Detection system for simultaneously detecting HBV (Hepatitis B Virus) and HCV (Hepatitis C Virus) based on multi-cross displacement isothermal amplification and nano biosensor

Abstract

The invention relates to the technical field of pathogen detection, in particular to a detection system for simultaneously detecting HBV (Hepatitis B Virus) and HCV (Hepatitis C Virus) based on multi-cross displacement isothermal amplification and a nano biosensor. The detection system comprises a multi-cross displacement isothermal amplification unit and a detection unit, the multi-cross displacement isothermal amplification unit is used for simultaneously performing multi-cross displacement isothermal amplification on the S gene of hepatitis B virus and the 5 'UTR gene of hepatitis C virus in the same reaction system; through the design of degenerate primers, the system can simultaneously detect various subtypes of hepatitis B virus and hepatitis C virus. According to the technical scheme, the technical problem that a detection system which is short in time consumption, simple to operate and high in detection sensitivity for simultaneously detecting various types of hepatitis viruses is lacked can be solved. And rapid amplification can be carried out within 35 min at the constant temperature of 64 DEG C, the detection limit is 10 copies, the requirements of economy, sensitivity, specificity, user friendliness, rapidness, stability and no need of complex equipment are met, and the method has ideal popularization and application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen detection, and in particular to a detection system for simultaneously detecting HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor. Background Art

[0002] Hepatitis B virus (HBV) and hepatitis C virus (HCV) infections are considered by the World Health Organization (WHO) to be a major threat to human health, especially in low- and middle-income settings. In 2019, an estimated 295.9 million people worldwide were living with chronic HBV infection and another 57.8 million with chronic HCV infection, with the two viruses together causing nearly a quarter of infectious disease deaths worldwide. In 2016, the WHO set a goal to eliminate viral hepatitis as a public health threat by 2030, emphasizing the importance of diagnostic testing and treatment. The goal is for 90% of people infected with HBV and HCV to know their status and for 80% of patients to receive antiviral treatment and be cured. However, a WHO report highlights that in low- and middle-income settings, less than 1% of people with chronic HBV / HCV infection know they are ill. Underdiagnosis of HBV / HCV is a particular challenge to achieving the WHO goal of eliminating HBV and HCV infections by 2030.

[0003] Currently, laboratory-based immunoassays and nucleic acid amplification tests (NAATs) are the mainstay of HBV / HCV testing in clinical practice. Immunoassays are based on serological responses targeting HBV / HCV antibodies or antigens. However, these tests may not be suitable for diagnosing acute HBV / HCV infection because they require a long window period (1–6 months). In addition, false-negative results may occur in immunocompromised patients. NAATs based on polymerase chain reaction (PCR) and real-time quantitative PCR are considered the new technologies of choice for early detection of HBV / HCV infection in clinical practice due to their high sensitivity and specificity. However, these methods are often inaccessible and unaffordable in resource-limited areas because they require significant investments in infrastructure, instrumentation, and training, and the testing process is time-consuming. Therefore, the development of an affordable, sensitive, specific, rapid, equipment-free, and user-friendly point-of-care (POC) platform is essential to achieve the WHO viral hepatitis elimination goal. Summary of the invention

[0004] The purpose of the present invention is to provide a detection system for simultaneously detecting HBV and HCV based on multiple cross-replacement isothermal amplification and nanobiosensor, so as to solve the technical problem in the prior art that there is a lack of a detection system that can simultaneously detect multiple types of HBV and HCV with short detection time, simple operation and high detection sensitivity.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] A detection system for simultaneously detecting HBV and HCV based on multiple cross-displacement isothermal amplification and nano-biosensor, comprising a multiple cross-displacement isothermal amplification unit and a detection unit; the multiple cross-displacement isothermal amplification unit is used to simultaneously perform multiple cross-displacement isothermal amplification on the S gene of hepatitis B virus and the 5'UTR gene of hepatitis C virus in the same reaction system; the hepatitis B virus includes at least one of B subtype, C subtype, D subtype, recombinant B / C subtype and recombinant C / D subtype; the hepatitis C virus includes at least one of 1b subtype, 2a subtype, 3a subtype, 3b subtype and 6a subtype.

[0007] This study developed an innovative HBV&HCV-MCDA-AuNPs-LFB point-of-care diagnostic platform that cleverly combined multiplex MCDA isothermal amplification with a visual AuNPs-LFB interpretation platform to achieve highly accurate, sensitive, rapid, simple, economical, and visual diagnosis of HBV and HCV infection in a single test. The feasibility of this detection platform was verified using serum samples from patients suspected of HBV and HCV infection, and the results were compared with those of real-time PCR.

[0008] HBV and HCV infections affect hundreds of millions of people and pose a significant burden on public health systems. Hepatitis virus infections are often asymptomatic or mild before developing into advanced liver disease. In addition, a large number of people infected with HBV or HCV remain undiagnosed, especially in low- and middle-income areas. As a result, a considerable proportion of chronic hepatitis B or C patients are unable to receive antiviral treatment in a timely manner, which may lead to serious complications and further spread of the virus. Therefore, the development of an affordable, easy-to-use, accurate and sensitive HBV / HCV identification diagnostic platform is crucial to prescribe more effective antiviral treatment regimens and prevent HBV / HCV transmission. Our HBV&HCV-MCDA-AuNPs-LFB assay utilizes a novel multiplex MCDA method that can rapidly amplify target genes within 35 min at a constant temperature (64°C). The MCDA reaction can be performed isothermally on simple equipment such as metal baths, water baths and heating blocks. The MCDA amplification products are analyzed quickly and intuitively using the AuNPs-LFB platform. Since Bst DNA polymerase is used, which has fewer inhibitors than Taq DNA polymerase used in traditional PCR systems, crude nucleic acid can meet the needs of MCDA isothermal amplification. Therefore, our HBV&HCV-MCDA-AuNPs-LFB test is user-friendly and time-saving. The entire test process, including rapid nucleic acid extraction (10 min), MCDA (35 min) and AuNPs-LFB interpretation (less than 2 min), can be completed within 50 min.

[0009] Further, the primer combination for multiple cross-replacement isothermal amplification of the S gene of hepatitis B virus is as follows:

[0010] HBV-F1: 5′-TGTACMAAACCTWCGGACGG-3′;

[0011] HBV-F2: 5′-GMGGYAWAAAGGGACTCAAG-3′;

[0012] HBV-CP1: 5′-TGAGGCCCACTCCCATAGGWAT-YTGCACYTGTATTCCCATCC-3′;

[0013] HBV-CP2: 5′-GTGGTTCGTAGGGCTTTCCCC-KACAGACTTGGCCCCCAA-3′;

[0014] HBV-C1: 5′-TGAGGCCCACTCCCATAGGWAT-3′;

[0015] HBV-C2: 5′-GTGGTTCGTAGGGCTTTCCCC-3′;

[0016] HBV-D1: 5′-SCGAAAGCCCARGATGAT-3′;

[0017] HBV-D2: 5′-TBTGGCTTTCAGTTATAT-3′;

[0018] HBV-R1: 5′-CTGAGCCARGAGAAACGGR-3′;

[0019] HBV-R2: 5′-TACTAGTGCCATTTGTTC-3′;

