participates in tumor growth, metastasis and treatment response by affecting programmed cell death. In addition, METTL14 can also affect the efficacy of radiotherapy by regulating radiotherapy-related DNA damage repair (such as adenine DNA glycosylase repair); however, the specific role of METTL14 in radiotherapy-induced cell pan-apoptosis has not yet been clarified. Therefore, in-depth research on the mechanism of action of METTL14 in radiotherapy-resistant lung cancer cells, especially its role in the regulation of radiotherapy-induced cell pan-apoptosis, is expected to provide drug targets and cell models for enhancing radiotherapy sensitivity. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing a radiotherapy-resistant lung cancer cell line with a knockout METTL14 gene and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: a method for constructing a radiotherapy-resistant lung cancer cell line with METTL14 gene knockout, using CRISPR / Cas9 technology to construct a radiotherapy-resistant lung cancer cell line with METTL14 gene knockout, the construction method comprising: selecting the sequence of 240bp-266bp of the first exon of the METTL14 gene coding region as the knockout target site, designing 3 gRNAs according to the knockout site, specifically: gRNA-1: CACCGTAGACCTCAGAATTTCATCA, gRNA-2: CACCGTAACACGGCACCAATGCTGT, gRNA-3: CACCGTGAAGAATATCCTAAACTGA, and then designing the DNA of the gRNA sequence The oligos primer is used to construct a METTL14-gRNA recombinant plasmid, and the recombinant plasmid is transformed into competent cells to amplify and screen the recombinant plasmid. The amplified recombinant plasmid is transfected into recipient cells using a transfection reagent, and the viral supernatant is collected. The supernatant is filtered and mixed with the culture medium, and then the supernatant is re-infected with a human lung cancer radiotherapy-resistant cell line (A549-RR) to obtain the radiotherapy-resistant lung cancer cell line with the METTL14 gene knocked out.

[0007] Furthermore, the sequence of the knockout target site is: GTAGACCTCAGAATTTCATC.

[0008] Further, the DNA oligos primer sequence is as follows: gRNA1-FP: CACCGTAGACCTCAGAATTTCATCA gRNA1-RP: TGATGAAATTCTGAGGTCTACGG gRNA2-FP: CACCGTAACACGGCACCAATGCTGT gRNA2-RP:ACAGCATTGGTGCCGTGTTACGG gRNA3-FP: CACCGTGAAGAATATCCTAAACTGA gRNA3-RP:TCAGTTTAGGATATTCTTCACGG.

[0009] Furthermore, the annealing reaction system of the DNA oligos primer sequence is: gRNA1-FP or gRNA2-FP or gRNA3-FP, 4 μL; gRNA1-RP or gRNA2-RP or gRNA3-RP, 4 μL; 10× NEB Buffer, 1 μL; ddH2O, 1 μL; The annealing reaction procedure was: 95°C, 10 min; and placed at room temperature for 2 h to obtain annealing products METTL14-sgRNA-1, METTL14-sgRNA-2, and METTL14-sgRNA-3.

[0010] Furthermore, the competent cells are DH5α.

[0011] Furthermore, the recipient cells are human lung cancer cells 293T cells.

[0012] Furthermore, the method for transfecting the recipient cells is liposome transfection.

[0013] Furthermore, the method for constructing the human lung cancer radiotherapy-resistant cell line is: C1. Human lung cancer A549 cells were cultured in RPMI-1640 complete medium and placed in a constant temperature incubator at 37°C and 5% CO2; A549 cells in logarithmic phase were evenly plated in a 25T culture flask, and after the cells grew to a density of 60-70%, they were exposed to a radiation source area with a radiation dose of 4Gy and a dose rate of 5Gy / min. After irradiation, the culture medium was replaced and the cells were placed in an incubator for culture; C2. When the cell density reached 90%, the cells were digested with trypsin and 3.5×10 4 The cells were placed in a new 25T cell culture flask and irradiated with 4Gy of X-rays after the cells grew to a density of 60-70%. C3. Repeat the above culture process and irradiation steps until the accumulated irradiation reaches 60 Gy; the cells that survived all radiation cycles were designated as human lung cancer radiotherapy-resistant cell lines, named A549-RR.

[0014] Application of the radiotherapy-resistant lung cancer cell line with METTL14 gene knockout constructed by the method of the present invention in the preparation of a product of cell pan-apoptosis.

