Preparation method and application of vinasse polysaccharide with life benefiting property

Abstract

The invention belongs to the technical field of health drinks, and particularly relates to a preparation method and application of vinasse polysaccharide with beneficial activity. The vinasse polysaccharide consists of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose and fucose; the molar ratio of the 2, 3, 4-trimethyl-1, 3-pentanediol to the 2, 3, 4-trimethyl-1, 3-pentanediol to the 2, 3, 4-trimethyl-1, 3-pentanediol to the 2, 3, 4-trimethyl-1, 3-pentanediol to the 2, the preparation method comprises the following steps: (1) drying, crushing and sieving the vinasse to obtain vinasse powder; (2) mixing the vinasse powder obtained in the step (1) with distilled water in proportion, extracting in a water bath, centrifuging, taking supernatant, concentrating, and performing rotary evaporation to obtain a polysaccharide extracting solution; and (3) carrying out alcohol precipitation, deproteinization, dialysis and freeze drying on the polysaccharide extracting solution obtained in the step (2) to obtain the vinasse polysaccharide. The vinasse polysaccharide with the life-benefiting activity, prepared by the invention, can regulate intestinal flora and has health-care and health-preserving effects.

Description

Technical Field

[0001] The invention relates to the technical field of health drinks, and in particular to a preparation method and application of distiller's grains polysaccharide with beneficial life properties. Technical Background

[0002] The human large intestine carries an extremely large and complex microbial ecosystem, including more than 1,000 microorganisms such as bacteria, fungi and protozoa. These bacteria account for the majority of the total intestinal microorganisms, but about 80% of intestinal bacteria are difficult to culture by traditional methods, and most of their functions have not yet been revealed. The intestinal microbiota plays a key role in maintaining a variety of physiological functions of the human body, including inflammatory response, immune function and energy balance. Accordingly, adjusting the composition of intestinal microorganisms is considered to be one of the effective means to promote intestinal health. More and more studies have shown that through the interaction between dietary polysaccharides and intestinal microorganisms, various physiological functions of the host can be effectively regulated and improved, thereby blocking the invasion of pathogenic microorganisms and maintaining the health of the host.

[0003] As one of the main by-products of the brewing industry, distiller's grains have a huge annual output. In China alone, the annual output of distiller's grains exceeds 100 million tons. The main components of distiller's grains include cellulose, hemicellulose, lignin, polysaccharides, proteins, lipids and minerals, which have high nutritional value and biological activity. Through modern biotechnology, these high value-added bioactive substances can be extracted and applied to significantly improve the economic value of distiller's grains. With the increasing living standards of people, topics such as health, safety and health care have attracted much attention. Oral liquid has the advantages of small dosage, high content of active ingredients and convenient administration, and is becoming more and more popular among people.

[0004] For example, Chinese patent CN110637957A discloses a distiller's grain protein compound beverage and its preparation method, which mainly solves the problem that the nutrient composition of the distiller's grain protein compound beverage produced by the prior art is not rich enough, and precipitation is produced after being placed for a period of time, which is not suitable for long-term storage; the distiller's grain protein compound beverage is made of soybean distiller's grain protein, skim milk powder, honey, xanthan gum, sodium bicarbonate, sodium citrate, β-carotene, sodium alginate and pure water, wherein the preparation method of soybean distiller's grain protein is: drying and crushing soybean distiller's grain powder, adding pure water to obtain soybean distiller's grain stock solution, adding soybean lecithin to the soybean distiller's grain stock solution to emulsify and obtain soybean protein extract, centrifugation and drying by centrifuge to obtain soybean distiller's grain protein, the soybean distiller's grain protein contains rich protein, the solution is light yellow, the milk fragrance is sufficient, the sweet and sour taste is moderate, the solution is delicate and uniform, no precipitation is produced, and the shelf life is greatly improved. However, the regulation of intestinal microbial flora by this invention is still unknown.

[0005] For example, Chinese patent CN117343979A discloses a highland barley lees antioxidant peptide beverage and its preparation method, which relates to the field of functional food processing technology. The highland barley lees antioxidant peptide beverage described in the invention includes highland barley lees antioxidant peptides, honey, citric acid, rose and vanilla extract; the preparation of the highland barley lees antioxidant peptides includes: pre-treating highland barley lees with ultrasound and microwave, obtaining highland barley lees protein by alkali dissolution and acid precipitation, and obtaining the highland barley lees antioxidant peptides by alkaline protease enzymolysis. The invention can increase the voids of highland barley lees and improve the extraction efficiency of protein through the synergistic treatment of ultrasound and microwave; the highland barley lees protein can improve the hydrolysis degree and DPPH clearance rate through enzymolysis. The invention can significantly improve the color and flavor of highland barley lees antioxidant peptides by compounding them with honey, citric acid, rose and vanilla extract, and obtain a highland barley lees peptide beverage that is highly nutritious and easily accepted by the public. However, the application also has the above-mentioned problems.

