Molecular marker of new functional allelic variant Sbdth1 of sorghum heading stage gene SbDTH1 and application thereof

Abstract

The application discloses a molecular marker of a new functional allelic variant Sbdth1 of a sorghum heading stage gene SbDTH1 and application of the molecular marker. The application provides regulation of a functional allelic variant in the sorghum heading stage gene SbDTH1, and the fourth base after a termination codon TGA is inserted with a transposon. The allelic variant can prolong the heading time of sorghum. A molecular marker for high-throughput marker molecular detection is developed according to the allelic variant. The molecular marker has advantages of flexibility, high efficiency, high throughput, low cost and the like. The molecular marker can be used for detection and screening of the allelic variant, used for molecular marker breeding, and used for breeding of new sorghum varieties with suitable heading stages. The application has important significance for expansion of regional planting of sorghum and improvement of yield.

Description

Technical Field

[0001] This invention relates to the field of marker-assisted breeding technology for crops, specifically to the molecular marker and application of a novel functional allelic variant of the sorghum heading gene SbDTH1, namely Sbdth1. Background Technology

[0002] Sorghum (Sorghumbicolor) is the world's fifth most popular cereal crop, a staple food for over 500 million people in Africa and Asia. Besides being a valuable food source, sorghum plays a vital role in the brewing, animal feed, pigment, and biomass energy industries, leading to a year-on-year increase in my country's demand for it. Therefore, further increasing sorghum production and expanding its planting area is extremely important.

[0003] Heading (flowering) time is one of the most important agronomic traits of crops. Successfully controlling flowering time is crucial for crop production because it ensures that plants reproduce under optimal conditions. Cereal sorghum is generally selected for early flowering to avoid drought or low temperatures and ensure propagation, while other sorghum types, such as sweet sorghum, forage sorghum, and energy sorghum, opt for a longer vegetative growth period to achieve higher biomass yields. The diversity of flowering time in sorghum under long-day conditions indicates that multiple genes can be selected to breed photoperiod-insensitive varieties. Therefore, flowering time is a major limiting factor in crop breeding for improving yield and regional adaptability.

[0004] Sorghum is a typical short-day plant, and differences in photoperiod sensitivity determine the flowering time of different sorghum varieties. Under temperate long-day conditions, many photoperiod-sensitive sorghum germplasms flower very late or even fail to produce heads, making them unsuitable for cultivation. Since photoperiod regulation of flowering is crucial for crop yield and hybrid seed production, it has been an important goal of sorghum improvement programs since the early 20th century.

[0005] Traditional breeding of widely adaptable sorghum involves single-plant selection based on the flowering time of offspring. This method is not only time-consuming and labor-intensive but also susceptible to environmental interference and lacks accuracy. Developing specific molecular markers to assist selection based on base differences in target genes is the best approach to improve the selection efficiency of widely adaptable sorghum. Although many scholars have studied the heading time of sorghum, reports on genes controlling heading time are still limited, and reported molecular markers related to heading time are even scarcer. Summary of the Invention

[0006] By statistically analyzing the heading dates of the Tx430 / P898012 inbred line population in seven different environments, five QTL loci were located using quantitative trait loci (QTL). Among these, Ma1 and Ma6 on chromosome 6 and SbFT on chromosome 10 have been reported, and ELF3 is a candidate gene on chromosome 9. No QTL control genes on chromosome 8 have been reported. We cloned the candidate gene on chromosome 8 as SbDTH1 and verified and elucidated the function and regulatory mechanism of the SbDTH1 gene.

[0007] This invention, through bioinformatics analysis, found that SbDTH1 encodes the bHLH transcription factor, which is most closely related to the maize PIF4 gene. Subcellular localization experiments revealed that the SbDTH1 protein is located in the cell nucleus.