[0015] The beneficial technical effect of the present invention is that the establishment of the METTL14 gene knockout cells of the present invention provides an effective cell model for the study of radiotherapy-resistant cell pan-apoptosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0017] Figure 1 It is a structural diagram of the lenti-sgRNA-PURO vector in Example 1 of the present invention.

[0018] Figure 2 This is a diagram of the plasmid sequencing results in Example 1 of the present invention.

[0019] Figure 3 The expression level of the METTL14 gene in A549-RR cells was detected by qRT-PCR in Example 1 of the present invention.

[0020] Figure 4 The knockout of METTL14 in A549-RR cells was detected by western blot in Example 1 of the present invention.

[0021] Figure 5 The clinical database of Example 2 of the present invention analyzes the correlation between METTL4 expression in lung cancer tissue and the survival rate of patients after radiotherapy.

[0022] Figure 6 This is the CCK8 analysis of the effect of METTL14 knockout on A549-RR cell proliferation in Example 3 of the present invention.

[0023] Figure 7 The cell clone formation experiment in Example 3 of the present invention analyzes the effect of METTL14 deficiency on the clone formation of A549-RR cells.

[0024] Figure 8This is the tumor result after 30 days of subcutaneous experiment on mice in Example 3 of the present invention.

[0025] Fig. 9 The subcutaneous tumor implantation experiment in Example 3 of the present invention evaluates the effect of METTL14-deficient A549-RR cells on radiotherapy sensitivity.

[0026] Fig.10 The western blot experiment in Example 4 of the present invention analyzed the effect of knocking out METTL14 in A549-RR cells on the cell pan-apoptosis process. DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1

[0029] A method for constructing a radiotherapy-resistant lung cancer cell line with METTL14 gene knockout, comprising the following steps: A. Determination of METTL14 gene knockout target site and gRNA design The sequence of 240bp-266bp of the first exon of the coding region of the METTL14 gene (Gene ID: 57721) was selected as the knockout target site. The knockout target site sequence was: GTAGACCTCAGAATTTCATC. A total of 3 gRNAs were designed. The specific sequences are as follows: gRNA-1: CACCGTAGACCTCAGAATTTCATCA (SEQ ID No. 1) gRNA-2: CACCGTAACACGGCACCAATGCTGT (SEQ ID No. 2) gRNA-3: CACCGTGAAGAATATCCTAAACTGA (SEQ ID No. 3) B. Construction of METTL14-gRNA expression vector B1 designs and synthesizes DNA oligos for gRNA based on the designed gRNA. The specific primer sequences are as follows: gRNA1-FP: CACCGTAGACCTCAGAATTTCATCA (SEQ ID No. 4) gRNA1-RP: TGATGAAATTCTGAGGTCTACGG (SEQ ID No. 5) gRNA2-FP: CACCGTAACACGGCACCAATGCTGT (SEQ ID No. 6) gRNA2-RP:ACAGCATTGGTGCCGTGTTACGG (SEQ ID No. 7) gRNA3-FP: CACCGTGAAGAATATCCTAAACTGA (SEQ ID No. 8) gRNA3-RP: TCAGTTTAGGATATTCTTCACGG (SEQ ID No. 9) B2. Dissolve the 6 gRNA DNA oligos synthesized above in ddH2O and adjust the concentration to 100 μm.

[0030] The annealing reaction system is: gRNA1-FP or gRNA2-FP or gRNA3-FP, 4 μL; gRNA1-RP or gRNA2-RP or gRNA3-RP, 4 μL; 10× NEB Buffer, 1 μL; ddH2O, 1 μL.

[0031] The annealing reaction procedure was: 95°C, 10 minutes; and room temperature for 2 hours to obtain annealing products METTL14-sgRNA-1, METTL14-sgRNA-2, and METTL14-sgRNA-3.

[0032] B3. Use endonuclease BsmbI to digest the lentiviral gRNA expression vector lenti-sgRNA-PURO. The structure of the lenti-sgRNA-PURO vector is as follows: Figure 1 As shown, the enzyme digestion system of lenti-sgRNA-PURO vector is: lenti-sgRNA-PURO, 1 μg; NEBbuffer 3.1, 2 μL; BsmbⅠ, 2 μL; add ddH2O to 20 μL; after digestion at 37°C for 2 hours, perform electrophoresis on 1% agarose gel, and then recover the digested vector with a gel recovery kit.