[0006] Therefore, there is an urgent need to develop a distiller's grains polysaccharide oral liquid that has health-care effects and a regulatory effect on intestinal flora. Summary of the invention

[0007] Based on the problems existing in the prior art, the present invention provides a distiller's grains polysaccharide oral liquid with beneficial life properties and a preparation method thereof. The present invention makes full use of distiller's grains and prepares them into oral liquid, which significantly improves the economic value and bioavailability of distiller's grains, and the distiller's grains polysaccharide oral liquid provided by the present invention has a good regulating effect on intestinal flora.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] First, the present invention provides a distiller's grains polysaccharide with beneficial life properties, characterized in that the distiller's grains polysaccharide is composed of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose and fucose; and the molar ratio thereof is: 3.280:0.229:0.268:1.365:0.783:81.879:3.284:4.104:4.687:0.120.

[0010] The present invention also provides a method for preparing the above-mentioned distiller's grains polysaccharide having beneficial activity, comprising the following steps:

[0011] (1) drying, crushing and sieving the vinasse to obtain vinasse powder;

[0012] (2) mixing the vinasse powder obtained in step (1) and distilled water in proportion, extracting in a water bath, centrifuging, taking the supernatant, concentrating, and rotary evaporating to obtain a polysaccharide extract;

[0013] (3) The polysaccharide extract obtained in step (2) is subjected to alcohol precipitation, deproteinization, dialysis, and freeze-drying to obtain the vinasse polysaccharide.

[0014] Preferably, the drying temperature in step (1) is 50-60° C., and the product is dried to a constant weight.

[0015] Preferably, the solid-liquid ratio of the vinasse powder and distilled water in step (2) is 1:10-30.

[0016] Preferably, the water bath extraction in step (2) is carried out at a temperature of 70-80°C and for a time of 2-4 hours.

[0017] Preferably, the centrifugal conditions in step (2) are 5000-8000 r / min, and the centrifugal time is 5-15 min.

[0018] Preferably, the temperature of the rotary evaporation in step (2) is 50-60° C., and the rotary evaporation is concentrated to 1 / 10 of the total volume.

[0019] Preferably, the volume ratio of the polysaccharide extract to edible alcohol (100%) in the alcohol precipitation of step (3) is 1:4, and the mixture is allowed to stand overnight in a refrigerator at 4°C for precipitation.

[0020] Preferably, the deproteinization in step (3) uses Sevag reagent (chloroform: n-butanol = 4:1), and the ratio of Sevag reagent to polysaccharide extract is 4:1.

[0021] Preferably, the dialysis bag used in the dialysis in step (3) is 3500Da, the dialysis temperature is 4-10°C, and the dialysis time is 48-72h.

[0022] The present application also provides an application of distiller's grains polysaccharide with beneficial activity in the preparation of a pharmaceutical preparation for regulating intestinal flora.

[0023] Preferably, the dosage form of the drug includes but is not limited to: capsules, granules, tablets, oral liquid or pills.

[0024] The present application also provides a distiller's grains polysaccharide oral liquid with beneficial life properties, characterized in that the distiller's grains polysaccharide oral liquid comprises the following raw materials: distiller's grains polysaccharide, edible flavor, honey and citric acid.

[0025] Preferably, the vinasse polysaccharide oral liquid comprises the following raw materials by mass fraction: vinasse polysaccharide 2%-5%, honey 1.5%-2.5%, edible flavor 0.3%-0.8%, and citric acid 0.06%-0.1%.

[0026] More preferably, the vinasse polysaccharide oral liquid comprises the following raw materials by mass fraction: vinasse polysaccharide 3%-4%, honey 1.5%-2%, edible flavor 0.4%-0.6%, and citric acid 0.06%-0.08%.

[0027] Further preferably, the vinasse polysaccharide oral liquid comprises the following raw materials by mass fraction: 3% vinasse polysaccharide, 2% honey, 0.5% edible flavor, and 0.08% citric acid.

[0028] In addition, the present application also provides a method for preparing a distiller's grains polysaccharide oral liquid having beneficial life properties, comprising the following steps:

[0029] (1) Mixing: Weigh distiller's grains polysaccharide, honey, edible flavor, and citric acid, add purified water, stir thoroughly to dissolve, and mix evenly to form a mixed solution;

[0030] (2) Centrifugation: centrifuging the mixed solution of step (1) to obtain a supernatant which is the vinasse polysaccharide oral solution;

[0031] (3) sterilizing the vinasse polysaccharide oral liquid obtained in step (2) and then canning it to obtain a finished vinasse polysaccharide oral liquid.