[0008] To analyze the polymorphism of the SbDTH1 gene sequence, sequence alignment was performed on the published sequences of Tx430, P898012, Tx623, and RIO. An insertion of 6755 bp was found in the early-flowering autumn varieties Tx430 and Tx623, while this fragment was missing in the late-flowering autumn varieties P898012 and RIO, suggesting it is a functional variation. Transposons were converted into molecular markers, and the heading date and transposon presence were statistically analyzed in an F2 population (Tx430 / Hongyingzi) and a natural population (161 sorghum germplasms). The results showed that varieties with transposons had a longer average heading time than those without, indicating that SbDTH1 regulates the heading date of sorghum, and that the transposon insertion is a functional variation.

[0009] This invention provides a functional allelic variant of the sorghum heading time gene SbDTH1, which inserts a transposon at the fourth base after the stop codon TGA. This allelic variant can prolong the heading time of sorghum. Molecular markers for high-throughput marker-assisted detection were developed based on this allelic variant.

[0010] This invention is achieved through the following technical solution:

[0011] This invention provides

[0012] A molecular marker for a novel functional allelic variant of the sorghum heading time gene SbDTH1, namely Sbdth1, is disclosed. This molecular marker is used to label a novel functional allelic variant of the sorghum heading time gene SbDTH1, namely Sbdth1, in which a transposon is inserted at the fourth base after the stop codon TGA in the sorghum chromosome 8 gene SbDTH1. The allelic variant Sbdth1 exhibits later heading.

[0013] Preferably, the number of bases in the transposon is 6755 bp.

[0014] Preferably, the transposon is inserted at a position 2314 bp from the start codon.

[0015] Preferably, the molecular marker comprises forward primers 1F and 2F; and the reverse primer is 1R;

[0016] The sequence of 1F is SEQ ID NO.1:

[0017] DTH-dF-1:5'GCTCACACTCAACCACATGC 3';

[0018] The sequence of 2F is SEQ ID NO.2:

[0019] DTH-dF-2:5'GCTACAGGCACAGATGACGA 3';

[0020] The sequence of 1R is SEQ ID NO.3:

[0021] DTH-dR-2:5'TTTGTTGACCTCGGTCTGAA 3'.

[0022] Preferably, the molecular marker can identify the allelic variant Sbdth1;

[0023] Amplification was performed using 2F and 1R, and a 675bp band was found that was the Sbdth1 genotype.

[0024] Amplification was performed using 1F and 1R, and a 615bp band was found to be of the DTH1 genotype.

[0025] Preferably, the molecular marker is used to detect whether a sorghum variety, strain, or germplasm resource is of the Sbdth1 genotype.

[0026] Preferably, the molecular markers are used to detect the distribution of key functional allelic variations in sorghum germplasm resources.

[0027] Preferably, the molecular marker is used for marker-assisted selection breeding of genes at the heading stage of sorghum.

[0028] The beneficial effects of this invention are as follows: This invention, through QTL mapping, discovered a variant site regulating the heading time of sorghum—a transposon insertion in the SbDTH1 gene—and developed it into a molecular marker. Developing a molecular marker closely linked to the heading time of sorghum for early (low generation) selection in breeding plays an important role in reducing breeding time, improving the sorghum's broad-type breeding, and ultimately increasing economic benefits.

[0029] This invention provides a gene regulating the heading stage of sorghum.

[0030] A novel variant of SbDTH1 provides a high-throughput molecular marker for detecting genes related to sorghum heading time, which has significant value in breeding. It can rapidly, flexibly, efficiently, and with high throughput detect key variants within the SbDTH1 gene that alter the heading time of sorghum. It can be used to detect the distribution of key functional allelic variants in sorghum germplasm resources, efficiently screen sorghum germplasm resources with ideal heading time, and apply them to molecular marker-assisted selection breeding of sorghum heading time genes. It has significant value in expanding the planting range of sorghum using SbDTH1. Attached Figure Description

[0031] Figure 1 The diagram shows the phylogenetic tree of SbDTH1.

[0032] Figure 2 The diagram shows the predicted structure of the SbDTH1 protein.

[0033] Figure 3 The diagram illustrates the subcellular localization of SbDTH1.

[0034] Figure 4 This is a schematic diagram of the SbDTH1 transposon.

