Preparation method and application of distiller's grains polysaccharide with beneficial biological activity
By preparing oral liquor of lees polysaccharides, the shortcomings of existing lees beverages in regulating intestinal microbial flora are solved, effective regulation of intestinal flora and enriching nutrients, and the economic value and bioavailability of lees are improved.
Patent Information
- Application Number
- CN202411443650.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-16
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-10-16
AI Technical Summary
The existing wine lee protein compound beverages and highland wine lee antioxidant peptide beverages are insufficient in regulating intestinal microbial flora, and there is a problem that the nutrient composition is not rich enough and prone to precipitation.
Prepare a lees polysaccharide oral solution. By mixing the lees powder with distilled water, extracting the lees powder in water bath, concentrating the centrifugal concentration, alcohol precipitation, deprotein and dialysis, the lees polysaccharide is obtained, and honey, edible flavor and citric acid are added to make capsules, granules, tablets, oral solution or pills to regulate the intestinal bacterial flora.
The oral solution of lees polysaccharides significantly regulates the intestinal flora, increases the relative abundance of beneficial bacteria, reduces the relative abundance of harmful bacteria, improves intestinal health, and improves economic value and bioavailability.
Smart Images

Figure CN119320461B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of health care beverages, and particularly to a preparation method and application of distiller's grains polysaccharide with beneficial biological activities. Technical Background
[0002] The human large intestine harbors an extremely large and complex microbial ecosystem, including more than 1,000 microorganisms such as bacteria, fungi, and protozoa. These bacteria account for the majority of the total intestinal microorganisms, but about 80% of the intestinal bacteria are difficult to culture by traditional methods, and their functions have mostly not been revealed. The gut microbiota plays a key role in maintaining various physiological functions of the human body, including inflammatory responses, immune functions, and energy balance. Accordingly, adjusting the composition of the gut microbiota is considered one of the effective means to promote intestinal health. More and more studies have shown that through the interaction between dietary polysaccharides and gut microbiota, various physiological functions of the host can be effectively regulated and improved, thereby blocking the invasion of pathogenic microorganisms and maintaining the healthy state of the host.
[0003] As one of the main by-products of the brewing industry, the annual output of distiller's grains is huge. Only in China, the annual output of distiller's grains exceeds 100 million tons. The main components of distiller's grains include cellulose, hemicellulose, lignin, polysaccharides, proteins, lipids, and minerals, etc., which have high nutritional value and biological activities. By means of modern biotechnology, extracting and applying these bioactive substances with high added value can significantly improve the economic value of distiller's grains. With the increasing living standards of people, topics such as healthy, safe, and health care foods have attracted much attention. Oral liquids are becoming more and more popular because of their small dosage, high content of active ingredients, and convenient administration.
[0004] For example, Chinese Patent CN110637957A discloses a distiller's grains protein compound beverage and its preparation method, which mainly solves the problems that the nutrient composition of the distiller's grains protein compound beverage produced by the prior art is not rich enough, and there is precipitation after standing for a period of time, and it is not suitable for long-term storage. The distiller's grains protein compound beverage is made of soybean distiller's grains protein, skimmed milk powder, honey, xanthan gum, sodium bicarbonate, sodium citrate, β-carotene, sodium alginate, and purified water. The preparation method of the soybean distiller's grains protein is as follows: drying and pulverizing soybean distiller's grains powder, adding purified water to obtain soybean distiller's grains stock solution, adding soybean phospholipid to the soybean distiller's grains stock solution for emulsification to obtain soybean protein extract, and centrifuging and extracting and drying with a centrifuge to obtain soybean distiller's grains protein. The soybean distiller's grains protein contains rich proteins, the solution is light yellow, has sufficient milk fragrance, is moderately sweet and sour, the solution is delicate and uniform, without precipitation, and the shelf life is greatly improved. However, the regulation of the gut microbiota by this invention is unknown.
[0005] For another example, Chinese Patent CN117343979A discloses a hulless barley distillers' grains antioxidant peptide beverage and its preparation method, which relates to the technical field of functional food processing. The hulless barley distillers' grains antioxidant peptide beverage described in this invention includes hulless barley distillers' grains antioxidant peptide, honey, citric acid, rose flowers, and vanilla essence; the preparation of the hulless barley distillers' grains antioxidant peptide includes: after ultrasonic and microwave pretreatment of hulless barley distillers' grains, alkaline protease hydrolysis is used to obtain hulless barley distillers' grains protein, and through alkaline protease enzymolysis, the hulless barley distillers' grains antioxidant peptide is obtained. Through the synergistic treatment of ultrasound and microwave in this invention, the voids of hulless barley distillers' grains can be increased, and the extraction efficiency of protein can be improved; the hydrolysis degree and DPPH scavenging rate of hulless barley distillers' grains protein can be improved through enzymolysis. By compounding hulless barley distillers' grains antioxidant peptide with honey, citric acid, rose flowers, and vanilla essence in this invention, the color and flavor of hulless barley distillers' grains antioxidant peptide can be significantly improved, and a highly nutritious and easily acceptable hulless barley distillers' grains polypeptide beverage can be obtained. However, this application also has the above problems.