[0020] The primer combination for multiple cross-replacement isothermal amplification of the 5'UTR gene of hepatitis C virus is as follows:

[0021] HCV-F1: 5′-TGTCGTRCAGCCTCCAG-3′;

[0022] HCV-F2: 5′-GGTCTACGAGACCTCCCG-3′;

[0023] HCV-CP1: 5′-AAGAAAGGACCCRGTCDYCCYR-AGCCATAGTRGTCTGCGGA-3′;

[0024] HCV-CP2: 5′-CCGCRAGAYYRCTAGCCGA-GCACCCTATCAGGCAGTACC-3′;

[0025] HCV-C1: 5′-AAGAAAGGACCCRGTCDYCCYR-3′;

[0026] HCV-C2: 5′-CCGCRAGAYYRCTAGCCGA-3′;

[0027] HCV-D1: 5′-CRATTCCGGTGTACTCA-3′;

[0028] HCV-D2: 5′-AGYGTTGGGTYGCGAAAGGC-3′;

[0029] HCV-R1: 5′-YATWGAGYGGGTTKNTC-3′;

[0030] HCV-R2: 5′-CYRGMVATTTGGGCGTGC-3′;

[0031] Among them, the 5′ end of HBV-C1 can be modified with the first marker molecule or not; the 5′ end of HBV-D1 can be modified with the second marker molecule or not; the 5′ end of HCV-C1 can be modified with the first marker molecule or not; the 5′ end of HCV-D1 can be modified with the third marker molecule or not.

[0032] Further, the concentration ratio of HBV-F1 and HCV-F1, HBV-F2 and HCV-F2, HBV-CP1 and HCV-CP1, HBV-CP2 and HCV-CP2, HBV-C1 and HCV-C1, HBV-C2 and HCV-C2, HBV-D1 and HCV-D1, HBV-D2 and HCV-D2, HBV-R1 and HCV-R1, and HBV-R2 and HCV-R1 is 1:2.

[0033] Furthermore, the first labeling molecule is biotin, the second labeling molecule is carboxyfluorescein, and the third labeling molecule is digoxigenin.

[0034] Furthermore, the multiple cross-displacement isothermal amplification unit also includes Bst 2.0 DNA polymerase, dNTP mixture and buffer.

[0035] Furthermore, the operating temperature of the multiple cross-displacement isothermal amplification unit is 64° C., and the operating time of the multiple cross-displacement isothermal amplification unit is 35 minutes.

[0036] Furthermore, the detection limit of the system was 10 copies / reaction.

[0037] Furthermore, the detection unit is a lateral flow biosensor based on gold nanoparticles; the lateral flow biosensor based on gold nanoparticles includes a sample pad, a binding pad, a nitrocellulose membrane and a water absorbent pad fixed on the back plate in sequence; the nitrocellulose membrane is provided with a test line 1, a test line 2 and a quality control line.

[0038] Furthermore, carboxyfluorescein antibody, digoxigenin antibody and biotinylated bovine serum albumin are respectively immobilized on the test line 1, the test line 2 and the quality control line.

[0039] Furthermore, the conjugate pad contains streptavidin-coated gold nanoparticles coupled to a deep red dye.

[0040] The technical principle and beneficial effects of this technical solution are:

[0041] HBV and HCV specific amplification products were simultaneously generated in a multiplex MCDA reaction system using Bst 2.0 DNA polymerase with strand displacement activity and two sets of MCDA primer sets targeting HBV-S and HCV-5'-UTR. Each MCDA primer set included two displacement primers (F1 and F2), two cross primers (CP1 and CP2), and six amplification primers (C1, C2, D1, D2, R1, and R2). In this study, two sets of MCDA primers specifically targeting HBV and HCV were successfully designed. The HBV-MCDA primers targeted ten regions of the S gene of the five HBV genotypes prevalent in China (B, C, D, B / C recombinant, and C / D recombinant), and the HCV-MCDA primers targeted ten regions of the 5'-UTR gene of the five HCV subtypes prevalent in China (1b, 2a, 3b, 6a, and 3a). For AuNPs-LFB detection, HBV-D1 and HBV-C1 primers were labeled with FAM and biotin at their 5' ends, while HCV-D1 and HCV-C1 primers were labeled with digoxigenin and biotin, respectively. Therefore, HBV positive amplification products were labeled with FAM and biotin, and HCV positive amplification products were labeled with digoxigenin and biotin, which made it possible to detect HBV-MCDA and HCV-MCDA products simultaneously on one AuNPs-LFB test strip. The conditions of our detection were optimized at 64℃ and 35min in the MCDA reaction stage. The specificity of our detection was verified by several HBV genotypes (B, C, D, B / C recombinant, and C / D recombinant), HCV subtypes (1b, 2a, 3b, 6a, and 3a), and other pathogens. As expected, the specificity of the HBV&HCV-MCDA-AuNPs-LFB diagnostic system for HBV S gene and HCV 5'-UTR gene reached 100%, and no cross-reaction was detected. In addition, the detection limit of our assay for HBV and HCV was 10 copies per test. In addition, the feasibility of our assay was validated using clinical serum samples from patients suspected of HBV and / or HCV infection, and the data confirmed that our novel assay can effectively identify HBV and HCV pathogens in clinical practice.

[0042] Multiple cross-displacement isothermal amplification (MCDA) is a novel isothermal nucleic acid amplification method based on strand displacement DNA synthesis and automated cycling, which has been validated as an alternative to PCR-based methods for the identification of specific nucleic acid targets. MCDA is a promising point-of-care (POC) diagnostic platform because it operates at a constant temperature, thanks to its high specificity, high sensitivity, and simple, rapid, instrument-free, and practical "on-site" detection procedure.

[0043] In this study, we used an innovative approach based on multiplexed MCDA and AuNPs-LFB platform for the first time, which was able to identify HBV and HCV simultaneously in one test. To achieve visual and rapid analysis of multiplexed MCDA products, we designed and constructed AuNPs-LFB in this study. In this study, AuNPs-LFB enabled rapid, visual, and simultaneous monitoring of multiplexed MCDA products by immobilizing anti-FAM, anti-digoxigenin, and BSA-biotin, respectively, on the nitrocellulose (NC) membrane of the biosensor strip. When FAM / biotin-labeled HBV-MCDA and digoxigenin / biotin-labeled HCV-MCDA products were dropped onto the sample pad of the biosensor, they moved forward by capillary action, integrated with the deep red dye-labeled streptavidin-AuNPs on the binding pad of the AuNPs-LFB strip, and then passed through the NC membrane. The amplified products of FAM / biotin labeled HBV-MCDA and digoxigenin / biotin labeled HCV-MCDA will be specifically captured by anti-FAM immobilized on the first test line (TL1) and anti-digoxigenin on the second test line (TL2), respectively. The remaining detection reagent (streptavidin-AuNPs) was captured by BSA-biotin in the control line (CL), indicating the effectiveness of the biosensor. In this study, agarose gel electrophoresis, real-time turbidity, and visual detection reagent (MG) were also used to analyze the multiplexed MCDA products. However, the first two methods require specific instruments, and the MG method has ambiguity when the concentration of MCDA products is low. In addition, all of the above-mentioned techniques are not sufficient for the simultaneous detection of two target genes in one test. In our study, we combined the cleverly integrated multiplexed MCDA isothermal amplification with the visual AuNPs-LFB diagnostic platform for the first time for the simultaneous identification of HBV and HCV pathogens. In addition, the cost of AuNPs-LFB is low (about $2 per test). Therefore, the total cost per test including nucleic acid extraction (about $0.5), MCDA (about $1.5), and AuNPs-LFB interpretation (about $2) was about $4.