[0033] B4. Connect METTL14-sgRNA-1, METTL14-sgRNA-2, and METTL14-sgRNA-3 to the lenti-sgRNA-PURO vector after enzyme digestion.

[0034] The ligation reaction system is: lenti-sgRNA-PURO, 25ng; annealing products (METTL14-sgRNA-1, METTL14-sgRNA-2, METTL14-sgRNA-3), 0.5μL; 10× T4 DNA ligase buffer, 0.5μL; T4DNA ligase, 0.25μL; add ddH2O to 5μl, ligate at room temperature for 30-60 minutes to obtain the ligation product.

[0035] B5. After the ligation product was transformed into DH5α competent cells, single clones were picked and placed in LB liquid medium containing ampicillin resistance, and cultured overnight at 37°C and 200 rpm for 16 hours.

[0036] B6. Use the endotoxin-free plasmid extraction kit to extract the endotoxin-free plasmid and sequence it. The results are as follows: Figure 2 As shown, the recombinant plasmids with correct sequencing were retained, namely gRNA expression vectors, named lenti-METTL14-gRNA-1, lenti-METTL14-gRNA-2, and lenti-METTL14-gRNA-3.

[0037] C. Construction of human lung cancer radiotherapy-resistant cell lines C1. Resuspend human lung cancer A549 cells in RPMI-1640 complete medium (containing 10% FBS, 1% streptomycin and glutamine) and place in a constant temperature incubator at 37°C and 5% CO2. Take A549 cells (3.5×10 4 After the cells grow to a density of 60-70%, they are exposed to a radiation source area with a radiation dose of 4 Gy and a dose rate of 5 Gy / min. After irradiation, the culture medium is replaced and the cells are placed in an incubator for culture.

[0038] C2. When the cell density reached 90%, the cells were digested with trypsin and 3.5×10 4 The cells were placed in a new 25T cell culture flask and irradiated with 4Gy of X-rays after the cells grew to 60-70% density.

[0039] C3. Repeat the above culture process and irradiation steps until the cumulative irradiation dose reaches 60 Gy (a total of 15 times, 6 months of irradiation); the cells that survived all radiation cycles were used as human lung cancer radiotherapy-resistant cell lines and named A549-RR.

[0040] D. Construction of METTL14 gene inducible knockout cell line D1. Inoculate 293T cell lines into 6-well cell culture plates, and perform transient transfection experiments when the cell density reaches 70%; add 1 μg of gRNA expression vector (including lenti-METTL14-gRNA-1, lenti-METTL14-gRNA-2, lenti-METTL14-gRNA-3) and lentiviral packaging plasmids 1 μg of psPAX2 and 0.3 μg of pMD2.G to 200 μL of Opti-MEM culture medium and mix by pipetting; then add 7.2 μL of StarFect transfection reagent to the above Opti-MEM culture medium containing the plasmid, vortex and shake repeatedly to mix, and let stand at room temperature for 12 minutes; then, add the above suspension to the cell culture medium, mix well, and place in a 37°C CO2 cell constant temperature incubator for 6 hours; after 6 hours, replace with fresh culture medium and continue to culture for 48 hours.

[0041] D2. Collect the viral supernatant after transfection with the above different plasmids (including lenti-METTL14-gRNA-1, lenti-METTL14-gRNA-2, and lenti-METTL14-gRNA-3), filter it with a 0.45 μm filter and name them METTL14-gRNA-1, METTL14-gRNA-2, and METTL14-gRNA-3, respectively.

[0042] D3. Centrifuge the collected virus solution at 4°C, 20,000 g for 2h-3h; after centrifugation, discard two-thirds of the virus supernatant and divide the remaining virus concentrate into smaller packages and store them in a -80°C refrigerator.

[0043] D4. Mix at a ratio of virus liquid volume: fresh culture medium volume = 2:1 to obtain a mixture 1 of METTL14-gRNA-1 virus liquid and culture medium, a mixture 2 of METTL14-gRNA-2 virus liquid and culture medium, and a mixture 3 of METTL14-gRNA-3 virus liquid and culture medium.

[0044] D5. The above A549-RR cells were cultured at 1×10 5 The cells were plated into six-well plates, and when the cell density reached about 60%, cationic polymer polybrene and cell virus solution (including a mixture 1 of METTL14-gRNA-1 virus solution and culture medium, a mixture 2 of METTL14-gRNA-2 virus solution and culture medium, and a mixture 3 of METTL14-gRNA-3 virus solution and culture medium) were added and placed in an incubator for infection for 8 hours.