[0006] Therefore, there is an urgent need to study a distillers' grains polysaccharide oral liquid with health care and health preservation effects and a regulatory effect on the intestinal flora. Summary of the Invention
[0007] Based on the problems existing in the prior art, the present invention provides a distillers' grains polysaccharide oral liquid with probiotic activity and its preparation method. The present invention makes full use of distillers' grains, prepares them into oral liquid, significantly improves the economic value and bioavailability of distillers' grains, and the distillers' grains polysaccharide oral liquid provided by the present invention has a good regulatory effect on the intestinal flora.
[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0009] First of all, the present invention provides a distillers' grains polysaccharide with probiotic activity, characterized in that: the distillers' grains polysaccharide is composed of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose, and fucose; its molar ratio is: 3.280:0.229:0.268:1.365:0.783:81.879:3.284:4.104:4.687:0.120.
[0010] The present invention also provides a preparation method of the above-mentioned distillers' grains polysaccharide with probiotic activity, including the following steps:
[0011] (1) Dry the distillers' grains, break them, and sieve them to obtain distillers' grains powder;
[0012] (2) Mix the distillers' grains powder obtained in step (1) and distilled water in proportion, extract by water bath, centrifuge, take the supernatant and concentrate, and rotary evaporate to obtain a polysaccharide extract;
[0013] (3) After subjecting the polysaccharide extract obtained in step (2) to alcohol precipitation, protein removal, dialysis, and freeze-drying, the said distiller's grains polysaccharide is obtained.
[0014] Preferably, in step (1), the drying temperature is 50 - 60 °C and drying is carried out until a constant weight is reached.
[0015] Preferably, in step (2), the ratio of the distiller's grains powder to distilled water in the material-liquid ratio is 1:10 - 30.
[0016] Preferably, in step (2), the temperature of the water bath extraction is 70 - 80 °C and the time is 2 - 4 h.
[0017] Preferably, in step (2), the centrifugation conditions are 5000 - 8000 r / min and the centrifugation time is 5 - 15 min.
[0018] Preferably, in step (2), the temperature of the rotary evaporation is 50 - 60 °C and the volume is concentrated to 1 / 10 of the total volume.
[0019] Preferably, in step (3), the volume ratio of the polysaccharide extract to edible alcohol (100%) in the alcohol precipitation is 1:4, and it is left to stand overnight for precipitation in a 4 °C refrigerator.
[0020] Preferably, in step (3), the protein removal uses Sevag reagent (chloroform: n-butanol = 4:1), and the ratio of the Sevag reagent to the polysaccharide extract is 4:1.
[0021] Preferably, in step (3), the dialysis bag used for dialysis is 3500 Da, the dialysis temperature is 4 - 10 °C, and the dialysis time is 48 - 72 h.
[0022] This application also provides an application of a distiller's grains polysaccharide with probiotic activity in the preparation of a pharmaceutical preparation for regulating intestinal flora.
[0023] Preferably, the dosage form of the drug includes but is not limited to: capsules, granules, tablets, oral liquids, or pills.
[0024] This application also provides an oral liquid of a distiller's grains polysaccharide with probiotic activity, characterized in that: the oral liquid of the distiller's grains polysaccharide includes the following raw materials: distiller's grains polysaccharide, edible essence, honey, and citric acid.
[0025] Preferably, the oral liquid of the distiller's grains polysaccharide, calculated by mass fraction, includes the following raw materials: distiller's grains polysaccharide 2% - 5%, honey 1.5% - 2.5%, edible essence 0.3% - 0.8%, and citric acid 0.06% - 0.1%.
[0026] More preferably, the distillers' grains polysaccharide oral liquid comprises the following raw materials by mass fraction: 3%-4% of distillers' grains polysaccharide, 1.5%-2% of honey, 0.4%-0.6% of edible essence, and 0.06%-0.08% of citric acid.
[0027] Even more preferably, the distillers' grains polysaccharide oral liquid comprises the following raw materials by mass fraction: 3% of distillers' grains polysaccharide, 2% of honey, 0.5% of edible essence, and 0.08% of citric acid.
[0028] In addition, the present application also provides a preparation method of a distillers' grains polysaccharide oral liquid with probiotic activity, comprising the following steps:
[0029] (1) Mixing: Weigh distillers' grains polysaccharide, honey, edible essence, and citric acid, add purified water, stir and dissolve thoroughly, and form a mixed solution after mixing evenly;
[0030] (2) Centrifuging: Centrifuge the mixed solution in step (1), and the supernatant obtained is the distillers' grains polysaccharide oral liquid;
[0031] (3) Sterilize the distillers' grains polysaccharide oral liquid obtained in step (2) and then carry out canning to obtain the finished distillers' grains polysaccharide oral liquid.