[0044] In summary, we have cleverly combined multiplexed MCDA isothermal amplification with a visual AuNPs-LFB analysis platform to successfully create a novel HBV&HCV-MCDA-AuNPs-LFB assay for simultaneous accurate, sensitive, rapid, economical, and visual identification of HBV and HCV pathogens. Our HBV&HCV-MCDA-AuNPs-LFB assay has a detection limit of 10 copies for HBV and HCV, with no cross-reaction with other pathogens. The entire diagnostic process can be completed within 50 minutes without the need for specific equipment. Therefore, our assay can meet the ASSURED criteria (economical, sensitive, specific, user-friendly, rapid and stable, no equipment required, and deliverable to end users) recommended by the World Health Organization (WHO) for point-of-care testing, and is particularly suitable for use in low- and middle-income areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of primer design in Example 1.

[0046] Figure 2Schematic diagram of the HBV&HCV-MCDA-AuNPs-LFB detection principle of Examples 2 and 3 (A: Schematic diagram of the AuNPs-LFB principle for visual analysis of HBV&HCV-MCDA products: 1 μL of HBV&HCV-MCDA product and 100 μL of running buffer (100 mM PBS, 1% Tween 20, pH 7.4) are simultaneously dripped into the sample pad area of ​​the biosensor; the running buffer containing HBV & HCV-MCDA products moves forward to the binding pad and NC membrane (reaction area) by capillary action, and the deep red dye-labeled streptavidin-coated gold nanoparticles (streptavidin-AuNPs) are rehydrated and combined with the FAM / biotin-labeled HBV-MCDA product or the digoxigenin / biotin-labeled HCV-MCDA product; in the reaction area, the FAM / biotin-labeled HBV-MCDA amplification product is captured by Anti-FAM at TL1, and the digoxigenin / biotin-labeled HCV-MCDA amplification product is captured by Anti-Digoxin at TL2, and the excess dye-coated streptavidin-Au NPs were captured by biotinylated bovine serum albumin (biotin-BSA) in the CL region; HBV positive results were represented by the CL and TL1 bands on the biosensor, HCV positive results were represented by the CL and TL2 bands on the biosensor, and HBV and HCV positive results were represented by the TL1, TL2 and CL bands on the AuNPs-LFB. When only the CL band appeared, it indicated a negative result; B: Workflow of BV&HCV-MCDA-AuNPs-LFB detection: The workflow contains the following closely connected steps: rapid nucleic acid extraction (step 1), MCDA reaction (step 2), and visual reading of AuNPs-LFB (step 3); the entire diagnostic procedure can be completed within 50 min).

[0047] Figure 3 These are the confirmation and detection experimental results of the HBV-, HCV- and HBV&HCV-MCDA products of Example 3 (A: 2% agarose gel electrophoresis; B: visual indicator (MG); C: AuNPs-LFB biosensor; Templates 1 to 14 are HBV-B plasmid, HBV-C plasmid, HBV-D plasmid, HBV-B / C recombinant plasmid, HBV-C / D recombinant plasmid, HCV-1b plasmid, HCV-2a plasmid, HCV-3a plasmid, HCV-3b plasmid, HCV-6a plasmid, HBV&HCV mixed plasmid, hepatitis A virus (HAV), human immunodeficiency virus (HIV); CL: control line, TL1: first detection line, TL2: second detection line).

[0048] Figure 4The results of the system amplification temperature optimization experiment in Example 4 (A: HBV detection by real-time turbidity; B: HCV detection by real-time turbidity; turbidity greater than 0.1 indicates a positive result; 1×10 4 Eight kinetic curves (labeled as a to h) were obtained for the target gene copies. In A, strong amplification effects were shown from graph e (64°C) to graph h (67°C). In B, strong amplification effects were also shown from graph e (64°C) to graph f (65°C).

[0049] Figure 5 Results of sensitivity analysis of the system using serial nucleic acid template dilution in Example 5 (serial dilutions of HBV-S and HCV-5'UTR plasmids were used as templates, while distilled water was used as blank control (BC); the results were analyzed by both visual reagent MG and AuNPs-LFB biosensor; A, B: sensitivity analysis of HBV-MCDA reaction; test tubes A1-A8 (biosensors B1-B8) represent HBV-S plasmids with an amount of 2.0×10 4 Copy, 2.0×10 3 Copy, 2.0×10 2 10 copies, 20 copies, 10 copies, 5 copies, 1 copy and blank control; the detection limit (LoD) of HBV-MCDA detection is 10 copies per reaction; C, D: sensitivity analysis of HCV-MCDA reaction; test tubes C1-C8 (biosensors D1-D8) represent HCV-5'UTR plasmid with a quantity of 2.0×10 4 Copy, 2.0×10 3 Copy, 2.0×10 2 10 copies, 20 copies, 10 copies, 5 copies, 1 copy and blank control; the detection limit (LoD) of HCV-MCDA detection is 10 copies per reaction; E, F: sensitivity analysis of HBV&HCV-MCDA reaction; test tubes E1-E8 (biosensors F1-F8) represent HBV&HCV plasmids with a mass of 2.0×10 4 Copy, 2.0×10 3 Copy, 2.0×10 2 10 copies, 20 copies, 10 copies, 5 copies, 1 copy and blank control; the limit of detection (LoD) of HBV&HCV-MCDA detection is 10 copies per reaction; CL: control line, TL1: first test line, TL2: second test line. ).

[0050] Figure 6The system amplification time optimization experiment results of Example 6 (at the optimal reaction temperature (64°C), different amplification times (A: 25min; B: 30min; C: 35min; D: 40min) were evaluated; biosensors 1-8 represent nucleic acid template amounts of 2.0×10 4 Copy, 2.0×10 3 Copy, 2.0×10 2 copies, 20 copies, 10 copies, 5 copies, 1 copy and blank control (distilled water); the amplified products of HBV&HCV-MCDA were analyzed using AuNPs-LFB biosensor; the detection limit (LoD) reached the optimal value at an amplification time (C) of 35 min; CL: control line; TL1: first test line; TL2: second test line).