[0032] Preferably, the mass ratio of the vinasse polysaccharide, honey, edible flavor and citric acid in step (1) is: 2-5: 1.5-2.5: 0.3-0.8: 0.06-0.1;

[0033] More preferably, the mass ratio of the vinasse polysaccharide, honey, edible flavor and citric acid in step (1) is: 3-4: 1.5-2: 0.4-0.6: 0.06-0.08;

[0034] More preferably, the mass ratio of the distiller's grains polysaccharide, honey, edible flavor and citric acid in step (1) is 3:2:0.5:0.08.

[0035] Preferably, the centrifugation condition in step (2) is 1000-2000 r / min, and the centrifugation time is 5-10 min.

[0036] Preferably, the sterilization conditions in step (3) are as follows: filtering with a sterile 0.22 μm filter membrane, packaging in a brown bottle, sealing, and sterilizing at 120-125° C. for 15-20 min. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings generally illustrate various embodiments by way of example and not limitation, and together with the description and claims, serve to illustrate embodiments of the invention. When appropriate, the same reference numerals are used throughout the drawings to refer to the same or similar parts. Such embodiments are illustrative and are not intended to be exhaustive or exclusive embodiments of the present apparatus or method.

[0038] Figure 1 The vinasse polysaccharide map provided in Example 1;

[0039] Figure 2 is the molecular weight distribution diagram of vinasse polysaccharides;

[0040] Figure 3 This is the monosaccharide composition distribution diagram of distiller's grains polysaccharides;

[0041] Figure 4 This is the infrared spectrum of vinasse polysaccharide;

[0042] Figure 5 The morphology and elemental composition of distiller's grains polysaccharides;

[0043] Figure 6 is the microbial rarefaction curve of distiller's grains polysaccharide after fermentation by intestinal microorganisms;

[0044] Figure 7 This is the PCA analysis diagram of the microbial composition of distiller's grains polysaccharides after intestinal microbial fermentation;

[0045] Figure 8 This is the relative abundance diagram of microorganisms at the phylum level after vinasse polysaccharides were fermented by intestinal microorganisms;

[0046] Fig. 9 This is the relative abundance diagram of microorganisms at the genus level after vinasse polysaccharide was fermented by intestinal microorganisms;

[0047] Fig.10 The PCA analysis diagram of the metabolites of distiller's grains polysaccharide after fermentation by intestinal flora and the metabolites of the blank control group;

[0048] Fig.11 It is a volcano plot of the differential metabolites of distiller's grains polysaccharides after fermentation by intestinal flora and the blank control group;

[0049] Fig.12 KEGG bubble diagram of differential metabolic function analysis of distiller's grains polysaccharides after fermentation by intestinal flora and blank control group;

[0050] Fig.13 The sensory profile diagram of the vinasse polysaccharide oral liquid provided for the application examples and comparative examples.

[0051] Specific implementation content

[0052] The present invention is further described below in conjunction with the embodiments, but the invention is not limited in any way. Any changes or substitutions made based on the teachings of the present invention belong to the protection scope of the present invention.

[0053] Example 1 Preparation of vinasse polysaccharide

[0054] After drying the lees to a constant weight at 60°C, crush and sieve, take 50g of the lees powder, add 500mL of distilled water and extract in a water bath at 80°C for 2h, then centrifuge the extract at 5000r / min for 10min, take the supernatant, extract the residue again, and then concentrate and evaporation at 55°C to make the supernatant of the two extractions 1 / 10 of the total volume. Add 4 times the volume of anhydrous ethanol to the crude extract, precipitate at 4°C overnight for 24h, collect the precipitate and dissolve it in distilled water. Add 1 / 4 of Sevag reagent (chloroform: n-butanol = 4:1) to the crude polysaccharide solution, mix evenly at room temperature, and then centrifuge at 12000r / min for 10min, take the top layer of solution, and repeat the deproteinization several times until there is no intermediate protein layer. The crude polysaccharide solution is dialyzed and freeze-dried to obtain lees polysaccharide (JZP), such as Figure 1 shown.

[0055] Example 2 Preparation of vinasse polysaccharide

[0056] After drying the lees to a constant weight at 60°C, crush and sieve, take 50g of the lees powder, add 1500mL of distilled water and extract in a water bath at 80°C for 4h, then centrifuge the extract at 8000r / min for 15min, take the supernatant, extract the residue once again, and then concentrate and evaporate at 55°C to make the supernatant of the two extractions 1 / 10 of the total volume. Add 4 times the volume of anhydrous ethanol to the crude extract, precipitate at 4°C overnight for 24h, collect the precipitate and dissolve it in distilled water. Add 1 / 4 of Sevag reagent (chloroform: n-butanol = 4:1) to the crude polysaccharide solution, mix evenly at room temperature, and then centrifuge at 12000r / min for 10min, take the top layer of solution, and repeat the deproteinization several times until there is no intermediate protein layer. The crude polysaccharide solution is dialyzed and freeze-dried to obtain lees polysaccharide.