[0045] D6. After 8 hours, replace with fresh culture medium and continue culturing for 24h-48h to restore the cell state.

[0046] D7. The virus-infected A549-RR cells were treated with puromycin for 4 days, and the culture medium containing antibiotics was replaced every two days.

[0047] E. Construction of control cell lines E1. Inoculate the 293T cell line into a 6-well cell culture plate, and perform a transient transfection experiment when the cell density reaches about 70%; the specific method is as follows: add 1 μg of gRNA empty expression vector and lentiviral packaging plasmids 1 μg of psPAX2 and 0.3 μg of pMD2.G to 200 μL of Opti-MEM culture medium and mix by pipetting; then add 7.2 μL of StarFect transfection reagent to the above Opti-MEM culture medium containing the plasmid, vortex and shake repeatedly to mix, and let stand at room temperature for 12 minutes; then, add the above suspension to the cell culture medium, mix well, and place in a 37°C CO2 cell constant temperature incubator for 6 hours; after 6 hours, replace with fresh culture medium and continue culturing for 48 hours.

[0048] E2. Collect the viral supernatant after transfection with the empty expression vector, filter it with a 0.45 μm filter and name it vector-gRNA.

[0049] E3. Centrifuge the collected virus solution at 4°C, 20,000 g for 2h-3h; after centrifugation, discard two-thirds of the virus supernatant and divide the remaining virus concentrate into smaller portions and store them in a -80°C refrigerator.

[0050] E4. Mix at a ratio of 2:1 between the volume of virus solution and the volume of fresh culture medium to obtain a mixture of vector-gRNA virus solution and culture medium.

[0051] E5. The above A549-RR cells were cultured at 1×10 5 The cells were plated into six-well plates, and when the cell density reached about 60%, cationic polymer polybrene and cell virus solution were added and placed in an incubator for infection for 8 hours.

[0052] E6. After 8 hours, replace with fresh medium and continue culturing for 24h-48h to restore the cell state.

[0053] E7. The virus-infected A549-RR cells were treated with puromycin for 4 days, and the culture medium containing antibiotics was replaced every two days.

[0054] F. The constructed METTL14 gene inducible knockout cell line and control cell line were identified by detecting the expression of METTL14.

[0055] (1) Detection of METTL14 expression in A549-RR cells at the transcriptional level a. mRNA extraction Collect A549 cells infected with virus liquid and selected by antibiotics, add 1mL TRIZOL and place on ice for 30min; after 30min, add 200μL chloroform, vortex upside down, place on ice plate and let stand for 3-5min; after standing, centrifuge at 12000g for 15min; after centrifugation, obvious liquid stratification can be observed, take the top transparent supernatant into 1.5mL EP tube, add 1mL isopropanol, mix gently, and place at -20℃ for 2 hours. After 2 hours, centrifuge at 12000g for 10min, completely discard the supernatant; wash with pre-cooled 75% ethanol. Repeat the above process 2-3 times; finally, completely discard the supernatant, turn the EP tube upside down, and let stand for 30min; add appropriate amount of DEPC water to dissolve RNA, measure RNA concentration by NanoDrop, and place at -80 degrees Celsius for long-term storage.

[0056] b. Reverse transcription of mRNA to cDNA Prepare the reaction system for removing genomic DNA according to Table 1.

[0057] Table 1 Genomic DNA removal system Reagents volume 4 × gDNA wiper mix 4 μL Template RNA 1 μg <![CDATA[RNase-free H2O]]> to 16 μL After vortexing and centrifugation, the mixture was reacted at 42°C for 2 min.

[0058] Prepare the reverse transcription PCR reaction system according to Table 2 and perform the reverse transcription process on the machine.

[0059] Table 2 Reverse transcription PCR reaction system Reagents volume 5 × qRT SuperMix Ⅱ 4 μL Step (1) Reaction solution 16 μL c. Detection of the expression level of METTL14 in A549-RR cells by fluorescence quantitative PCR The reverse transcribed cDNA was diluted 20-30 times with ddH2O and temporarily placed on ice for subsequent fluorescence quantitative PCR experiments. The primers designed by NCBI were diluted with ddH2O and used in the next experiment. The fluorescence quantitative reaction system (total system: 20 μL) was prepared according to Table 3, and the primer sequences are shown in Table 4. The results showed that qRT-PCR detection found that both sgRNA-1 and sgRNA-2 could reduce the level of Mettl14 in A549-RR cells, and the METTL14 mRNA level of sgRNA-1 was significantly reduced (such as Figure 3 as shown).