[0051] Figure 7 The specific analysis experimental results of the system using different strain samples in Example 7 (MCDA reactions were carried out using different nucleic acid templates, and each amplification product was analyzed by the visual AuNPs-LFB biosensor; biosensors 1-5 represent HBV genotype B plasmid, HBV genotype C plasmid, HBV genotype D plasmid, HBV genotype B / C recombinant plasmid, HBV genotype C / D recombinant plasmid; biosensors 6-10 represent HBV strains (clinical samples); biosensors 11-15 represent HCV subtype 1b plasmid, HCV subtype 2a plasmid, HCV subtype 3b plasmid, HCV subtype 6a plasmid, HCV subtype 3a plasmid, respectively; biosensors 16-20 represent HCV strains (clinical samples); biosensor 21 represents HBV & HCV plasmid mixture; biosensors 22-26 represent H BV & HCV strains (clinical samples); biosensor 27 represents herpes simplex virus; biosensor 28 represents parainfluenza virus; biosensor 29 represents hepatitis A virus (HAV); biosensor 30 represents coxsackievirus CAV16; biosensor 31 represents human enterovirus EV71; biosensor 32 represents influenza A virus; biosensor 33 represents influenza B virus; biosensor 34 represents human papillomavirus (HPV); biosensor 35 represents human immunodeficiency virus (HIV); biosensor 36 represents Mycobacterium leprae; biosensor 37 represents Mycobacterium tuberculosis; biosensor 38 represents Haemophilus influenzae; biosensor 39 represents Cryptococcus neoformans; biosensor 40 represents blank control (distilled water); CL: control line; TL1: first test line; TL2: second test line).

[0052] Figure 8 The results of the amplification efficiency test under different primer combination ratios in Experimental Example 1 are shown.

[0053] Fig. 9 The amplification efficiency test results of different primer combinations in Experimental Example 2 are shown. DETAILED DESCRIPTION

[0054] The following is further described in detail through specific implementation methods:

[0055] Example 1: Samples and primers

[0056] (1) Preparation of target genes and clinical samples

[0057] A total of 97 serum samples from patients suspected of hepatitis B virus (HBV) and / or hepatitis C virus (HCV) infection were collected from the Second Affiliated Hospital of Guizhou University of Traditional Chinese Medicine from May 2023 to February 2024. Nucleic acids were extracted from each sample using the TIANamp Viral DNA / RNA Rapid Kit from Tiangen Biotechnology Co., Ltd. (Beijing, China). Briefly, each 200 μL serum sample was mixed with 20 μL proteinase K, 250 μL lysing agent RLC, and 250 μL isopropanol and incubated at 56°C for 5 min. Subsequently, nucleic acids were enriched in a centrifugal RNase-free adsorption column. After washing with PWT buffer, nucleic acids were eluted with 50 μL RNase-free double-distilled water. The extracted nucleic acids were stored at −80°C for subsequent analysis.

[0058] The full-length S gene sequences of the five HBV genotypes (B, C, D, recombinant B / C, and recombinant C / D) that are dominant in China were downloaded from the GenBank database (the respective GenBank accession numbers are AB014366.1, AB014360.1, AB090268.1, KC774178.1, and AY800249.1). Similarly, the full-length 5'-UTR gene sequences of the five HCV subtypes (1b, 2a, 3a, 3b, and 6a) that are prevalent in China were downloaded (the respective GenBank accession numbers are EU781827.1, HQ639944.1, D17763.1, JQ065709.1, and AY859526.1). Each sequence was cloned and inserted into the pUC57 plasmid after synthesis, and the synthesized plasmid was used as a positive control. The concentration of each plasmid was adjusted to 10 8 copies / mL.

[0059] (2) Design and synthesis of MCDA primers

[0060] Based on the principle of multiple cross-displacement isothermal amplification (MCDA) reaction, MCDA primers for S gene (HBV) and 5'-UTR gene (HCV) were designed. Each MCDA primer set includes two displacement primers (F1 and F2), two cross primers (CP1 and CP2), and six amplification primers (C1, C2, D1, D2, R1 and R2). For details on the information, position and modification of each primer in the HBV and HCV-MCDA primer sets, see Figure 1 and Table 1. All oligonucleotide primers were synthesized and purified by TsingKe Biotechnology Co., Ltd. (Beijing, China) according to HPLC purification grade. MCDA is an efficient isothermal nucleic acid amplification technology that uses multiple pairs of primers for cyclic amplification at a constant temperature to produce a large number of copies of the target sequence in a short time. The design and verification of primers are important steps to ensure the accuracy of detection. Because it is necessary to amplify each subtype of HBV and HCV, the primers designed in this technical solution are degenerate primers. According to the relevant regulations on degenerate primers, generally speaking: R = A / G, Y = C / T, M = A / C, K = G / T, S = C / G, W = A / T, H = A / C / T, B = C / G / T, V = A / C / G, D = A / G / T, N = A / C / G / T. HBV-C1*, whose 5' end is labeled with biotin; HBV-D1*, whose 5' end is labeled with fluoresceinamine (FAM); HCV-C1*, whose 5' end is labeled with biotin; HCV-D1*, whose 5' end is labeled with digoxin, are used for gold nanoparticle-lateral flow chromatography (AuNPs-LFB) detection.

[0061] Table 1: Primer list

[0062]

[0063] Example 2: Lateral Flow Biosensor (LFB) of Gold Nanoparticles (AuNPs)

[0064] like Figure 2The gold nanoparticle-based lateral flow biosensor (AuNPs-LFB) shown in A is made according to the conventional method of the prior art. Briefly, the AuNPs-LFB contains four parts, including a sample pad, a coupling pad, a nitrocellulose (NC) membrane, and a water-absorbing pad, all of which are laminated and packaged on a plastic adhesive backing plate. Streptavidin gold nanoparticles (SA-AuNPs) with scarlet dye coating are assembled on the coupling pad. Among them, the specific information of SA-AuNPs is: size 40±5nm, concentration 10 mg / mL; the solvent uses 100mM borate buffer at pH 8.5 containing 0.1% bovine serum albumin BSA, 0.05% Tween 20 and 10mM ethylenediaminetetraacetic acid; purchased from Bangs Laboratories, Inc., Indiana, USA. Anti-fluorescein (anti-FAM, 0.2 mg / mL, Abcam Co., Ltd.), anti-digoxin (anti-Digoxin, 0.25 mg / mL, Abcam Co., Ltd.) and biotin-labeled bovine serum albumin (biotin-BSA, 4 mg / mL, Abcam Co., Ltd.) were sprayed on the NC membrane to form test line 1 (TL1), test line 2 (TL2) and control line (CL), and the lines were separated by 5 mm. The AuNPs-LFB developed in this study can detect two targets simultaneously. The AuNPs-LFB used in this study was prepared by Tianjin Huidexin Biotechnology Co., Ltd. (Tianjin, China) and stored at room temperature until use.

[0065] The design of the AuNPs-LFB sensor allows it to detect two different targets simultaneously, which is very valuable in clinical diagnosis and point-of-care testing (POCT) applications because it can improve detection efficiency and reduce sample consumption. Streptavidin gold nanoparticles act as signal amplification elements and can generate visible detection signals by binding to biotin or other markers. Anti-fluorescein and anti-digoxigenin antibodies are used to specifically capture target molecules labeled with corresponding tags. The layout and design of the entire sensor ensure accuracy and repeatability during the detection process.