[0057] Example 3 Characterization of vinasse polysaccharides

[0058] (1) Determination of molecular weight

[0059] The average molecular weight was determined by high performance gel permeation chromatography (HPGPC), equipped with TSKgel GMPWXL aqueous gel chromatography column of TOSOH, Japan, LC 20AT high performance liquid chromatography pump of Shimadzu, Japan, Rheodyne7725i manual six-way valve injector (quantitative loop 20 microliters) of the United States and RID-20 refractive index detector of Shimadzu, Japan. T series dextran standards with molecular weights of 5.20, 11.60, 23.80, 48.60, 148.00, 273.00, 410.00 and 668.00 kDa were used for calibration. The mobile phase was 0.1 mol / L NaNO3 and 0.05% NaN3 added to pure water, the mobile phase flow rate was 0.6 mL / min, and the column temperature was 35 ° C. The standard curve was relatively corrected by Mark-Houwink parameters, and the results were processed by Shimadzu Lab Solutions GPC V5.93 software.

[0060] (2) Determination of monosaccharide composition

[0061] The monosaccharide composition determination of JZP includes the following steps: 2 mg of the lees polysaccharide prepared in Example 1 is hydrolyzed in 1 mL of 2 mol / L trifluoroacetic acid at 110°C for 90 min, and then evaporated to dryness on a rotary evaporator. The hydrolyzate of the polysaccharide or the monosaccharide mixed standard solution is added with 2 mL of double distilled water, 60 mg of sodium borohydride is reduced for 8 hours, glacial acetic acid is added for neutralization, rotary evaporation, and then dried in an oven at 101°C, and then 1 mL of acetic anhydride is added for acetylation reaction at 100°C for 1 hour, cooled, and then 3 mL of toluene is added, concentrated and evaporated to dryness under reduced pressure, and this step is repeated 4-5 times to remove excess acetic anhydride. The acetylated product is dissolved in 3 mL of chloroform and transferred to a separatory funnel, and a small amount of distilled water is added to fully shake, and the upper aqueous solution is removed, and this is repeated 4 times. The chloroform layer is dried with an appropriate amount of anhydrous sodium sulfate, fixed to 10 mL, and the acetylated product sample is analyzed using a Shimadzu GCMS-QP 2010 gas chromatograph-mass spectrometer.

[0062] GC-MS conditions: RXI-5SIL MS column 30m×0.25mm×0.25mm; programmed temperature conditions: starting temperature 120℃, heating at 3℃ / min to 250℃ / min, maintaining for 5min; injection port temperature 250℃, detector temperature 250℃ / min, carrier gas helium, flow rate 1mL / min.

[0063] (3) Determination of infrared spectrum

[0064] The FT-IR spectrum of the vinasse polysaccharide prepared in Example 1 was recorded using an infrared spectrometer (Nicolet IS10 FT-IR) with a scanning range of 4000-400 cm -1The spectrometer resolution is 4 cm -1 , the signal-to-noise ratio (S / N) is 50000: 1. Before measurement, the sample was ground with KBr powder and scanned according to the KBr pellet method.

[0065] (4) Morphology characterization and particle size analysis

[0066] The surface morphology of the vinasse polysaccharide prepared in Example 1 was observed by scanning electron microscopy (SEM). Before scanning, the dried polysaccharide was sputter-coated with a thin layer of gold and then observed by a scanning electron microscope system, and the elemental composition of JZP was detected by an EX-250 system.

[0067] (5) Results analysis

[0068] Molecular weight determination results

[0069] Natural polysaccharides usually show a wide range of molecular weight distributions, and different molecular weights affect the properties of polysaccharides such as solution viscosity and biological activity. In this study, we used HPGPC to determine the molecular weight of JZP prepared in Example 1 and Example 2. The molecular weight distribution chromatogram is as follows: Figure 2 As shown, JZP has only one component in the figure, indicating that JZP has a single polysaccharide component and its Mw is 9666Da.

[0070] Determination results of monosaccharide composition

[0071] The types and molar ratios of monosaccharides in polysaccharides often have an important influence on the biological activity of polysaccharides. Therefore, the determination of monosaccharide composition is an extremely important part of the structural analysis of polysaccharides. Figure 3 The chromatogram of the monosaccharide composition of JZP was displayed, and the results showed that JZP was mainly composed of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose, and fucose, with proportions of 3.280, 0.229, 0.268, 1.365, 0.783, 81.879, 3.284, 4.104, 4.687, and 0.120, respectively.