[0060] Table 3 qRT-PCR reaction procedure Reagents volume SYBR green 10 μL Forward 1 μL Reverse 1 μL cDNA 1 μL <![CDATA[RNase-free H2O]]> to 20 μL Table 4 Primer sequences Primer name Species Primer sequence 5' to 3' Mettl14-F Mus 5'-CTGAGAGTGCGGATAGCATTG-3' (SEQ ID No.10) Mettl14-R Mus 5'-GAGCAGATGTATCATAGGAAGCC-3' (SEQ ID No.11) (2) Western blot detection of METTL14 knockout efficiency in A549-RR cells Collect virus liquid (vector-gRNA or METTL14-sgRNA-1 or METTL14-sgRNA-2 or METTL14-sgRNA-3) infected and antibiotic-screened A549-RR cells, add an appropriate amount of RIPA lysis buffer containing 1% phosphatase inhibitor and protease inhibitor, and place on ice for 30 minutes; then, the cells are completely broken by ultrasonic cell crusher and centrifuged at 4℃ 12000g for 15 minutes; take the supernatant and place it in a new EP tube and monitor the protein concentration with a BCA kit, add 4× protein loading buffer, and boil it in a 95℃ metal bath for 5-10 minutes. Finally, place the prepared samples at -20℃ for later use. According to the protein molecular weight of METTL14, prepare 10% electrophoresis gel. After the electrophoresis gel solidifies, add 15-20μg of protein sample to each well. The electrophoresis process was carried out at a voltage of 80V-120V until bromophenol blue reached the bottom of the gel; the protein after electrophoresis was transferred to a methanol-activated PVDF membrane, wet transfer, 105V, 100min. The PVDF membrane after transfer was blocked with 5% skim milk at room temperature for 1 hour and incubated with anti-METTL14 (Proteintech, 1:2000) monoclonal antibody overnight, and anti-mouse or anti-rabbit secondary antibody was incubated at room temperature for 2h. Finally, the chemical color developer ECL emitted light and was imaged by a chemical imaging system. Western blot detection showed that sgRNA-1, sgRNA-2 and sgRNA-3 could all reduce the expression of METTL14 in A549-RR cells, among which the amount of METTL14 protein in sgRNA-3 was significantly reduced, indicating that sgRNA-3 had the best knockout efficiency. In subsequent studies, we will also use gRNA-3 to knock out the expression of METTL14 in A549-RR cells (such as Figure 4 As shown). In summary, METTL14-sgRNA-3 has the highest knockout efficiency. Therefore, we will use it for subsequent experimental analysis and detection in subsequent experiments.

[0061] Example 2

[0062] Correlation between METTL14 expression and radiotherapy sensitivity in lung cancer tissues analyzed by clinical database The correlation between METTL14 expression and the survival of lung cancer patients after radiotherapy was analyzed using edgeR in the public database. The results showed that METTL14 expression was negatively correlated with the survival of lung cancer patients after radiotherapy (e.g. Figure 5 The results showed that high expression of METTL14 enhanced radiotherapy resistance, affected the efficacy of radiotherapy, and led to poor survival and quality of life of radiotherapy patients.

[0063] Example 3

[0064] Evaluation of the effect of METTL14 deletion on radiosensitivity of A549RR cells 1. CCK8 assay to detect the effect of METTL14 knockout on A549-RR cell proliferation Collect virus fluid (vector-gRNA or METTL14-sgRNA-3) and A549-RR cells (A549-RR-vector or A549-RR-METTL14-sgRNA) after infection and antibiotic selection, count the cells and dilute the cell concentration to 5 × 10 3 cells / mL. The diluted cells were plated on a 96-well plate and placed in a cell culture incubator for 24 hours of pre-culture to allow the cells to adhere to the wall and reach a stable state. After 24 hours, CCK8 solution was prepared (culture medium: CCK8 reagent = 10:1), and an experimental group (containing culture medium, cells and CCK8 solution), a control group (containing only culture medium and cells) and a blank group (only culture medium, no cells and CCK8 solution) were set up, and CCK8 solution was added to the experimental group and incubated for another 4 hours. After 4 hours, the OD value was calculated, and the cell survival rate was calculated based on the cell survival rate = (experimental group OD value - blank group OD value) / (control group OD value - blank group OD value) × 100%. The results showed that compared with the control group, the proliferation of A549-RR cells was significantly downregulated after METTL14 knockout (such as Figure 6 as shown).