[0032] Preferably, the mass ratio of the distillers' grains polysaccharide, honey, edible essence, and citric acid in step (1) is: 2-5:1.5-2.5:0.3-0.8:0.06-0.1;
[0033] More preferably, the mass ratio of the distillers' grains polysaccharide, honey, edible essence, and citric acid in step (1) is: 3-4:1.5-2:0.4-0.6:0.06-0.08;
[0034] Even more preferably, the mass ratio of the distillers' grains polysaccharide, honey, edible essence, and citric acid in step (1) is: 3:2:0.5:0.08.
[0035] Preferably, the conditions for centrifuging in step (2) are 1000-2000 r / min, and the centrifugation time is 5-10 min.
[0036] Preferably, the conditions for sterilization in step (3) are filtering with a sterile 0.22 μm filter membrane, then filling into a brown bottle, sealing, and sterilizing at 120-125 °C for 15-20 min. Description of the Drawings
[0037] The accompanying drawings illustrate various embodiments by way of example rather than limitation, and together with the description and claims are used to explain the embodiments of the invention. Where appropriate, the same reference numerals are used throughout the drawings to refer to the same or similar parts. Such embodiments are illustrative and are not intended to be an exhaustive or exclusive embodiment of the device or method.
[0038] Figure 1 Graph of distillers' grains polysaccharide provided for Example 1;
[0039] Figure 2 Molecular weight distribution graph of distillers' grains polysaccharide;
[0040] Figure 3 Monosaccharide composition distribution graph of distillers' grains polysaccharide;
[0041] Figure 4 Infrared spectrum graph of distillers' grains polysaccharide;
[0042] Figure 5 Morphology image and elemental composition graph of distillers' grains polysaccharide;
[0043] Figure 6 Microbial rarefaction curve after fermentation of distillers' grains polysaccharide by intestinal microorganisms;
[0044] Figure 7 PCA analysis graph of microbial composition after fermentation of distillers' grains polysaccharide by intestinal microorganisms;
[0045] Figure 8 Relative abundance graph of microorganisms at the phylum level after fermentation of distillers' grains polysaccharide by intestinal microorganisms;
[0046] Figure 9 Relative abundance graph of microorganisms at the genus level after fermentation of distillers' grains polysaccharide by intestinal microorganisms;
[0047] Figure 10 PCA analysis graph of metabolites after fermentation of distillers' grains polysaccharide by intestinal flora and metabolites of the blank control group;
[0048] Figure 11 Volcano graph of differential metabolites after fermentation of distillers' grains polysaccharide by intestinal flora and the blank control group;
[0049] Figure 12 KEGG bubble graph of differential metabolic function analysis after fermentation of distillers' grains polysaccharide by intestinal flora and the blank control group;
[0050] Figure 13 Sensory profile graph of distillers' grains polysaccharide oral liquid provided for the application example and the comparative example.
[0051] Specific implementation content
[0052] The present invention will be further described below in conjunction with embodiments, but it is not limited in any way. Any transformation or replacement made based on the teachings of the present invention falls within the protection scope of the present invention.
[0053] Example 1 Preparation of Distiller's Grains Polysaccharide
[0054] The distiller's grains were dried to a constant weight at 60 °C, then crushed and sieved. 50 g of the above-mentioned distiller's grains powder was taken, 500 mL of distilled water was added, and the mixture was extracted in a water bath at 80 °C for 2 h. Subsequently, the extract was centrifuged at 5000 r / min for 10 min, and the supernatant was taken. The residue was extracted again once. Then, it was concentrated and rotary evaporated at 55 °C to make the total volume of the supernatant of the two extractions 1 / 10 of the original volume. 4 times the volume of absolute ethanol was added to the crude extract, and it was precipitated at 4 °C overnight for 24 h. The precipitate was collected and dissolved in distilled water. 1 / 4 of Sevag reagent (chloroform: n-butanol = 4:1) was added to the crude polysaccharide solution, and it was mixed evenly at room temperature. Then, it was centrifuged at 12000 r / min for 10 min, and the top layer solution was taken. The protein removal was repeated many times until there was no intermediate protein layer. After dialysis treatment of the crude polysaccharide solution, it was freeze-dried to obtain distiller's grains polysaccharide (JZP), as Figure 1 shown.
[0055] Example 2 Preparation of Distiller's Grains Polysaccharide
[0056] The distiller's grains were dried to a constant weight at 60 °C, then crushed and sieved. 50 g of the above-mentioned distiller's grains powder was taken, 1500 mL of distilled water was added, and the mixture was extracted in a water bath at 80 °C for 4 h. Subsequently, the extract was centrifuged at 8000 r / min for 15 min, and the supernatant was taken. The residue was extracted again once. Then, it was concentrated and rotary evaporated at 55 °C to make the total volume of the supernatant of the two extractions 1 / 10 of the original volume. 4 times the volume of absolute ethanol was added to the crude extract, and it was precipitated at 4 °C overnight for 24 h. The precipitate was collected and dissolved in distilled water. 1 / 4 of Sevag reagent (chloroform: n-butanol = 4:1) was added to the crude polysaccharide solution, and it was mixed evenly at room temperature. Then, it was centrifuged at 12000 r / min for 10 min, and the top layer solution was taken. The protein removal was repeated many times until there was no intermediate protein layer. After dialysis treatment of the crude polysaccharide solution, it was freeze-dried to obtain distiller's grains polysaccharide.
