Preparation method of human haploid trophoblast stem cells

Abstract

The invention relates to a preparation method of human haploid trophoblast stem cells, which comprises the following steps: inoculating haploid embryonic stem cells (hAG-ESCs) into a culture medium of human trophoblast stem cells (TSC), domesticating, and when TSC sample clones account for more than 50% of the proportion of all cells in the induction process, carrying out flow sorting on ITGA6 positive cells, and inoculating into the TSC culture medium again for culturing to obtain the human haploid trophoblast stem cells. After the culture, haploid trophoblast stem cells (haiTSCs) are obtained; the prepared haiTSCs are haploids, and have TSC properties. The preparation method is rapid and efficient, and the haiTSCs can be used for simulating an in-vivo disease model and have the genetic screening advantage of haploids.

Description

Technical Field

[0001] The invention belongs to the technical field of cell culture, and in particular relates to a method for preparing human haploid trophoblast stem cells. Background Art

[0002] Human trophoblast cells differentiate into placental organs during embryonic development and are responsible for material transport, nutrient transfer and immune barriers between the mother and the fetus, so they are indispensable in the process of embryonic development. Many congenital gene mutations can cause placental development defects, which in turn cause serious diseases such as threatened abortion and eclampsia during pregnancy. Therefore, genetic screening of the trophoblast lineage can study the key regulatory genes of placental development, thereby gaining a deeper understanding of the pathogenic mechanisms of placental-related diseases. Due to ethical and other restrictions on the acquisition of early placental samples, it is particularly important to induce stem cells that can simulate trophoblast lineage differentiation in vitro. Traditional trophoblast stem cells are diploid cells, which are extremely inconvenient for studying gene functions or recessive genetic phenotypes. Since haploid cells have only one set of chromosomes, homozygous mutant cells can be quickly obtained after gene mutation, which has a unique advantage over diploid cells in genetic research. Therefore, the present invention intends to establish haploid trophoblast stem cells (haiTSCs) in vitro, which is a type of trophoblast stem cells with only one set of genome. These stem cells will provide an efficient and convenient tool for genetic screening research on placental development. However, since haploid stem cells tend to spontaneously diploidize during normal culture, they lose the advantages of haploidy. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a method for preparing human haploid trophoblast stem cells.

[0004] The technical solution adopted by the present invention is: human TSC culture medium, with DMEM / F12 as the basic culture medium, supplemented with 0.1mMβ-ME, 0.2% FBS, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 1.5mg / ml L-ascorbic acid, 50ng / mL human EGF protein, 2mM CHIR99021, 0.5mM A83-01, 1mM SB431542, 0.8mM VPA and 5mM Y-27632.

[0005] A method for preparing human haploid trophoblast stem cells, comprising culturing haploid embryonic stem cells in a human trophoblast stem cell culture system, flow sorting ITGA6-positive cells from haploid cells after culturing, and re-culturing in a human trophoblast stem cell culture system to obtain human haploid trophoblast stem cells;

[0006] Among them, the human trophoblast stem cell culture system includes human TSC culture medium.

[0007] Preferably, the specific steps are as follows:

[0008] Step 1: Place haploid embryonic stem cells into human TSC culture medium for acclimatization and culture for 5-7 days;

[0009] Step 2: When TSC clones account for more than 50% of the total cells in the culture system, cells that are both haploid and express the TSC molecular marker ITGA6 are sorted out by flow cytometry, and then inoculated into human TSC culture medium again and cultured for 2-3 days to obtain human haploid trophoblast stem cells;

[0010] Step 3: During the culture process, haiTSCs are passaged every three days and flow sorted every 15-20 days to maintain the haploid ratio.

[0011] Preferably, in step 1, the haploid embryonic stem cells are routinely cultured in human ESC culture medium at a temperature of 37°C and 5% CO 2 , 20% O 2 ;

[0012] The culture medium of human ESC is based on knockout DMEM, supplemented with 20% KOSR, 2mM L-alanyl-L-glutamine solution, 0.5% penicillin-streptomycin, 0.1mM β-ME and 10ng / ml basic fibroblast growth factor.