[0072] Infrared spectrum measurement results

[0073] As a commonly used analytical method for the identification of the primary structure of polysaccharides, FT-IR can be used to analyze the glycosidic bond type, functional group type, sugar ring configuration, etc. of polysaccharides. The FT-IR spectrum of JZP shows characteristic peaks of various polysaccharides, such as Figure 4 As shown in the figure, due to the OH stretching vibration of the hydroxyl group in the polysaccharide, at 3348.67 cm -1 A strong and broad absorption peak was observed. 2914.87cm -1 The JZP absorption peak at 1645.20 cm represents the CH symmetric stretching vibration. Both absorption peaks are characteristic of polysaccharides.-1 and 1424.34cm -1 The band at 1246.67cm resulted in the stretching vibration of CO and the bending vibration of CH, indicating that JZP contained uronic acid. This finding is consistent with the results of the monosaccharide composition of JZP. -1 -1041.94cm -1 The absorption of is stronger, indicating that COC comes from the stretching vibration of the pyranose ring.

[0074] Topography analysis

[0075] SEM is considered a powerful tool to elucidate the surface morphology of polymers and predict their physical properties. Figure 5 As shown in the figure, the microstructure of JZP shows a lamellar smooth structure and a porous state under 50 times and 500 times magnification.

[0076] Example 4 Determination of the beneficial activity of vinasse polysaccharides

[0077] (1) Extraction of bacterial DNA and 16S rRNA sequence analysis

[0078] Before DNA extraction, the JZP prepared in Example 1 was stored in a -80°C refrigerator. The fermentation broth was centrifuged, the supernatant was discarded, and the Soil DNA Kit was used to extract DNA and the procedure was followed. Agarose gel electrophoresis was used to detect the purity and concentration of DNA. The extracted DNA was amplified and sequenced in the 16S rRNA V3-V4 region with primers 338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT. Sequencing was performed using Illumina's MiseqPE300 / NovaSeq PE250 platform (Shanghai Meiji Biopharmaceutical Technology Co., Ltd.). UPARSE software was used to cluster the sequences into OTUs based on a similarity of 97%, and all data analysis was performed on the Meiji Biocloud platform.

[0079] Table 1

[0080] Primers Serial Number Sequence (5'-3') 338F SEQ ID NO.1 ACTCCTACGGGAGGCAGCAG 806R SEQ ID NO.2 GGACTACHVGGGTWTCTAAT

[0081] (2) Determination of metabolites in fermentation broth

[0082] Metabolites in fecal fermentation were determined by LC-MS. The supernatant of vinasse polysaccharide fermented by intestinal flora for 24 h was extracted. Blank control group: The method was the same as that of the group without vinasse polysaccharide (BLK). 250 μL of each extract was mixed with 750 μL of acetonitrile, shaken well, centrifuged at 4°C, 13000 rpm for 10 min, and the supernatant was taken for LC-MS analysis. The chromatographic conditions were: Waters UPLC BEH C18 column (100×2.1mm, 1.7μm), temperature 40°C; 0.1% formic acid water and 0.1% formic acid acetonitrile as mobile phase; flow rate 0.3mL / min; injection volume 5.0μL. Data were obtained in positive and negative ion modes.

[0083] (3) Data analysis

[0084] The mothur software was used to calculate the Chao1 and Shannon index of Alpha diversity, and the Wilxocon rank sum test was used to analyze the intergroup differences in Alpha diversity. PCoA analysis (principal coordinate analysis) based on the bray-curtis distance algorithm was used to test the similarity of the microbial community structure between samples, and the PERMANOVA nonparametric test was combined to analyze whether the difference in microbial community structure between sample groups was significant. Progenesis QI software (Nonlinear Dynamics, Durham, NC, USA) was used to align and extract the data. The peak deconvolution used the default settings of QI. The data were further analyzed using R software. The data exported by QI software were further analyzed and screened, and the peaks were identified using the R program package and HMDB database. For biological replicates, the method of combining the difference fold, the p value of the student's t test, and the VIP value was used to screen the differential metabolites. The differential metabolites obtained by the positive and negative ion mode analysis were merged and then the KEGG pathway enrichment analysis was performed.

[0085] (4) Results analysis

[0086] Effects of distiller's grains polysaccharides on microbial diversity

[0087] The effect of JZP on intestinal flora was determined by in vitro fermentation experiments. After 24 h of fermentation, the flora was analyzed by 16S rRNA, and the metabolites in fecal fermentation were determined by LC-MS.

[0088] Rarefaction curve (also called rarefaction curve) is generally used in microbial research to evaluate the saturation of sequencing or sample volume. If the sample sequencing depth increases but the curve no longer rises significantly (to be precise, the slope of the curve is smooth and the change is small), it is considered that the sequencing volume is sufficient, and if the sequencing volume is increased, the alpha diversity index of the sample will not change significantly, that is, the sample alpha diversity index has reached stability. Figure 6 As shown in the figure, the curve tends to be flat, indicating that the sequencing depth has basically covered all the microbial communities in the sample, and increasing the sequencing data cannot find more OUTs. The sequencing data is accurate and reliable.