[0057] Example 3 Characterization of Distiller's Grains Polysaccharide
[0058] (1) Determination of Molecular Weight
[0059] The determination of the average molecular weight was carried out by high performance gel permeation chromatography (HPGPC), equipped with a TSKgel GMPWXL aqueous gel chromatography column from TOSOH Corporation of Japan, an LC 20AT high performance liquid chromatography pump from Shimadzu Corporation of Japan, a Rheodyne 7725i manual six-port valve injector (20 μL quantitative loop) from the United States, and a RID-20 refractive index detector from Shimadzu Corporation of Japan. Calibration was performed using T-series dextran standards with molecular weights of 5.20, 11.60, 23.80, 48.60, 148.00, 273.00, 410.00, and 668.00 kDa respectively. The mobile phase was pure water added with 0.1 mol / L NaNO3 and 0.05% NaN3, the flow rate of the mobile phase was 0.6 mL / min, and the column temperature was 35°C. The Mark-Houwink parameters of the standard curve were relatively corrected, and the results were processed using Shimadzu Lab Solutions GPC V5.93 software.
[0060] (2) Determination of monosaccharide composition
[0061] The determination of the monosaccharide composition of JZP included the following steps: 2 mg of the distiller's grains polysaccharide prepared in Example 1 was taken, hydrolyzed in 1 mL of 2 mol / L trifluoroacetic acid at 110°C for 90 min, and evaporated to dryness using a rotary evaporator. The hydrolyzate of the polysaccharide or the monosaccharide mixed standard solution was added with 2 mL of double-distilled water, reduced with 60 mg of sodium borohydride for 8 hours, neutralized with glacial acetic acid, rotary evaporated, and then dried in an oven at 101°C. Then, 1 mL of acetic anhydride was added for acetylation reaction at 100°C for 1 h, cooled, and then 3 mL of toluene was added, and concentrated under reduced pressure to dryness. This step was repeated 4 - 5 times to remove the excess acetic anhydride. The acetylated product was dissolved in 3 mL of chloroform and transferred to a separatory funnel. After adding a small amount of distilled water and shaking well, the upper aqueous solution was removed, and this was repeated 4 times. The chloroform layer was dried with an appropriate amount of anhydrous sodium sulfate and made up to 10 mL. The analysis was carried out using a Shimadzu GCMS-QP 2010 gas chromatography-mass spectrometry instrument to determine the acetylated product sample.
[0062] GC-MS conditions: RXI-5SIL MS chromatographic column 30 m × 0.25 mm × 0.25 mm; The programmed temperature conditions were: the initial temperature was 120°C, heated to 250°C at a rate of 3°C / min, and held for 5 min; the injection port temperature was 250°C, the detector temperature was 250°C, the carrier gas was helium, and the flow rate was 1 mL / min.
[0063] (3) Determination of infrared spectrum
[0064] The FT-IR spectrum of the distiller's grains polysaccharide prepared in Example 1 was recorded using an infrared spectrometer (Nicolet IS10 FT-IR), and the scanning range was 4000 - 400 cm -1。The resolution of the spectrometer is 4 cm -1 , and the signal-to-noise ratio (S / N) is 50,000:1. Before measurement, the sample was ground with KBr powder and scanned according to the KBr tablet pressing method.
[0065] (4) Morphology characterization and particle size analysis
[0066] The surface morphology of the distiller's grains polysaccharide prepared in Example 1 was observed by scanning electron microscopy (SEM). Before scanning, the dried polysaccharide was coated with a thin layer of gold by sputtering, and then observed through a scanning electron microscope system, and the elemental composition of JZP was detected by the EX-250 system.
[0067] (5) Result analysis
[0068] Determination results of molecular weight
[0069] Natural polysaccharides usually exhibit a wide molecular weight distribution, and different molecular weights affect the properties of polysaccharides such as solution viscosity and biological activity. In this study, we used HPGPC to determine the molecular weight of JZP prepared in Example 1 and Example 2. The molecular weight distribution chromatogram is as Figure 2 shown. JZP has only one component in the figure, indicating that JZP has a single polysaccharide component and Mw is 9666 Da.
[0070] Determination results of monosaccharide composition
[0071] The types and molar ratios of monosaccharides in polysaccharides often have an important impact on the biological activity of polysaccharides. Therefore, the determination of monosaccharide composition is an extremely important part of the structural analysis of polysaccharides. Figure 3 shows the monosaccharide composition chromatogram of JZP. The results show that JZP is mainly composed of mannose, ribose, rhamnose, glucuronic acid, galacturonic acid, glucose, galactose, xylose, arabinose and fucose, and the proportions are 3.280, 0.229, 0.268, 1.365, 0.783, 81.879, 3.284, 4.104, 4.687 and 0.120 respectively.