[0013] The invention relates to a method for preparing human haploid trophoblast stem cells and to human haploid trophoblast stem cells prepared by the method.

[0014] A method for preparing human haploid placental organoids, comprising placing human haploid trophoblast stem cells into an organoid culture medium to differentiate into human haploid placental organoids.

[0015] Preferably, human haploid trophoblast stem cells are used, and when the cell confluence reaches 80%, they are digested with Tryple and cultured at 1 × 10 4 The starting cell amount was mixed in 100 μL of 75% Matirgel basement membrane matrix, and the cells were dropped in the center of a 24-well plate at a rate of 30 μL per well. The wells were left to stand at room temperature for 2 min, incubated at 37°C for 30 min, and 500 μL of organoid culture medium was added to the 24 wells. After 6 days of induction, human haploid placental organoids were obtained.

[0016] Preferably, the organoid culture medium is based on Advanced DMEM / F12, supplemented with 1×N2Supplement, 1×B27 Supplement minus vitamin A, 100ug / mL Primocin, 1.25mM N-acetyl-L-cysteine, 2mML-glutamine, 500nM A83-01, 1.5μM CHIR99021, 2μM Y-27632, 50ng / mL rhEGF, 50ng / mLrhHGF, 80ng / mL rhR-Spondin1, 100ng / mL rhFGF2 and 2.5μM Prostaglandin E2.

[0017] Human haploid placental organoids prepared by a method for preparing human haploid placental organoids;

[0018] Preferably, cells positive for the TSCs molecular marker CDH1 are located in the outer layer of the organoid, and cells positive for the STs molecular markers CGB and SDC1 are located in the inner layer of the organoid.

[0019] A human haploid trophoblast stem cell differentiation method, which is to differentiate human haploid trophoblast stem cells into STs or into EVTs;

[0020] Preferably, human haploid trophoblast stem cells are placed in a culture medium for STs differentiation to differentiate and obtain cell clusters with STs-specific molecular markers;

[0021] Alternatively, human haploid trophoblast stem cells are placed in a culture medium for differentiation of EVTs to differentiate and obtain cell clusters with EVTs-specific molecular markers;

[0022] Among them, the culture medium for STs differentiation was based on DMEM / F12, supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 2.5 μM Y27632, 2 μM Forskolin, and 4% KOSR;

[0023] The EVTs differentiation medium was based on DMEM / F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 100 ng / ml NRG1, 7.5 μM A83-01, 2.5 μM Y27632 and 4% KOSR.

[0024] Application of human haploid trophoblast stem cells and / or human haploid placental organoids in drug target research and genetic studies.

[0025] The advantages and positive effects of the present invention are: providing a method for rapidly and efficiently preparing human haploid trophoblast stem cells, and furthermore being able to construct human haploid placental organoids; the cell system is extremely similar to diploid TSCs in molecular biology and cell biology functions, can be used to simulate in vivo disease models, and has the genetic screening advantages of haploids; and providing two extremely advantageous experimental tools for exploring genetic diseases and drug targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 DNA content analysis of haiTSCs before and after sorting;

[0027] Figure 2 White light image of haiTSCs cell morphology; scale bar 100 μm;

[0028] Figure 3 Results of G-banding karyotype analysis experiments of haiTSCs;

[0029] Figure 4 DNA gene mutation analysis (CNV) of haiTSCs, based on log2;

[0030] Figure 5 The staining results of TSC markers TEAD4, CDH1, GATA3 and TP63 in haiTSCs; the scale bar is 50 μm;

[0031] Figure 6 Staining of ST markers (SDC1 and CGB) of ST cells induced from haiTSCs; scale bar is 50 μm;

[0032] Figure 7 Expression levels of ST lineage-specific genes in haiTSC-STs and haiTSCs; T test, ***p<0.001, **p<0.01;

[0033] Figure 8 Staining of EVT markers (HLA-G and CGB) of EVT cells induced from haiTSCs; scale bar is 50 μm;

[0034] Fig. 9 Expression levels of EVT-specific genes in EVT cells induced from haiTSCs in haiTSC-EVTs and haiTSCs; T test, ***p<0.001, **p<0.01;