[0089] Alpha diversity is an important component of microbial diversity analysis. It refers to the diversity within a specific area or ecosystem and is a comprehensive indicator of richness and evenness. Species diversity is not only reflected in the number of biological species (richness), but also in the evenness of the distribution of these biological species in a specific environment (diversity). From the perspective of richness, Chao1 Index and ACE Index are two main measurement tools. Chao1 Index focuses on assessing the number of rare species in an ecosystem, while ACE Index provides a more accurate estimate of the total number of species in an ecosystem by weighted calculation of rare populations. Regarding the evenness of species distribution in a community, Shannon Index and Simpson Index are commonly used indicators to measure community diversity. Shannon Index takes into account the relative abundance of species and can provide a broad overview of community diversity, while Simpson Index focuses more on the dominance or concentration of species. The higher the Simpson Index value, the scarcer the biodiversity. As shown in Table 2, Chao, Shannon, and Ace of JZP were significantly higher than those of BLK (p < 0.05), indicating that the addition of JZP significantly increased the richness and diversity of intestinal flora.

[0090] In addition, PCA in beta diversity analysis based on Bray-Curtis clustering tree (such as Figure 7 As shown in Figure 3, the intestinal flora characteristics of BLK and JZP were significantly separated, indicating that JZP significantly changed the composition of the intestinal flora.

[0091] Table 2 Alpha diversity of samples among different groups

[0092]

[0093] (a represents a significant value p<0.001, b represents a significant value 0.001≤p<0.01, and c represents a significant value 0.01≤p<0.05)

[0094] Effects of distiller's grains polysaccharides on microbial composition

[0095] Changes in the intestinal microbiota between the JZP and BLK groups at the phylum level Figure 8 As shown in the figure, Proteobacteria and Firmicutes were the dominant phyla in the BLK group, while Proteobacteria, Firmicutes, Bacteroidota, and Actinobacteriota were the dominant phyla in JZP. It is worth noting that the relative abundance of Proteobacteria was significantly reduced in JZP compared with BLK. Proteobacteria includes a variety of pathogens. In general, an increase in its relative abundance can cause intestinal flora imbalance, low-grade inflammation, and even chronic colitis. In addition, the relative abundance of Bacteroidota, Fusobacteriota, and Firmicutes was significantly increased in JZP compared with BLK. Bacteroidota is present in the distal colon and is one of the main intestinal flora responsible for polysaccharide degradation, which helps reduce systemic inflammation, improve the recovery rate of tissue structure, and restore the intestinal microbiota. It can enzymatically hydrolyze indigestible polysaccharides and produce short-chain fatty acids; Firmicutes can also produce short-chain fatty acids by degrading dietary fiber; Fusobacteriota has a relatively high abundance, which may be because Fusobacteriota prefers to use carbon sources to maintain growth. Our study shows that JZP supplementation selectively stimulates the growth of intestinal microbiota.

[0096] To further identify specific genera that metabolize JZP, we analyzed the abundance of the top 30 bacterial genera. Fig. 9As shown in the figure, after 24 hours of fermentation in a basic carbon-free medium, Shigella was the main pathogen, which is the main cause of diarrhea in young children and can cause developmental delay in young children. Compared with the BLK group, the Shigella in the JZP group was significantly reduced. In addition, the beneficial bacteria Phascolarctobacterium, Enterococcus, Bacteroides, Bifidobacterium, and Blautia increased significantly. Phascolarctobacterium can prevent Clostridium difficile infection and maintain intestinal health; according to previous studies, Enterococcus is widely used as a probiotic, and it has a strong bactericidal effect on enteroaggregative Escherichia coli, including inducing abrasion damage and cell lysis; Bacteroides can degrade polysaccharides by encoding many carbohydrate-active enzymes. Previous studies have reported that Bacteroides can enhance host immunity and maintain intestinal ecological balance; Blautia is a recently discovered bacterial genus that has attracted much attention for its contribution to the relief of inflammatory and metabolic diseases and its antibacterial activity against specific microorganisms; Bifidobacterium promotes the absorption of iron and vitamin D and improves the utilization of phosphorus, iron, and calcium; Bifidobacterium can decompose α-casein through phosphoprotein phosphatase and promote protein absorption. In summary, JZP regulates intestinal flora by increasing the relative abundance of beneficial bacterial genera and reducing the relative abundance of harmful bacterial genera.

[0097] Principal component analysis

[0098] Principal component analysis (PCA) is a multidimensional data statistical analysis method for unsupervised pattern recognition. It reflects the information of the original variables and generally reflects the variability between and within the sample groups, that is, the distribution and separation trend of the two groups of samples. PCA was used to explore the changes in in vitro fermentation metabolites between the groups after JZP treatment. PCA analysis was performed on each group. Fig.10 As shown in the figure, after JZP treatment, the polysaccharide group and the blank group showed a significant separation trend, indicating that polysaccharides changed the metabolism of intestinal microbiota.