[0066] Example 3: MCDA detection

[0067] To evaluate the feasibility of the two sets of MCDA primers, standard MCDA reactions were performed. Single-step single MCDA reactions were used for HBV or HCV and were performed in a 25 μL volume. Briefly, the reaction mixture included 12.5 μL of 2× reaction buffer (containing 2 M betaine, 16 mM magnesium sulfate, 40 mM potassium chloride, 20 mM ammonium sulfate, 40 mM Tris-HCl (pH 8.8), and 0.2% Tween-20); 3 μL dNTP mix (10 mM); 1 μL Bst 2.0 DNA polymerase (8 U); 1 μL AMV reverse transcriptase (10 U) (for RNA template only); 0.4 μM each of F1 and F2; 1.6 μM each of CP1 and CP2; 0.8 μM each of C1 or C1* (only for AuNPs-LFB), C2, D1 or D1* (only for AuNPs-LFB), D2, R1 and R2; 2μL color indicator (MG) (only for colorimetric method); 1μL standard plasmid template (or 5μL clinical sample template); double distilled water was added to a total volume of 25μL. The reaction was continued at 65℃ for 60min. Amplification of HBV and HCV was performed separately.

[0068] Multiplex MCDA reactions were also performed in a 25 μL mixture. The reaction mixture contained 12.5 μL 2× reaction buffer (same as above); 3 μL dNTP mix (10 mM); 2 μL Bst 2.0 DNA polymerase (8 U); 1 μL AMV reverse transcriptase (10 U) (for RNA template only); 0.2 μM HBV-F1 and HBV-F2, 0.8 μM HBV-CP1 and HBV-CP2, 0.4 μM HBV-C1 or HBV-C1* (for AuNPs-LFB only), HBV-C2, HBV-D1 or HBV-D1* (for AuNPs-LFB only), HBV-D2, HBV-R1, and HBV-R2; 0.4 μM HCV-F1 and HCV-F2, 1.6 μM each HCV-CP1 and HCV-CP2; 0.8 μM HCV-C1 or HCV-C1* (only for AuNPs-LFB), HCV-C2, HCV-D1 or HCV-D1* (only for AuNPs-LFB), HCV-D2, HCV-R1 and HCV-R2; 2 μL color indicator (MG) (only for colorimetric method); 1 μL of standard plasmid template (or 5 μL of clinical sample template); double distilled water was added to a total volume of 25 μL. The reaction lasted for 60 min at 65°C.

[0069] The MCDA reaction products were analyzed by several monitoring methods, including agarose gel electrophoresis, visual detection reagent (MG), real-time turbidity (LA-500, Eiken Chemical Co., Ltd., Japan), and AuNPs-LFB. For agarose gel electrophoresis detection, the appearance of ladder bands indicated a positive result, while the absence of bands indicated a negative result. For visual MG analysis, the reaction mixture turned light green to indicate a positive result, while a colorless mixture indicated a negative result. For turbidity measurement, a real-time turbidity value >0.1 indicated a positive result. For AuNPs-LFB recognition, 1 μL of each MCDA reaction mixture and 100 μL of running buffer (100 mM PBS, 1% Tween 20, pH 7.4) were added to the sample pad at the same time. The sample then flowed along the biosensor by capillary action. Finally, the presence or absence of the target could be detected on the NC membrane (dark red line) within 2 min. The simultaneous appearance of the control line (CL) and test line 1 (TL1) on the AuNPs-LFB strip indicated a positive result for HBV. At the same time, the control line (CL) and test line 2 (TL2) turned red on the biosensor at the same time, indicating a positive result for HCV. For a negative result, only CL appeared on the AuNPs-LFB strip.

[0070] Based on Examples 1-3, the details of AuNPs-LFB analysis of HBV & HCV-MCDA amplification products are as follows Figure 2 As shown in A. 1 μL of multiplex MCDA product and 100 μL of running buffer were simultaneously dropped onto the sample pad area of ​​the biosensor ( Figure 2 A①). The running buffer containing multiple MCDA products moves along the biosensor by capillary migration. Deep red dye-coated streptavidin gold nanoparticles (SA-AuNPs) are rehydrated with the running buffer and then bind to the FAM / biotin-labeled HBV-MCDA and digoxigenin / biotin-labeled HCV-MCDA amplification products in the coupling pad area of ​​the biosensor ( Figure 2 A-②). On the nitrocellulose membrane (detection area), the FAM / biotin-labeled HBV-MCDA and digoxigenin / biotin-labeled HCV-MCDA amplification products were specifically captured by the anti-FAM immobilized on the first test line (TL1) and the immobilized anti-digoxigenin on the second test line (TL2), and the remaining detection reagent (SA-AuNPs) was captured in the control line (CL), indicating the effectiveness of AuNPs-LFB ( Figure 2 A-③). The interpretation of multiple MCDA results obtained using AuNPs-LFB is shown in Figure 2A-④. When both CL and TL1 turn red, a positive result for HBV is obtained. When both CL and TL2 turn red at the same time, a positive result for HCV is obtained. When CL, TL1, and TL2 turn red at the same time, both HBV and HCV are positive. When only CL turns red, a negative result is obtained.

[0071] The workflow of HBV&HCV-MCDA-AuNPs-LFB detection is as follows Figure 2 B. Briefly, nucleic acids were rapidly extracted from serum samples using a DNA / RNA rapid kit, a process that was completed within 10 min (step 1). Then, the multiplex MCDA reaction was performed at a constant temperature (64 °C) for 35 min (step 2). Here, FAM was attached to the HBV-MCDA primer set, while digoxigenin was added to the HCV-MCDA primer set. Thus, the HBV-D1 and HBV-C1 primers were labeled with FAM and biotin at the 5' end, while the HCV-D1 and HCV-C1 primers were labeled with digoxigenin and biotin, respectively. After activation of Bst 2.0 DNA polymerase, the HBV-MCDA amplification products were simultaneously labeled with FAM and biotin, while the HCV-MCDA amplification products were labeled with digoxigenin and biotin (step 2). The labeled multiplex MCDA amplification products were visualized and analyzed using the AuNPs-LFB platform (step 3).

[0072] To confirm the feasibility of two sets of MCDA primers in the multiplex MCDA reaction system, five standard HBV-S plasmids (genotype B, C, D, recombinant B / C, recombinant C / D), five standard HCV-5′UTR plasmids (subtype 1b, 2a, 3b, 6a, and 3a), and viral RNA of hepatitis A virus (HAV) and human immunodeficiency virus (HIV) were used as templates. The MCDA assay was performed at a fixed temperature of 65°C for 60 min, and distilled water was used as a blank control (BC). Agarose gel electrophoresis, color indicator (MG), and AuNPs-LFB analysis methods were used to interpret the results of the multiplex MCDA. According to each analysis method, nucleic acids from HBV and / or HCV plasmid templates were amplified and produced positive results ( Figure 3 AC). Importantly, the AuNPs-LFB method used in this study is able to detect two targets (HBV and HCV) simultaneously in one test ( Figure 3 C). No amplification was detected for the negative controls (HAV and HIV) or blank controls (DW). Figure 3 ). These findings confirmed that the two MCDA primer sets for HBV and HCV detection were suitable for the development of HBV&HCV-MCDA-AuNPs-LFB assays.