[0065] 2. Cloning assay to analyze the effect of METTL14 knockout on the proliferation of A549-RR cells Collect virus fluid (vector-gRNA or METTL14-sgRNA-3) and A549-RR cells (A549-RR-vector or A549-RR-METTL14-sgRNA) after infection and antibiotic selection, count the cells and dilute the cell concentration to 1×10 4 cells / mL. The diluted cells were plated onto a 6-well plate and cultured at 37°C 5% CO2 for 3 weeks; fresh culture medium was replaced every three days during the culture period; after 3 weeks, the culture medium was removed, the cells were washed with PBS buffer and 4% paraformaldehyde was added to fix the cells for 15 minutes; after 15 minutes, the paraformaldehyde was collected and washed with PBS buffer for 3-5 times, and crystal violet was added for staining for 30 minutes; after 30 minutes, the crystal violet was removed and the remaining residual crystal violet liquid was slowly rinsed with clean water. The results showed that the number of colonies formed by A549-RR cells with METTL14 knocked out was significantly less than that of A549-RR cells without METTL14 knockout (such as Figure 7 as shown).

[0066] 3. Evaluation of the effect of METTL14 knockout on radiosensitivity by subcutaneous tumor implantation in mice Collect the virus solution (vector-gRNA or METTL14-sgRNA-3) and A549-RR cells after infection and antibiotic selection, and adjust the cell concentration to 1×10 per 100 μL. 6 vector-gRNA-A549RR cells or 1×10 6 METTL14-gRNA-A549RR cells; the above cells were implanted into Rag1 - / - The tumor volume (0.52×length×width×width) was measured subcutaneously by using a vernier caliper every week. On the 10th day after tumor implantation, radiotherapy was given (radiation dose of 8Gy for three consecutive days). When the tumor had grown for 30 days, the mice were euthanized and the subcutaneous tumor tissue of the mice was removed for tumor comparison, volume recording and weighing. The results showed that compared with A549-RR cells without METTL14 knockout, the volume and weight of the tumor tissue formed by A549RR cells with METTL14 knockout were significantly reduced (e.g. Figure 8-9 as shown).

[0067] Example 4

[0068] Application of METTL14 knockout A549-RR cells in detecting pan-apoptosis A549-RR cells infected with virus liquid (vector-gRNA or METTL14-sgRNA-3) and selected with antibiotics were collected and the expression levels of proteins related to programmed cell death were detected by western blot to further confirm the effect of knocking out the METTL14 gene on the pan-apoptosis process of cells. The specific steps are as follows: add an appropriate amount of RIPA lysis buffer containing 1% phosphatase inhibitors and protease inhibitors, and place on ice for 30 minutes; then, the cells were completely broken by ultrasonic cell crusher and centrifuged at 4℃ 12000g for 15 minutes; take the supernatant and place it in a new EP tube and monitor the protein concentration with a BCA kit, add 4× protein loading buffer, and boil it in a 95℃ metal bath for 5-10 minutes. Finally, the prepared samples were placed at -20℃ for later use. According to the protein molecular weight of METTL14, a 10% electrophoresis gel was prepared. After the electrophoresis gel solidified, 15-20μg of protein sample was added to each well. The electrophoresis process was carried out at a voltage of 80V-120V until bromophenol blue reached the bottom of the gel; the protein after electrophoresis was transferred to the PVDF membrane activated by methanol, and wet-transferred at 105V for 100min. After transfer, the PVDF membrane was blocked with 5% skim milk at room temperature for 1 hour and incubated with monoclonal antibodies of anti-METTL14 (Proteintech, 1:2000), anti-METTL14 (Proteintech, 1:2000), anti-Caspase7 (Proteintech, 1:2000), anti-CleavedCaspase7 (Proteintech, 1:2000), anti-CleavedCaspase3 (Proteintech, 1:2000), MLKL (Proteintech, 1:2000), GSDME (Proteintech, 1:2000) and β-Actin (Proteintech, 1:2000) overnight, and anti-mouse or anti-rabbit secondary antibody was incubated at room temperature for 2 hours. Finally, the chemical color developer ECL was used for luminescence and the images were imaged by chemical imaging system. The results showed that the pan-apoptotic process (including apoptosis, necrosis and pyroptosis) was activated in METTL14-knocked-out A549-RR cells; these results indicate that METTL14 improves the radiosensitivity of lung cancer cells by promoting the pan-apoptotic process, achieving anti-tumor effects (such as Fig.10 as shown).