[0035] Figure 5 These are amplification gel images of Tx430 and P898012 transposons, where T indicates the presence of transposon insertion and P indicates the absence of transposon insertion.

[0036] Figure 6 It is a statistical analysis of the presence or absence of transposons in different groups and the heading period.

[0037] Figure 7 This is a gel image of F2 population genotyping, where primer A is 2F / 1R; and primer B is a gel image of amplification using primer 1F / 1R.

[0038] Figure 8 This is a gel image of the Sbdth1 / SbDTH1 genotyping in a natural population, where primer A is 2F / 1R; and primer B is a gel image of amplification using primer 1F / 1R. Detailed Implementation

[0039] Example 1: Bioinformatics Analysis of SbDTH1

[0040] The SbDTH1 gene encodes the bHLH transcription factor, with an APB structure at 42 aa and a bHLH structure at 278 aa at the N-terminus. Blast analysis of the SbDTH1 amino acid sequence was performed using NCBI, and phylogenetic trees were constructed using MEGA7 to identify proteins from different species. The results showed that the sorghum SbDTH1 protein is most closely related to the maize PIF4 gene (see...). Figure 1 ).

[0041] Example 2: SbDTH1 protein structure prediction

[0042] The tertiary structure of the SbDTH1-encoded protein was predicted online using SWISS-MODEL. Based on the SbDTH1 protein sequence, a model with high similarity to the PDB was selected for tertiary structure modeling. The model with ID number 5gnj.3.A was chosen; its quality assessment value was between 0 and 1, and its sequence similarity was higher than 60%. Using this model as a reference, the constructed SbDTH1 tertiary structure exhibited high reliability and accuracy (see...). Figure 2 ).

[0043] Example 3: Subcellular localization of SbDTH1

[0044] To understand the subcellular localization of SbDTH1, an expression vector of SbDTH1-pBI121 with a GFP tag was constructed and transformed into Agrobacterium GV3101. Agrobacterium was then transferred into the lower epidermis of leaves from approximately 5 weeks-old *Nicotiana Bunsenata* plants. After injection, the plants were cultured for another 2 days, using pBI121-GFP as a control. Leaf fluorescence was observed using a two-photon laser confocal microscope (Zeiss, Germany). Subcellular localization results showed that the empty pBI121-GFP vector fluoresced in the cell membrane, cytoplasm, and nucleus, while the SbDTH1 gene fluoresced only in the nucleus (see...). Figure 3 This indicates that SbDTH1 is a nuclear protein.

[0045] Example 4: SbDTH1 Polymorphism Analysis

[0046] To investigate the polymorphism of the SbDTH1 gene, we performed sequence alignment of the upstream 3000 bp and downstream 2000 bp of the SbDTH1 gene in the published genomes of the varieties Tx430, P898012, RIO, and Tx623 (heading stage). A total of 14 polymorphic sites were identified, including 7 in the promoter, 6 in the exons, and 1 in the intron. Among these, sequence alignment of the early-flowering varieties Tx430 and Tx623, and the late-flowering varieties P898012 and RIO, revealed 3 potential functional mutations. The base substitutions at 1869 bp and 2235 bp were synonymous mutations. A 6755 bp transposon insertion (3 bp from the stop codon TGA) was present in the early-heading varieties Tx623 and Tx430, but not in the late-heading varieties Rio and P898012 (see [link to relevant documentation]). Figure 4 It is speculated that the transposon is a functional mutation.

[0047]

[0048] Table 1. Statistics on polymorphic sites of various nucleotides

[0049] The genotype with transposon insertion is named Sbdth1; the genotype without transposon insertion is named SbDTH1.

[0050] Example 5: Transposon conversion to molecular marker

[0051] We designed two pairs of primers for transposons, including forward primers 1F and 2F; and a reverse primer 1R.