[0073] Example 4: Optimization of system reaction temperature

[0074] Reaction temperature is crucial to improve the efficiency of multiple crossover site amplification (MCDA). In this study, we tested the optimal reaction temperature of the experiments by performing HBV-MCDA and HCV-MCDA in the range of 63 to 70 °C at 1 °C intervals under standard MCDA reaction conditions. 1 × 10 4 The HBV and HCV standard plasmids were used as templates. The reaction results were tracked by real-time turbidity monitoring. In addition, the optimal reaction time range of multiple MCDA was determined to be 25 to 40 min with an interval of 5 min at the optimal reaction temperature. The amplification products of MCDA were analyzed using gold nanoparticle-lateral flow immunochromatography (AuNPs-LFB) detection, and each test was independently repeated three times.

[0075] To confirm the optimal temperature for HBV- and HCV-MCDA assays, HBV- and HCV-MCDA reactions were regulated in the temperature range of 63 to 70°C at 1°C intervals. Standard plasmids (HBV-S and HCV-5'UTR) were used as templates at a concentration of 1.0 × 10 4 The HBV-MCDA and HCV-MCDA reactions were monitored by real-time turbidity meter, and the kinetic curves corresponding to different temperatures were plotted ( Figure 4 A and B). At 64 to 66°C ( Figure 4 A) and 64 to 65°C ( Figure 4 B), strong HBV-MCDA and HCV-MCDA reactions were observed, respectively. Therefore, 64°C was identified as the most suitable amplification temperature for the HBV&HCV-MCDA-AuNPs-LFB system.

[0076] Example 5: System Sensitivity

[0077] Plasmid templates including HBV-S plasmid and HCV-5'UTR plasmid were serially diluted 10-fold, ranging from 2.0 × 10 per test. 4 The copies were reduced to 1 copy to determine the limit of detection (LoD) of HBV&HCV-MCDA detection. These tests were performed under the optimal reaction conditions, the amplified products were analyzed using AuNPs-LFB, and distilled water was used as a blank control (BC). Each test was repeated at least three times.

[0078] Serial dilutions of HBV-S plasmid and HCV-5'UTR plasmid were used as templates to verify the limit of detection (LoD) of the multiplex MCDA-AuNPs-LFB assay. The MCDA assay was performed at 64°C for 1 h, and the amplification products were subsequently analyzed using AuNPs-LFB and MG reagents. Figure 5As shown in A to F, the detection limit of MCDA-AuNPs-LFB assay for HBV-S ( Figure 5 A and B) and HCV-5'UTR ( Figure 5 C and D) The plasmids were 10 copies per test. The sensitivity of multiplex MCDA-AuNPs-LFB was consistent with that of single HBV-AuNPs-LFB and HCV-AuNPs-LFB detection ( Figure 5 E and F), and the results obtained using the AuNPs-LFB method ( Figure 5 B, D and F) compared with the results obtained using MG reagent ( Figure 5 A, C, and E). Notably, the multiplexed MCDA-AuNPs-LFB platform was able to detect both HBV and HCV pathogens in a single reaction.

[0079] Example 6: Optimization of detection reaction time

[0080] The optimal reaction time for the amplification phase of the multiplex MCDA-AuNPs-LFB assay was confirmed by using HBV-S plasmid and HCV-5'UTR plasmid at the detection limit level (10 copies each). All tests were performed at the optimal reaction temperature (64°C) and the results were analyzed using AuNPs-LFB. Figure 6 As shown in Figure 2, the detection limits of the two plasmid templates can be accurately identified within an incubation time of 35 min. Therefore, the optimal amplification conditions for our HBV&HCV-MCDA-AuNPs-LFB detection were determined to be 64 °C for 35 min.

[0081] Example 7: System specificity and selectivity

[0082] The specificity and selectivity of the multiplex MCDA-AuNPs-LFB assay were validated by using five HBV-S plasmids (genotypes B, C, D, recombinant B / C, and recombinant C / D), five HCV-5′UTR plasmid templates (HCV subtypes 1b, 2a, 3b, 6a, and 3a), HBV / HCV-positive clinical samples (confirmed by real-time PCR), and other pathogens including herpes simplex virus, parainfluenza virus, hepatitis A virus (HAV), coxsackievirus CAV16, human enterovirus EV71, influenza A virus, influenza B virus, human papillomavirus (HPV), human immunodeficiency virus (HIV), Mycobacterium leprae, Mycobacterium tuberculosis, Haemophilus influenzae, Cryptococcus neoformans, and their mixtures (Table 2). All microbial nucleic acid templates used in this study were isolated using a bacterial genomic DNA extraction kit or a viral DNA / RNA extraction kit (Xi'an Tianlong Technology Co., Ltd.; Xi'an, China), and their concentration and purity were determined by NanoDrop ND-2000 (Beijing, China) at A260 / 280 wavelength. The assays were performed using the same multiplex MCDA primer set under the optimal reaction conditions. All amplification products were detected using the AuNPs-LFB assay, and distilled water was used as a blank control (BC). Each test was independently performed three times on different days.

[0083] Table 2: Template information (ATCC stands for American Type Culture Collection; 2 nd GZUTCM refers to the Second Affiliated Hospital of Guizhou University of Traditional Chinese Medicine; GZCCL is the abbreviation of Guizhou Clinical Laboratory Center; and GZCDC stands for Guizhou Center for Disease Control and Prevention; P stands for positive; N stands for negative)

[0084]

[0085]

[0086] The specificity and selectivity of our assay were validated using HBV-S plasmid, HCV-5'UTR plasmid, HBV and / or HCV positive clinical samples (confirmed by qPCR), 13 other pathogens and their mixtures (Table 2). The HBV&HCV-MCDA-AuNPs-LFB assay was performed under optimal reaction conditions (64°C for 35 min) and the results were analyzed using the AuNPs-LFB assay. Figure 7As shown in Table 2, our test has 100% specificity for the recognition of HBV and HCV. The results of positive HBV and HCV are manifested by the appearance of three red lines on the biosensor (control line CL, test line 1 TL1, and test line 2 TL2). Positive HBV strains cause the CL and TL1 bands on the biosensor to turn red, while positive HCV strains cause the CL and TL2 bands to turn red. The results of other pathogens and blank controls were negative, and no cross-reactions were observed in this study. These data indicate that our HBV&HCV-MCDA-AuNPs-LFB test exhibits high specificity.

[0087] Example 8: Feasibility of the system on clinical samples

[0088] To demonstrate the feasibility of the multiplex MCDA-AuNPs-LFB assay in clinical practice, we used 97 serum samples from patients suspected of HBV and / or HCV infection. Nucleic acids were rapidly extracted using the TIANamp Viral DNA / RNA Rapid Kit (Beijing Tiangen Biochemical Technology Co., Ltd.; Beijing, China) according to the manufacturer's instructions. These templates were then tested simultaneously using a commercially available real-time TaqMan PCR kit (Xi'an Tianlong Technology Co., Ltd., Xi'an, China) and our HBV&HCV-MCDA-AuNPs-LFB assay. The experiments were independently repeated three times. According to the manufacturer's recommendations, HBV more than 5 IU (approximately 30 copies) and HCV more than 50 IU (approximately 45 copies) were considered positive results. We compared the results of the HBV&HCV-MCDA-AuNPs-LFB assay with those of the real-time PCR method.