[0072] Determination results of infrared spectrum
[0073] As a commonly used analysis method in the identification of the primary structure of polysaccharides, FT-IR can be used to analyze the glycosidic bond type, functional group type, sugar ring configuration, etc. of polysaccharides. The FT-IR spectrum of JZP shows characteristic peaks of various polysaccharides, such as Figure 4 shown. Due to the O-H stretching vibration of hydroxyl groups in polysaccharides, a strong and broad absorption peak was observed at 3348.67 cm -1 . The JZP absorption peak at 2914.87 cm -1 represents the C-H symmetric stretching vibration, and these two absorption peaks are both characteristics of polysaccharides. At 1645.20 cm-1 and 1424.34 cm -1 The bands at... cm caused the stretching vibration of C-O and the bending vibration of C-H, indicating that JZP contains uronic acid. This finding is consistent with the results of the monosaccharide composition of JZP. 1246.67 cm -1 -1041.94 cm -1 The strong absorption indicates that C-O-C comes from the stretching vibration of the pyranose ring.
[0074] Morphology analysis
[0075] SEM is considered a powerful tool for elucidating the surface morphology of polymers to predict their physical properties. As Figure 5 shown, the microstructure of JZP shows a flaky and smooth structure and a porous state under magnifications of 50 times and 500 times.
[0076] Determination of the probiotic activity of distiller's grains polysaccharide in Example 4
[0077] (1) Extraction of microbial community DNA and 16S rRNA sequence analysis
[0078] Before DNA extraction, the JZP prepared in Example 1 was stored in a -80 °C refrigerator. The fermentation broth was centrifuged, and the supernatant was discarded. DNA was extracted using the Soil DNA Kit kit and operated according to the kit steps. Agarose gel electrophoresis was used to detect the purity and concentration of DNA. The extracted DNA was amplified and sequenced in the V3-V4 region of 16S rRNA. The amplification primers were 338F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVGGGTWTCTAAT. Sequencing was performed using the Illumina MiseqPE300 / NovaSeq PE250 platform (Shanghai Majorbio Bio-Pharm Technology Co., Ltd.). The UPARSE software was used to perform OTU clustering on the sequences according to 97% similarity. All data analysis was performed on the Majorbio Cloud Platform.
[0079] Table 1
[0080] Primer Sequence number Sequence (5'-3') 338F SEQ ID NO.1 ACTCCTACGGGAGGCAGCAG 806R SEQ ID NO.2 GGACTACHVGGGTWTCTAAT
[0081] (2) Determination of metabolites in the fermentation broth
[0082] The metabolites during the fecal fermentation process were determined by LC-MS method. The supernatant of the distiller's grains polysaccharide fermented by intestinal flora for 24 h was extracted. Blank control group: The method of the group without adding distiller's grains polysaccharide (BLK) was the same. Take 250 μL of each extract and mix it with 750 μL of acetonitrile, shake well, centrifuge at 13,000 rpm for 10 min at 4 °C, and take the supernatant for liquid chromatography-mass spectrometry analysis. The chromatographic conditions were as follows: Waters UPLC BEH C18 chromatographic column (100×2.1 mm, 1.7 μm), temperature 40 °C; 0.1% formic acid water and 0.1% formic acid acetonitrile as the mobile phase; flow rate 0.3 mL / min; injection volume 5.0 μL. Data were obtained in positive and negative ion modes.
[0083] (3) Data analysis
[0084] The Alpha diversity knowledge such as Chao1 and Shannon index was calculated using the mothur software, and the inter-group differences in Alpha diversity were analyzed using the Wilxocon rank sum test; the PCoA analysis (principal coordinates analysis) based on the bray-curtis distance algorithm was used to test the similarity of the microbial community structure between samples, and the PERMANOVA nonparametric test was combined to analyze whether the differences in the microbial community structure between sample groups were significant. The Progenesis QI software (Nonlinear Dynamics, Durham, NC, USA) was used to perform peak alignment and peak extraction on the data. The deconvolution of peaks used the default settings of QI. The data were further analyzed using the R software. The data exported by the QI software were further analyzed and screened, and at the same time, the R package and the HMDB database were used to identify the substances of the peaks. For those with biological replicates, a method combining the fold change, the p-value of the student's t-test, and the VIP value was adopted to screen for differential metabolites. After combining the differential metabolites obtained from the positive and negative ion mode analyses, the enrichment analysis of the KEGG pathway was performed.
[0085] (4) Result analysis
[0086] Effect of distiller's grains polysaccharide on microbial diversity
[0087] Through in vitro fermentation experiments, the effects of JZP on intestinal flora were determined. After 24 h of fermentation, the flora was analyzed by 16S rRNA, and the metabolites during the fecal fermentation process were determined by LC-MS method.