[0099] Different metabolites between groups

[0100] For biological replicates, we combined the difference fold, the p-value of the student's t-test, and the VIP value to screen for differential metabolites. First, we obtained the differential metabolites between the two groups through univariate analysis. The volcano plot can quickly view the difference in the expression level of metabolites in the two groups. The threshold of the volcano plot is set to p<0.05 and the absolute value of log2FC>1 to screen some key metabolites. Fig.11 As shown in the figure, it is a volcano plot of each difference comparison group. Each point in the figure represents a metabolite. The red points in the figure represent up-regulated differentially expressed metabolites, the green points represent down-regulated differentially expressed metabolites, and the gray points represent metabolites that were detected but not significantly different. Under the above method, a total of 552 differential metabolites were screened, of which JZP significantly up-regulated 422 differential metabolites and significantly down-regulated 130 differential metabolites.

[0101] KEGG enrichment pathway analysis

[0102] Different metabolites in organisms work together to exert their biological functions. Therefore, KEGG pathway analysis will provide a deeper understanding of its biological functions. Based on the UPLC LTQ-Orbitrap MS / MS platform, metabolite enrichment analysis was performed on the differential metabolism of KEGG pathways. Fig.12 It can be seen that under the mediation of JZP, the metabolism of cysteine ​​and methionine, the metabolism of alanine, aspartic acid and glutamate, and the digestion and absorption of carbohydrates have been greatly affected. Therefore, based on the above facts, JZP can affect some important metabolic pathways and have a positive impact on host health.

[0103] Application Example 1-3 Preparation method of a distiller's grains polysaccharide oral liquid with beneficial life properties

[0104] Application Example 1 Application Example 2 Application Example 3 Distillers grains polysaccharide 2mg 3mg 5mg Honey 1.5mg 2mg 2.5mg Food flavors 0.3mg 0.5mg 0.8mg Citric Acid 0.06mg 0.08mg 0.1mg

[0105] Application Comparative Example 1 Preparation method of a distiller's grains polysaccharide oral liquid with beneficial life properties

[0106]

[0107]

[0108] The preparation method of the vinasse polysaccharide oral liquid comprises the following steps:

[0109] (1) Mixing: Weigh the distiller's grains polysaccharide, honey, edible flavor and citric acid in the above application examples 1-3 respectively, add 100 mL of water, stir thoroughly to dissolve, and mix evenly to form a mixed solution;

[0110] (2) Centrifugation: The mixed solution of step (1) is centrifuged at 2000 r / min for 5 min, and the obtained supernatant is the vinasse polysaccharide oral solution;

[0111] (3) The vinasse polysaccharide oral liquid obtained in step (2) is filtered through a sterile 0.22 μm filter membrane and placed in a brown bottle, which is sealed and sterilized at 121° C. for 15 min before canning to obtain a finished vinasse polysaccharide oral liquid.

[0112] Effect experiment

[0113] 1. Evaluation of the dosage of each component of vinasse polysaccharide oral solution

[0114] 15 portions of the vinasse polysaccharide oral liquid prepared in the above-mentioned application examples 1-3 and comparative example 1 were accurately measured, each with 10 mL, and according to the oral liquid scoring criteria in Table 3, 5 people in the laboratory were randomly selected to score and the average value was calculated as the comprehensive taste score.

[0115] Table 3 Oral liquid sensory scoring details

[0116] project Quality requirements Scoring Options Impurities No visible foreign matter 5，4，3，2，1 Color clarify 5，4，3，2，1 taste Harmonious and soft taste 5，4，3，2，1

[0117] The clarity and taste scores of the vinasse polysaccharide solutions after adding honey of different qualities were tested. The results are shown in Table 4. The clarity of the vinasse polysaccharide solutions at different honey addition amounts was slightly different. Among them, the solution obtained by adding honey in Example 2 was visually clear, had a harmonious and soft taste, and had the highest score, which was significantly higher than that of Comparative Example 1.

[0118] Table 4 Sour grains polysaccharide solution after adding different qualities of honey

[0119] Application Example 1 Application Example 2 Application Example 3 Application Comparative Example 1 Clarity clarify clarify clarify clarify Taste score 4 5 4 3.2

[0120] The clarity and taste scores of the distiller's grains polysaccharide solutions after adding citric acid of different masses were tested. The results are shown in Table 5, among which the taste of Application Example 2 was the best, and the taste of the Application Examples was better than that of Comparative Example 1.

[0121] Table 5 The situation of vinasse polysaccharide solution after adding honey of different qualities

[0122]

[0123]

[0124] 2. Quality rating and sensory evaluation of vinasse polysaccharide oral liquid

[0125] (1) Oral liquid form

[0126] The oral liquid of distiller's grains polysaccharide is a clear liquid with no foreign smell. Its clarity is determined by visual inspection.