[0089] To validate the applicability of the multiplex MCDA-AuNPs-LFB assay as a valuable tool for HBV and HCV identification, a total of 97 serum samples were tested simultaneously using our assay and real-time PCR assay. The results showed that 42 serum samples (42 / 97) were HBV positive, 27 samples (27 / 97) were HCV positive, 12 samples (12 / 97) were diagnosed as HBV and HCV co-infection, and 16 samples (16 / 97) were HBV / HCV negative according to the real-time PCR test results. All HBV / HCV positive and negative samples were confirmed using our assay (Table 3). In the current study, the positivity rates of HBV&HCV-MCDA-AuNPs-LFB and real-time PCR were consistent. These data suggest that our assay can be used as a powerful tool for the identification of HBV and HCV infection in clinical settings.

[0090] Table 3: Clinical sample test results

[0091]

[0092] Experimental Example 1: Primer Ratio Study

[0093] After screening and obtaining primer combinations for two target genes, the inventors tried to place the two sets of primers in a unified reaction system for MCDA amplification. Initially, it was found that the compatibility of the two sets of primers in Table 1 was not ideal when the conventional 1:1 mixing method was used, and the amplification efficiency of HCV was particularly low. The inventors explored the reasons for the above phenomenon in great detail, from the aspects of amplification temperature, enzyme dosage, primer concentration, etc., and found that adjustments on these technical points could not solve the problem of inconsistent amplification efficiency of the two sets of primers (which would make it difficult to detect the target gene). Through a large number of experimental attempts, it was finally found that the concentration ratio of the two sets of primers was the key to affecting the overall amplification efficiency. In Example 3, the primer amounts used for the HBV S gene are: 0.2 μM HBV-F1 and HBV-F2, 0.8 μM HBV-CP1 and HBV-CP2, 0.4 μM HBV-C1 or HBV-C1* (only for AuNPs-LFB), HBV-C2, HBV-D1 or HBV-D1* (only for AuNPs-LFB), HBV-D2, HBV-R1 and HBV-R2; the primer amounts used for the HCV 5'UTR gene are: 0.4 μM HCV-F1 and HCV-F2, 1.6 μM HCV-CP1 and HCV-CP2, 0.8 μM each. HCV-C1 or HCV-C1* (only for AuNPs-LFB), HCV-C2, HCV-D1 or HCV-D1* (only for AuNPs-LFB), HCV-D2, HCV-R1 and HCV-R2. The ratio of the concentration of each primer of HBV S gene to the concentration of each primer of HCV 5'UTR gene is 1:2. With the above primer ratio design, the amplification efficiency of the two target genes in the mixed system is basically the same, thereby ensuring the effective detection of the target genes. For the detection images under different primer ratios, please refer to Figure 8 (The turbidity detector uses the Judgment mode), the amplification conditions refer to Example 3, and the results show that the HBV-MCDA primer concentration: HCV-MCDA primer concentration = 1:2 is more suitable for this detection system. If a 1:1 ratio is used, the amplification efficiency of HCV is too low. If a 1:3 ratio is used, the amplification efficiency of HCV is still not high. Only under the condition of 1:2, the amplification efficiency of HCV will show a significant improvement and remain consistent with the amplification efficiency of HBV. The use of a primer concentration ratio of 1:2 ensures the efficient amplification of the two target genes, thereby ensuring the detection effect.

[0094] Experimental Example 2: Primer Screening

[0095] In order to screen out MCDA primers with higher amplification efficiency, several sets of HBV-MCDA and HCV-MCDA primers were designed respectively, and amplification reactions were carried out under standard reaction systems. Two sets of HBV-MCDA and three sets of HCV-MCDA primers are listed for comparative explanation, see Table 4-8 for details, and the amplification conditions refer to Example 3. Real-time turbidity detection is performed simultaneously with amplification, and the turbidity detector uses the Judgment mode, which mainly examines the amplification efficiency. Precipitation will be produced during the amplification process, for example, magnesium pyrophosphate (dNTP participates in the reaction, loses pyrophosphate, and pyrophosphate combines with magnesium ions in the amplification system to produce precipitation, and magnesium ions are necessary for the activity of DNA polymerase), so turbidity can be used to characterize the degree of amplification, which is a common method in this technical field. The amplification efficiency of different primer combinations is as follows. Fig. 9 According to the amplification efficiency of each primer, two sets of primers, HBV-MCDA-2 and HCV-MCDA-3, were selected as the basis for the subsequent research and development of HBV & HCV-MCDA-AuNPs-LFB diagnostic technology.

[0096] Although there are general rules for the design of MCDA primer combinations, due to the large number of primers contained in the primer combination and the complex situation, even if it is designed according to the rules, the amplification effect is often not ideal. In addition, this technical solution needs to detect multiple subtypes such as HBV genotypes (B, C, D, B / C recombinants and C / D recombinants), HCV subtypes (1b, 2a, 3b, 6a and 3a), and it is necessary to design degenerate primers according to the gene specificity of these different subtypes. The complexity and difficulty of primer design are further improved. How to ensure the amplification efficiency of the primer combination, how to avoid the poor amplification efficiency caused by the introduction of degenerate primers, and the incompatibility of the two sets of primers are problems that the inventors need to solve independently, and there is no prior art to refer to. The candidate primer combinations used in this scheme are all designed according to basic rules, but in terms of amplification efficiency, they show very significant differences. In particular, the difficulty of primer design for HBV is particularly large, and only one primer combination is found to quickly reach a turbidity of more than 0.5. The turbidity of HBV-MCDA-1 is less than 0.4 after about 40 minutes, and the amplification efficiency is very unsatisfactory. In addition to HBV-MCDA-1 and HBV-MCDA-2, the inventors also tried to design other primer combinations, but the amplification effect was far lower than that of HBV-MCDA-1. After amplification for more than 40 minutes, the turbidity was difficult to reach about 0.3. However, with HBV-MCDA-2, it only takes 30 minutes for the turbidity of the amplification system to reach a level of 0.5-0.6. It can be seen that the use of the primer combination in Table 1 of this scheme (i.e., HBV-MCDA-2) has achieved unexpected technical effects and laid the foundation for the successful development of this detection scheme.

[0097] The turbidity of HCV-MCDA-1 was slightly higher than 0.4 at around 30 minutes; the turbidity of HCV-MCDA-2 was still lower than 0.4 at around 60 minutes; the turbidity of HCV-MCDA-3 was 0.5-0.6 at around 30 minutes. It can be seen that the HCV-MCDA-3 primer combination has a great advantage in amplification efficiency compared with other primer combinations.