[0035] Fig.10 White light image of haploid organoids induced from haiTSCs; scale bar is 100 μm;

[0036] Fig.11 IF staining results of haiTSC-1-1-TOs cells composed of ha-TOs; TSC molecular marker is CDH1, ST molecular markers are CGB and SDC1;

[0037] Fig.12 Analysis of DNA content of ha-TOs; the proportion of 1n(G0 / G1) peak in ha-TOs was 39.4%. DETAILED DESCRIPTION

[0038] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0039] The present invention relates to a method for preparing human haploid trophoblast stem cells. First, haploid embryonic stem cells (hAG-ESCs) are screened, and then inoculated in a culture medium of human trophoblast stem cells (TSC) for domestication. hAG-ESCs are induced to transform into TSC-like clones. When TSC-like clones occupy more than 50% of the proportion of all cells in the induction process, ITGA6-positive cells are flow-sorted, and the screened cells are again inoculated into TSC culture medium for culture, and haploid trophoblast stem cells (haiTSCs) are obtained after culture. It can be known from the confirmation of haploid properties that the cultured haiTSCs are haploids with only one set of chromosomes; TEAD4, GATA3, TP63, and CDH1 antibody detection are then performed to prove their TSC properties. In the daily passage process of haiTSCs, flow sorting once a week is used to control the haploid properties, and the haploidy of the cell line is maintained by such a method.

[0040] Human TSC culture medium can activate the WNT growth factor signaling pathway and the epidermal growth factor (EGF) signaling pathway, inhibit transforming growth factor beta (TGF-β), histone deacetylase (HDAC) and Rho-associated protein kinase (ROCK), and the resulting culture system can induce the transformation of hAG-ESCs in the Primed state into haiTSCs; long-term use in culturing haiTSCs cells can maintain their haploidy and TSC properties.

[0041] The specific preparation steps are as follows:

[0042] Step 1: hAG-ESCs were cultured in human embryonic stem cell (ESC) culture medium on a daily basis, and feeder cells were laid on the bottom of the dish to provide nutrients. The daily culture conditions of hAG-ESCs were 37°C and 5% CO. 2 , 20% O 2 ; Under this culture system, haploid cells can maintain a high haploid ratio for a long time, which is beneficial to resist the spontaneous diploidization phenomenon in the subsequent differentiation process. Haploid embryonic stem cells with a high haploid ratio are subcultured into a cell culture dish with type I collagen as the bottom, which is beneficial for the transformation of ESC to TSC. The culture medium of ESC is replaced with TSC culture medium, and differentiation is induced under this condition.

[0043] The culture medium of human ESC is based on knockout DMEM, supplemented with 20% KOSR, 2mM L-alanyl-L-glutamine solution, 0.5% penicillin-streptomycin, 0.1mMβ-ME and 10ng / ml basic fibroblast growth factor. The TSC induction system is human TSC culture medium, and the human TSC culture medium is based on DMEM / F12, supplemented with 0.1mMβ-mercaptoethanol, 0.2% FBS, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 1.5mg / ml L-ascorbic acid, 50ng / mL human EGF protein, 2mM CHIR99021, 0.5mM A83-01, 1mM SB431542, 0.8mM VPA and 5mM Y-27632.

[0044] Step 2: On the 7th day of the induction process, TSC clones accounted for more than 50% of the total cells. Hochest33342 and TSC-specific molecular marker ITGA6 were used to co-stain the cells during the induction process with antibodies and genomes. Cells that were both haploid and expressed the TSC molecular marker ITGA6 were sorted out by flow cytometry and re-inoculated into TSC culture medium. After 2-3 days, haiTSCs with a very high haploid ratio could be obtained quickly and efficiently.

[0045] Step 3: During the culture process, haiTSCs are passaged every three days and flow sorted every 15-20 days to maintain the haploid ratio.

[0046] The prepared haiTSCs were identified to have haploid properties, no genetic mutations occurred during differentiation, and were able to express TSC molecular markers. Based on haiTSCs, they can be further induced to differentiate and prepared into syncytial trophoblast stem cells (STs), invasive trophoblast stem cells (EVTs) or human haploid placental organoids (ha-TOs).