[0069] Finally, it should be noted that the above embodiments are only used to illustrate rather than limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the present invention can still be modified or replaced by equivalents. Any modification or partial replacement that does not depart from the spirit and scope of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A method for constructing a radiotherapy-resistant lung cancer cell line with METTL14 gene knockout, using CRISPR / Cas9 technology to construct a radiotherapy-resistant lung cancer cell line with METTL14 gene knockout, characterized in that: The construction method comprises: selecting a sequence of 240bp-266bp of the first exon of the coding region of the METTL14 gene as a knockout target site, designing three gRNAs according to the knockout site, specifically: gRNA-1: CACCGTAGACCTCAGAATTTCATCA, gRNA-2: CACCGTAACACGGCACCAATGCTGT, gRNA-3: CACCGTGAAGAATATCCTAAACTGA, then designing DNA oligos primers of the gRNA sequence to construct a METTL14-gRNA recombinant plasmid, transforming the recombinant plasmid into competent cells to amplify and screen the recombinant plasmid, transfecting the recombinant plasmid into receptor cells with a transfection reagent, collecting the supernatant, filtering the supernatant and mixing it with a culture medium, and then infecting a human lung cancer radiotherapy-resistant cell line (A549-RR) again, so as to obtain the radiotherapy-resistant lung cancer cell line with the METTL14 gene knocked out.

2. The construction method according to claim 1, characterized in that: The sequence of the knockout target site is: GTAGACCTCAGAATTTCATC.

3. The construction method according to claim 1, characterized in that: The DNA oligos primer sequences are as follows: gRNA1-FP: CACCGTAGACCTCAGAATTTCATCA gRNA1-RP: TGATGAAATTCTGAGGTCTACGG gRNA2-FP: CACCGTAACACGGCACCAATGCTGT gRNA2-RP:ACAGCATTGGTGCCGTGTTACGG gRNA3-FP: CACCGTGAAGAATATCCTAAACTGA gRNA3-RP:TCAGTTTAGGATATTCTTCACGG.

4. The construction method according to claim 1 or 3, characterized in that: The annealing reaction system of the DNA oligos primer sequence is: gRNA1-FP or gRNA2-FP or gRNA3-FP, 4 μL; gRNA1-RP or gRNA2-RP or gRNA3-RP, 4 μL; 10× NEB Buffer, 1 μL; ddH2O, 1 μL; The annealing reaction procedure was: 95°C, 10 min; and placed at room temperature for 2 h to obtain annealing products METTL14-sgRNA-1, METTL14-sgRNA-2, and METTL14-sgRNA-3.

5. The construction method according to claim 1, characterized in that: The competent cells are DH5α.

6. The construction method according to claim 1, characterized in that: The recipient cells are 293T cells.

7. The construction method according to claim 1, characterized in that: The method for transfecting the receptor cells is liposome transfection.

8. The construction method according to claim 1, characterized in that: The method for constructing the human lung cancer radiotherapy-resistant cell line is as follows: C1. Resuspend human lung cancer A549 cells in RPMI-1640 complete medium and culture them in a constant temperature incubator at 37°C and 5% CO2; Take A549 cells in logarithmic phase and evenly plate them into a 25T culture flask. After the cells grow to a density of 60-70%, expose them to a radiation source area with a radiation dose of 4Gy and a dose rate of 5Gy / min. After irradiation, replace the medium and continue to culture them in a cell culture incubator; C2. When the cell density reached 90%, the cells were digested with trypsin and 3.5×10 4 The cells were placed in a new 25T cell culture flask and irradiated with 4Gy of X-rays after the cells grew to a density of 60-70%. C3. Repeat the above culture process and irradiation steps until the cumulative irradiation dose reaches 60 Gy; the cells that survived all radiation cycles were used as a human lung cancer radiotherapy-resistant cell line and named A549-RR.

9. Use of the radiotherapy-resistant lung cancer cell line with METTL14 gene knockout constructed by the method according to claim 1 in the preparation of a product of pan-apoptosis of cells.

Images