[0052] The primer sequence for labeling Sbdth1 is as follows:

[0053] The sequence of 1F is SEQ ID NO.1:

[0054] DTH-dF-1:5'GCTCACACTCAACCACATGC 3';

[0055] The sequence of 2F is SEQ ID NO.2:

[0056] DTH-dF-2:5'GCTACAGGCACAGATGACGA 3';

[0057] The sequence of 1R is SEQ ID NO.3:

[0058] DTH-dR-2:5'TTTGTTGACCTCGGTCTGAA 3';

[0059] Amplification using 1F and 1R revealed that the Tx430 strain amplified a 7375bp fragment, while the P898012 strain amplified a 615bp fragment, indicating that the P898012 strain had a 6755bp deletion (see...). Figure 5 P898012 is the SbDTH1 genotype.

[0060] Amplification using 2F and 1R revealed a 675bp target band on Tx430, while P898012 showed no target band (see [link to data]). Figure 5 Tx430 is the Sbdth1 genotype.

[0061] Example 6: Determination of Functional Variation

[0062] Using molecular markers to statistically analyze the heading date and the presence or absence of transposons in different populations, it was found that in the F2 population (Tx430 / Hongyingzi) and the natural population, varieties with transposon insertion had an average heading time later than varieties without transposon insertion. Figure 6 The results indicate that the SbDTH1 gene regulates the heading period of sorghum, and the insertion of the transposon is a functional mutation.

[0063] Example 7: Genotyping of Recombinant Inbred Line Population

[0064] The population consisted of 192 F2 generation plants from a recombinant inbred line population constructed using Tx430(Sbdth1) / Hongyingzi (DTH1). The heading time was statistically analyzed as follows: Figure 7 As shown in the figure, 43 materials were of the Sbdth1 genotype, 52 materials were of the SbDTH1 genotype, and 94 materials were heterozygous. The segregation ratio of the materials was 1:2:1, which meets the segregation ratio. The results are as follows. Figure 7 As shown

[0065] Example 8: Identification of the presence or absence of transposons in sorghum varieties from different sources

[0066] The experimental materials used for transposon identification included 161 sorghum varieties from China and Africa. The heading time of these 161 varieties was statistically analyzed. Figure 8 As shown.

[0067] The presence or absence of transposons in 161 sorghum varieties from China and Africa was determined by 1% agarose gel electrophoresis. 79 varieties contained transposons, while 82 varieties did not.

[0068] The above description is only a preferred embodiment of this patent. It should be noted that for those skilled in the art, several improvements and substitutions can be made without departing from the technical principles of this patent, and these improvements and substitutions should also be considered within the scope of protection of this patent.

Claims

1. A method for detecting a novel functional allelic variant, Sbdth1, of the sorghum heading stage gene SbDTH1, characterized in that, Includes the following steps: The following primer combinations were used for amplification reactions: Forward primer 1F, with the sequence SEQ ID NO.1: 5'-GCTCACACTCAACCACATGC-3'; and / or Forward primer 2F has the sequence SEQ ID NO.2: 5'-GCTACAGGCACAGATGACGA-3'; The reverse primer 1R has the sequence SEQ ID NO.3: 5'-TTTGTTGACCTCGGTCTGAA-3'; The allelic variant Sbdth1 is a transposon inserted into the sorghum chromosome 8 gene SbDTH1 at the 4th base after the stop codon TGA; the allelic variant Sbdth1 has a later heading stage. If a 675bp band can be amplified using the primers 2F and 1R, then the sorghum is determined to contain the Sbdth1 genotype. And / or, using the primers 1F and 1R for amplification, if a 615bp band can be amplified, then the sorghum is determined to contain the wild-type SbDTH1 genotype.

2. The method according to claim 1, characterized in that, The transposon has 6755 bp bases.

3. The method according to claim 1, characterized in that, The transposon insertion site is 2314 bp away from the start codon of the SbDTH1 gene.

4. The application of the method according to any one of claims 1-3, characterized in that, Used to detect whether a sorghum variety, strain, or germplasm resource is of the Sbdth1 genotype.

5. The application of the method according to any one of claims 1-3, characterized in that, This is used to detect the distribution of the allelic variants in sorghum germplasm resources.

6. The application of the method according to any one of claims 1-3, characterized in that, Molecular marker-assisted selection breeding for sorghum heading stage.

Images