[0088] The rarefaction curve (also known as the dilution curve) is generally used in microbial research to evaluate the saturation of sequencing volume or sample size. When the sample sequencing depth increases but the curve no longer shows a significant increase (accurately speaking, the curve slope is smooth and the change is small), it is considered that the sequencing volume is sufficient, and increasing the sequencing volume will not cause a significant change in the alpha diversity index of the sample, that is, the alpha diversity index of the sample reaches stability. As Figure 6 shown, the curve tends to be flat, indicating that the sequencing depth has basically covered all microbial communities in the sample, and increasing the sequencing data cannot find more OUTs, and the sequencing data is accurate and reliable.
[0089] Alpha diversity is an important component in microbial diversity analysis. It refers to the diversity within a specific region or ecosystem and is a comprehensive index reflecting richness and evenness. Species diversity is not only reflected in the number of biological species (richness), but also includes the evenness of the distribution of these biological species in a specific environment (diversity). From the perspective of richness, the Chao1 index and the ACE index are two main measurement tools. The Chao1 index focuses on evaluating the number of rare species in an ecosystem, while the ACE index provides a more accurate estimate of the total number of species in an ecosystem through weighted calculation of rare populations. Regarding the evenness of species distribution in a community, the Shannon index and the Simpson index are commonly used indicators to measure community diversity. The Shannon index takes into account the relative abundance of species and can provide a broad overview of community diversity, while the Simpson index pays more attention to the dominance or concentration of species. The higher the value of the Simpson index, the scarcer the biodiversity. As shown in Table 2, the Chao, Shannon, and Ace of JZP are all significantly higher than those of BLK (p < 0.05), indicating that adding JZP significantly increases the richness and diversity of the gut microbiota.
[0090] In addition, in the PCA of beta diversity analysis based on the Bray-Curtis clustering tree (as Figure 7 shown), the gut microbiota characteristics of BLK and JZP are significantly separated, indicating that JZP significantly changes the gut microbiota composition.
[0091] Table 2 Alpha diversity of samples among different groups
[0092]
[0093] (a represents the significance value p < 0.001, b represents the significance value 0.001 ≤ p < 0.01, c represents the significance value 0.01 ≤ p < 0.05)
[0094] Effects of distiller's grains polysaccharides on microbial composition
[0095] The changes in the gut microbiota of the JZP and BLK groups at the phylum level are as follows Figure 8 shown. Proteobacteria and Firmicutes are the dominant phyla in the BLK group, while Proteobacteria, Firmicutes, Bacteroidota, and Actinobacteriota are the dominant phyla in JZP. Notably, compared with BLK, the relative abundance of Proteobacteria in JZP is significantly reduced. Proteobacteria includes various pathogens, and generally, an increase in its relative abundance can cause gut microbiota imbalance, low-grade inflammation, and even chronic colitis. In addition, compared with BLK, the relative abundances of Bacteroidota, Fusobacteriota, and Firmicutes in JZP are significantly increased. Bacteroidota exists in the distal colon and is one of the main gut microbiota responsible for polysaccharide degradation, which helps reduce systemic inflammation, improve the recovery rate of tissue structure, and restore the gut microbiota. It can enzymatically degrade indigestible polysaccharides to produce short-chain fatty acids; Firmicutes can also produce short-chain fatty acids by degrading dietary fiber; the relative abundance of Fusobacteriota is relatively high, which may be because Fusobacteriota prefers to utilize carbon sources to maintain growth. Our research shows that the supplementation of JZP selectively stimulates the growth of the gut microbiota.
[0096] To further analyze the specific genera of JZP, we analyzed the abundances of the top 30 genera, and the results are as follows Figure 9As shown, after 24 hours of fermentation in a carbon-free medium, Escherichia-Shigella is the main bacterium. Escherichia-Shigella is the main cause of diarrhea in young children and can cause developmental delays in young children. Compared with the BLK group, the Escherichia-Shigella in the JZP group was significantly reduced. In addition, the beneficial bacteria genera Phascolarctobacterium, Enterococcus, Bacteroides, Bifidobacterium, and Blautia were significantly increased. Phascolarctobacterium can prevent Clostridium difficile infection and maintain intestinal health; according to previous studies, Enterococcus is widely used as a probiotic and has a strong bactericidal effect on Enteroaggregative Escherichia coli, including inducing abrasion and cell lysis; Bacteroides can degrade polysaccharides by encoding many carbohydrate-active enzymes, and previous studies have reported that Bacteroides can enhance host immunity and maintain intestinal ecological balance; Blautia is a recently discovered bacterial genus that has attracted much attention for its contribution to alleviating inflammatory and metabolic diseases and its antibacterial activity against specific microorganisms; Bifidobacterium promotes the absorption of iron and vitamin D and improves the utilization rate of phosphorus, iron, and calcium; Bifidobacterium can decompose α-casein through phosphoprotein phosphatase to promote protein absorption. In summary, JZP regulates the intestinal flora by increasing the relative abundance of beneficial bacteria genera and decreasing the relative abundance of harmful bacteria genera.