[0127] (2) Detection of relative density and pH of oral solution

[0128] Take three groups of vinasse polysaccharide oral liquids prepared in Example 2, first weigh 10 mL, then weigh 10 mL of water; the pH value thereof is measured using an acidity meter, and each group of samples is tested three times.

[0129] The relative density of vinasse polysaccharide oral liquid is 1.102; the average pH is 6.03.

[0130] (3) Sensory evaluation

[0131] Five evaluators with food expertise and good sensory acuity were trained and selected to form an evaluation group. The sensory evaluation of the vinasse polysaccharide oral liquid prepared in Example 2 was conducted based on color, aroma, taste and state. The scoring criteria are shown in Table 6.

[0132] Table 6 Sensory evaluation of vinasse polysaccharide oral liquid

[0133]

[0134] After evaluation, the color of distiller's grains polysaccharide scored 7.8 points, the aroma scored 7 points, the taste scored 6.8 points, and the state scored 8.2 points. Fig.13 shown.

[0135] The above results indicate that the vinasse polysaccharide prepared by the present invention has good biological activity, and the oral liquid using it as the main functional formula has a good state, elegant flavor, and strong mouth feel, and the oral liquid has broad application prospects.

Claims

1. A distiller's grains polysaccharide with beneficial life properties, characterized in that: The vinasse polysaccharide is composed of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose and fucose; the molar ratio thereof is: 3.280:0.229:0.268:1.365:0.783:81.879:3.284:4.104:4.687:0.

120.

2. The method for preparing vinasse polysaccharide according to claim 1, characterized in that: The steps include: (1) drying, crushing and sieving the vinasse to obtain vinasse powder; (2) mixing the vinasse powder obtained in step (1) and distilled water in proportion, extracting in a water bath, centrifuging, taking the supernatant, concentrating, and rotary evaporating to obtain a polysaccharide extract; (3) The polysaccharide extract obtained in step (2) is subjected to alcohol precipitation, deproteinization, dialysis, and freeze-drying to obtain the vinasse polysaccharide.

3. The preparation method according to claim 2, characterized in that: The solid-liquid ratio of the vinasse powder and distilled water in step (2) is 1:10-30; the temperature of the water bath extraction is 70°C-80°C, and the time is 2-4h; the centrifugal condition is 5000-8000r / min, and the centrifugal time is 5-15min; the temperature of the rotary evaporation is 50°C-60°C, and the rotary evaporation is concentrated to 1 / 10 of the total volume.

4. The preparation method according to claim 2, characterized in that: In the alcohol precipitation of step (3), the volume ratio of the polysaccharide extract to edible alcohol is 1:4, and the mixture is allowed to stand overnight in a refrigerator at 4°C for precipitation; the deproteinization is carried out using Sevag reagent, and the ratio of the Sevag reagent to the polysaccharide extract is 4:1; the dialysis bag used in the dialysis is 3500Da, the dialysis temperature is 4-10°C, and the dialysis time is 48-72h.

5. Use of the vinasse polysaccharide according to claim 1 or the vinasse polysaccharide prepared by the preparation method according to any one of claims 1 to 4 in the preparation of a preparation for regulating intestinal flora.

6. The use according to claim 5, characterized in that: The preparation dosage form is capsule, granule, tablet, oral liquid or pill.

7. An oral liquid containing distiller's grains polysaccharide having beneficial life properties, characterized in that: The method comprises the following raw materials: the vinasse polysaccharide according to claim 1 or the vinasse polysaccharide prepared by the preparation method according to any one of claims 1 to 4, honey, edible flavor and citric acid.

8. The oral solution of vinasse polysaccharide according to claim 7, characterized in that: The raw materials are as follows, calculated by mass fraction: 2%-5% of the vinasse polysaccharide according to claim 1 or the vinasse polysaccharide prepared by the preparation method according to any one of claims 1 to 4, 1.5%-2.5% of honey, 0.3%-0.8% of edible flavoring, and 0.06%-0.1% of citric acid.

9. The method for preparing the oral solution of vinasse polysaccharide according to claim 7 or 8, characterized in that: The following steps are involved: (1) Mixing: Weigh distiller's grains polysaccharide, honey, edible flavor, and citric acid, add purified water, stir thoroughly to dissolve, and mix evenly to form a mixed solution; (2) Centrifugation: centrifuging the mixed solution of step (1) to obtain a supernatant which is the vinasse polysaccharide oral solution; (3) sterilizing the vinasse polysaccharide oral liquid obtained in step (2) and then canning it to obtain a finished vinasse polysaccharide oral liquid.

10. The preparation method according to claim 9, characterized in that: The centrifugation conditions in step (2) are 1000-2000 r / min and the centrifugation time is 5-10 min. The sterilization conditions in step (3) are aseptic 0.22 μm filter membrane filtration followed by packaging in a brown bottle, sealing, and sterilization at 120-125° C. for 15-20 min.

Images