[0098] Table 4: The first set of HBV-MCDA-1 primers

[0099] name Primer sequence (5'→3') HBV-F1-1 TGTACMAAACCTWCGGACGG HBV-F2-1 GMGGYAWAAAGGGACTCAAG HBV-CP1-1 TGAGGCCCACTCCCATAGGWAT-YTGCACYTGTATTCCCATCC HBV-CP2-1 TCAGTGGTTCGTAGGGCTTTCC-CCCCCAATACCACATCATCC HBV-C1-1 TGAGGCCCACTCCCATAGGWAT HBV-C2-1 TCAGTGGTTCGTAGGGCTTTCC HBV-D1-1 SCGAAAGCCCARGATGAT HBV-D2-1 ACTGTBTGGCTTTCAGTTA HBV-R1-1 AGCCARGAGAAACGGRC HBV-R2-1 AGTTTACTAGTGCCATTTG

[0100] Table 5: The second set of HBV-MCDA-2 primers (used in this scheme, see Table 1)

[0101]

[0102]

[0103] Table 6: The first set of HCV-MCDA-1 primers

[0104] name Primer sequence (5'→3') HCV-F1-1 CGYCTAGCCATGGCGTTAG HCV-F2-1 CCCTATCAGGCAGTACCACA HCV-CP1-1 CGGTTCCGCAGAYCACTATGG-YGAGTGTCGTRCAGCCT HCV-CP2-1 TTGGANMAACCCRCTCWATGCC-TTTCGCRACCCAACRCTAC HCV-C1-1 CGGTTCCGCAGAYCACTATGG HCV-C2-1 TTGGANMAACCCRCTCWATGCC HCV-D1-1 TCTCCCGGGAGGGGGGGKCCT HCV-D2-1 CGCRAGAYYRCTAGCCGA HCV-R1-1 CRATTCCGGTGTACTCA HCV-R2-1 YRGGRHGACYGGGTCCTT

[0105] Table 7: Second set of HCV-MCDA-2 primers

[0106] name Primer sequence (5'→3') HCV-F1-2 GTGTCGTRCAGCCTCCA HCV-F2-2 CASGGTCTACGAGACCTCC HCV-CP1-2 CCRGTCDYCCYRGCRATTCC-CGGGAGAGCCATAGTRGTC HCV-CP2-2 CCGCRAGAYYRCTAGCCGA-CACCCTATCAGGCAGTACCA HCV-C1-2 CCRGTCDYCCYRGCRATTCC HCV-C2-2 CCGCRAGAYYRCTAGCCGA HCV-D1-2 TGTACTCACCGGTTCCG HCV-D2-2 AGYGTTGGGTYGCGAAAG HCV-R1-2 GYGGGTTKNTCCAAGAAAGGA HCV-R2-2 ATRCCYRGMVATTTGGGC

[0107] Table 8: The third set of HCV-MCDA-3 primers (used in this scheme, see Table 1)

[0108]

[0109]

[0110] The above is only an embodiment of the present invention, and the common knowledge such as the known specific structure and characteristics in the scheme is not described in detail here. It should be pointed out that for those skilled in the art, several deformations and improvements can be made without departing from the structure of the present invention, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor, characterized by: It comprises a multiple cross-displacement isothermal amplification unit and a detection unit; the multiple cross-displacement isothermal amplification unit is used to simultaneously perform multiple cross-displacement isothermal amplification on the S gene of the hepatitis B virus and the 5'UTR gene of the hepatitis C virus in the same reaction system; the hepatitis B virus comprises at least one of subtype B, subtype C, subtype D, recombinant B / C subtype and recombinant C / D subtype; the hepatitis C virus comprises at least one of subtype 1b, subtype 2a, subtype 3a, subtype 3b and subtype 6a.

2. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 1, characterized in that: The primer combination for multiple cross-replacement isothermal amplification of the S gene of hepatitis B virus is as follows: HBV-F1: 5′-TGTACMAAACCTWCGGACGG-3′; HBV-F2: 5′-GMGGYAWAAAGGGACTCAAG-3′; HBV-CP1: 5′-TGAGGCCCACTCCCATAGGWAT-YTGCACYTGTATTCCCATCC-3′; HBV-CP2: 5′-GTGGTTCGTAGGGCTTTCCCC-KACAGACTTGGCCCCCAA-3′; HBV-C1: 5′-TGAGGCCCACTCCCATAGGWAT-3′; HBV-C2: 5′-GTGGTTCGTAGGGCTTTCCCC-3′; HBV-D1: 5′-SCGAAAGCCCARGATGAT-3′; HBV-D2: 5′-TBTGGCTTTCAGTTATAT-3′; HBV-R1: 5′-CTGAGCCARGAGAAACGGR-3′; HBV-R2: 5′-TACTAGTGCCATTTGTTC-3′; The primer combination for multiple cross-replacement isothermal amplification of the 5'UTR gene of hepatitis C virus is as follows: HCV-F1: 5′-TGTCGTRCAGCCTCCAG-3′; HCV-F2: 5′-GGTCTACGAGACCTCCCG-3′; HCV-CP1: 5′-AAGAAAGGACCCRGTCDYCCYR-AGCCATAGTRGTCTGCGGA-3′; HCV-CP2: 5′-CCGCRAGAYYRCTAGCCGA-GCACCCTATCAGGCAGTACC-3′; HCV-C1: 5′-AAGAAAGGACCCRGTCDYCCYR-3′; HCV-C2: 5′-CCGCRAGAYYRCTAGCCGA-3′; HCV-D1: 5′-CRATTCCGGTGTACTCA-3′; HCV-D2: 5′-AGYGTTGGGTYGCGAAAGGC-3′; HCV-R1: 5′-YATWGAGYGGGTTKNTC-3′; HCV-R2: 5′-CYRGMVATTTGGGCGTGC-3′; Among them, the 5′ end of HBV-C1 can be modified with the first marker molecule or not; the 5′ end of HBV-D1 can be modified with the second marker molecule or not; the 5′ end of HCV-C1 can be modified with the first marker molecule or not; the 5′ end of HCV-D1 can be modified with the third marker molecule or not.

3. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 2, characterized in that: The concentration ratio of HBV-F1 and HCV-F1, HBV-F2 and HCV-F2, HBV-CP1 and HCV-CP1, HBV-CP2 and HCV-CP2, HBV-C1 and HCV-C1, HBV-C2 and HCV-C2, HBV-D1 and HCV-D1, HBV-D2 and HCV-D2, HBV-R1 and HCV-R1, and HBV-R2 and HCV-R1 is 1:

2.

4. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 3, characterized in that: The first labeling molecule is biotin, the second labeling molecule is carboxyfluorescein, and the third labeling molecule is digoxigenin.

5. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 4, characterized in that: The multiple cross-displacement constant temperature amplification unit also includes Bst 2.0 DNA polymerase, dNTP mixture and buffer.

6. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 5, characterized in that: The working temperature of the multiple cross-displacement constant temperature amplification unit is 64° C., and the working time of the multiple cross-displacement constant temperature amplification unit is 35 minutes.

7. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 6, characterized in that: The detection limit of the system is 10 copies / reaction.

8. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 1, characterized in that: The detection unit is a lateral flow biosensor based on gold nanoparticles; the lateral flow biosensor based on gold nanoparticles comprises a sample pad, a binding pad, a nitrocellulose membrane and a water absorbent pad which are fixed on a back plate in sequence; a test line 1, a test line 2 and a quality control line are arranged on the nitrocellulose membrane.

9. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 8, characterized in that: Carboxyfluorescein antibody, digoxigenin antibody and biotinylated bovine serum albumin are fixed on the test line 1, the test line 2 and the quality control line respectively.

10. A detection system for simultaneous detection of HBV and HCV based on multiple cross-replacement isothermal amplification and nano-biosensor according to claim 9, characterized in that: The conjugate pad contains streptavidin-coated gold nanoparticles coupled to a deep red dye.

Images