[0097] Principal Component Analysis
[0098] Principal Component Analysis (PCA) is a multivariate statistical analysis method for unsupervised pattern recognition, which can reflect the information of the original variables and reflect the variability between and within sample groups as a whole, that is, the distribution and separation trend of the two groups of samples. PCA was applied to explore the changes in in vitro fermentation metabolites among groups after JZP treatment. PCA analysis was performed on each group respectively. As Figure 10 shown, after JZP treatment, both the polysaccharide group and the blank group showed a significant separation trend. This indicates that the polysaccharide changed the metabolism of the intestinal microbiota.
[0099] Differential metabolites between groups
[0100] For those with biological replicates, a method of combining fold change, p-value of student's t-test, and VIP value was adopted to screen for differential metabolites. First, univariate analysis was used to obtain differential metabolites between the two groups. Through a volcano plot, the differences in the expression levels of metabolites between the two groups could be quickly visualized. The threshold settings for the volcano plot were p < 0.05 and the absolute value of log2FC > 1 to screen for some metabolites of key concern. As Figure 11 shown, the volcano plots for each differential comparison group are presented. Each point in the figure represents a metabolite. The red points in the figure represent up-regulated differentially expressed metabolites, the green points represent down-regulated differential metabolites, and the gray points represent metabolites that were detected but showed no significant differences. Using the above method, a total of 552 differential metabolites were screened. Among them, 422 differential metabolites were significantly up-regulated in JZP, and 130 differential metabolites were significantly down-regulated.
[0101] KEGG enrichment pathway analysis
[0102] Different metabolites in an organism cooperate with each other to exert their biological functions. Therefore, through KEGG pathway analysis, a deeper understanding of their biological functions can be achieved. Based on the UPLC LTQ-Orbitrap MS / MS platform, metabolite enrichment analysis of differential metabolites was performed through the KEGG pathway. As Figure 12 can be seen, under the mediation of JZP, the metabolism of cysteine and methionine, the metabolism of alanine, aspartic acid, and glutamic acid, and the digestion and absorption of carbohydrates were significantly affected. Therefore, based on the above facts, JZP can affect some important metabolic pathways and have a positive impact on host health.
[0103] Application Examples 1 - 3 Preparation method of a lees polysaccharide oral liquid with probiotic activity
[0104] Application Example 1 Application Example 2 Application Example 3 Distiller's grains polysaccharide 2mg 3mg 5mg Honey 1.5mg 2mg 2.5mg Food flavor 0.3mg 0.5mg 0.8mg Citric acid 0.06mg 0.08mg 0.1mg
[0105] Application Comparative Example 1 Preparation method of a lees polysaccharide oral liquid with probiotic activity
[0106]
[0107]
[0108] The preparation method of the lees polysaccharide oral liquid includes the following steps:
[0109] (1) Mixing: Weigh the lees polysaccharide, honey, edible essence, and citric acid in Application Examples 1 - 3 above, add 100 mL of water, stir well to dissolve, and form a mixed solution after mixing evenly;
[0110] (2) Centrifugation: The mixed solution from step (1) is centrifuged at 2000 r / min for 5 min, and the supernatant obtained is the lees polysaccharide oral liquid;
[0111] (3) The lees polysaccharide oral liquid obtained in step (2) is filtered through a sterile 0.22 μm filter membrane and then filled into a brown bottle, sealed, sterilized at 121 °C for 15 min, and then canned to obtain the finished lees polysaccharide oral liquid.
[0112] Effect experiment
[0113] 1. Evaluation of the dosage of each component of the lees polysaccharide oral liquid
[0114] Precisely measure 15 portions of the lees polysaccharide oral liquid prepared in Application Examples 1 - 3 and Comparative Example 1 above, each portion being 10 mL. According to the scoring rules for oral liquid in Table 3, randomly select 5 people in the laboratory to score and then calculate the average value as the comprehensive taste score.
[0115] Table 3 Sensory scoring rules for oral liquid
[0116] Item Quality requirement Score option Impurity No visible foreign impurities 5,4,3,2,1 Color and luster Clear 5,4,3,2,1 Taste The taste is harmonious and gentle 5,4,3,2,1
[0117] Detect the clarity and taste score of the lees polysaccharide solution after adding honey of different qualities. The results are shown in Table 4. The clarity of the lees polysaccharide solution is slightly different under different amounts of honey added; among them, the solution obtained with the honey addition amount in Application Example 2 is visually clear, with a harmonious and gentle taste, and has the highest score, significantly higher than that of Comparative Example 1.
[0118] Table 4 Conditions of the lees polysaccharide solution after adding honey of different qualities
[0119] Application Example 1 Application Example 2 Application Example 3 Application Comparative Example 1 Clarity Clear Clear Clear Clear Taste score 4 5 4 3.2
[0120] Detect the clarity and taste score of the lees polysaccharide solution after adding citric acid of different qualities. The results are shown in Table 5. Among them, the taste of Application Example 2 is the best, and the taste of Application Examples is better than that of Comparative Example 1.
[0121] Table 5 Conditions of the lees polysaccharide solution after adding honey of different qualities
[0122]
[0123]
[0124] 2. Quality grading and sensory evaluation of the lees polysaccharide oral liquid
[0125] (1) Shape of the oral liquid
[0126] The lees polysaccharide oral liquid is a clear liquid without strange odors. The clarity is determined by visual inspection.
[0127] (2) Detection of relative density and pH of oral liquid
[0128] Take three groups of distiller's grains polysaccharide oral liquids prepared in Application Example 2. First, weigh 10 mL, and then weigh 10 mL of water. The pH is detected using a pH meter, and each group of samples is detected three times.
[0129] The relative density of the distiller's grains polysaccharide oral liquid is 1.102; the average pH is 6.03.
[0130] (3) Sensory evaluation
[0131] Train and select 5 evaluators with food professional knowledge and good sensory acuity to form a review group. Conduct a sensory evaluation of the distiller's grains polysaccharide oral liquid prepared in Application Example 2 based on four aspects: color, aroma, taste, and state. The scoring rules are shown in Table 6.
[0132] Table 6 Sensory evaluation of distiller's grains polysaccharide oral liquid
[0133]
[0134] After evaluation, the color score of the distiller's grains polysaccharide is 7.8 points, the aroma score is 7 points, the taste score is 6.8 points, and the state score is 8.2 points. The sensory profile is as Figure 13 shown.
[0135] The above results show that the distiller's grains polysaccharide prepared by the present invention has good biological activity. The oral liquid with it as the main functional formula has a good state, elegant flavor, and strong palatability, and the oral liquid has broad application prospects.
Claims
1. A preparation method of distiller's grains polysaccharide with beneficial biological activities, characterized in that, The following steps are involved: (1) Dry the lees at 60°C to constant weight, crush and sieve, take 50 g, add 500 mL of distilled water, and extract in a water bath at 80°C for 2 h; (2) The extract was centrifuged at 5000 r / min for 10 min and the supernatant was collected. The residue was extracted once again and the supernatants were combined and concentrated at 55°C under reduced pressure to 1 / 10 of the initial volume. (3) Add 4 times the volume of anhydrous ethanol to the concentrate, precipitate at 4°C for 24 h, collect the precipitate, and dissolve it in distilled water to prepare a crude polysaccharide solution; (4) Add 1 / 4 volume of Sevag reagent (chloroform: n-butanol = 4:1) to the crude polysaccharide solution, mix, and centrifuge at 12,000 r / min for 10 min. Take the upper aqueous phase and repeat the operation until there is no protein layer. (5) The deproteinized polysaccharide solution is dialyzed and freeze-dried to obtain vinasse polysaccharide.
2. A vinasse polysaccharide prepared by the preparation method according to claim 1.
3. Use of the vinasse polysaccharide obtained by the preparation method according to claim 1 or the vinasse polysaccharide according to claim 2 in the preparation of a preparation for regulating intestinal flora.
4. The application according to claim 3, characterized in that: The preparation dosage form is capsule, granule, tablet, oral liquid or pill.
5. A lees polysaccharide oral liquid containing beneficial biological activities, characterized in that: The invention comprises the following raw materials: the vinasse polysaccharide as claimed in claim 2, honey, edible essence and citric acid.
6. The lees polysaccharide oral liquid according to claim 5, characterized in that: Calculated by mass fraction, the raw materials include: 2%-5% of the distiller's grains polysaccharide according to claim 2, 1.5%-2.5% of honey, 0.3%-0.8% of edible flavoring, and 0.06%-0.1% of citric acid.
7. The preparation method of the distiller's grains polysaccharide oral liquid according to claim 5 or 6, characterized in that: The following steps are involved: (1) Mixing: Weigh distiller's grains polysaccharide, honey, edible flavor, and citric acid, add purified water, stir thoroughly to dissolve, and mix evenly to form a mixed solution; (2) Centrifugation: centrifuging the mixed solution of step (1) to obtain a supernatant which is the vinasse polysaccharide oral solution; (3) sterilizing the vinasse polysaccharide oral liquid obtained in step (2) and then canning it to obtain a finished vinasse polysaccharide oral liquid.
8. The preparation method according to claim 7, characterized in that; The centrifugation conditions in step (2) are 1000-2000 r / min and the centrifugation time is 5-10 min. The sterilization conditions in step (3) are as follows: filtering with a sterile 0.22 μm filter membrane, placing in a brown bottle, sealing, and sterilizing at 120-125° C. for 15-20 min.
Citation Information
Patent Citations
Distilled grain protein compound beverage and preparation method thereof
CN110637957A
Highland barley vinasse antioxidant peptide beverage and preparation method thereof
CN117343979A
Vinasse water-soluble araboxylan as well as preparation method, pharmaceutical composition and application thereof
CN117903332A
White spirit vinasse polysaccharide, response surface method optimization-based microwave-assisted enzyme extraction method and application thereof
CN118772308A