[0047] haiTSCs were inoculated into STs differentiation medium to differentiate into STs. STs differentiation medium is based on DMEM / F12, supplemented with 0.1mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 2.5μM Y27632, 2μM Forskolin, and 4% KOSR. haiTSCs were inoculated into EVTs differentiation medium to differentiate into EVTs. EVTs differentiation medium is based on DMEM / F12, supplemented with 0.1mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 100ng / ml NRG1, 7.5μM A83-01, 2.5μM Y27632, and 4% KOSR.

[0048] HaiTSCs were inoculated into the culture medium for EVTs differentiation, and Matrigel with a final concentration of 2% was added to the culture medium. After three days of culture, NRG1 was removed from the culture medium, and the final concentration of Matrigel was changed to 0.5%. On the 5th to 6th day, the cells were subcultured at a ratio of 1:2, KOSR was removed, and the final concentration of Matrigel was changed to 0.5%. After another 2-3 days of culture, EVTs were induced. It can be seen that the prepared haiTSCs have outstanding differentiation ability.

[0049] Furthermore, haiTSCs can be differentiated into ha-TOs. HaiTSCs can be inoculated into organoid culture medium, and placental organoids ha-TOs can be obtained after 6 days of induction. The organoid culture medium is based on Advanced DMEM / F12, supplemented with 1×N2Supplement, 1×B27 Supplement minus vitamin A, 100ug / mL Primocin, 1.25mM N-acetyl-L-cysteine, 2mM L-glutamine, 500nM A83-01, 1.5μM CHIR99021, 2μM Y-27632, 50ng / mLrhEGF, 50ng / mL rhHGF, 80ng / mL rhR-Spondin1, 100ng / mL rhFGF2 and 2.5μM ProstaglandinE2; the outer layer of the prepared placental organoid ha-TOs includes cells positive for the TSCs molecular marker CDH1, and the inner layer includes cells positive for the STs molecular markers CGB and SDC1.

[0050] The prepared haiTSCS and ha-TOs both have a high proportion of haploidy, which has great theoretical and clinical value for drug target and genetic research.

[0051] The scheme of the present invention is described below in conjunction with the accompanying drawings, wherein the experimental methods without specific operating steps are all carried out in accordance with the corresponding product instructions, and the instruments, reagents, and consumables used in the examples can all be purchased from commercial companies unless otherwise specified.

[0052] Human ESC culture medium: Knock out DMEM (Gibco, 10829018) as the basal medium, supplemented with 20% KOSR (serum replacement, Thermo, 10828028), 2mM L-alanyl-L-glutamine solution (Thermo, 35050061), 0.5% penicillin-streptomycin (Thermo, 15140122), 0.1mM β-mercaptoethanol (Thermo, 21985023) and 10ng / ml basic fibroblast growth factor (bFGF, Peprotech, 100-18B);

[0053] Human TSC culture medium: DMEM / F12 (Gibco, 11320033) was used as the basic medium, supplemented with 0.1 mM β-mercaptoethanol, 0.2% FBS (HyClone, SH3040605), 0.5% penicillin-streptomycin, 0.3% BSA (Sigma, A1933), 1% ITS supplement (Sigma, I3146), 1.5 mg / ml L-ascorbic acid (Sigma, A8960), 50 ng / mL human EGF protein (Peprotech, AF-100-15-1MG), 2 mM CHIR99021 (MCE, HY-10182), 0.5 mM A83-01 (MCE, HY-10432), 1 mM SB431542 (MCE, HY10431), 0.8 mM VPA (Sigma, P4543) and 5 mM Y-27632 (Selleck, S1049);

[0054] STs differentiation medium: DMEM / F12 as the basic medium, supplemented with 0.1 mM 2-mercaptoethanol (Thermo, 21985023), 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 2.5 μM Y-27632, 2 μM Forskolin (MCE, HY-15371) and 4% KOSR (Thermo, 10828028);

[0055] EVTs differentiation medium: DMEM / F12 as the basic medium, supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 100 ng / ml NRG1 (MCE, HY-P74709), 7.5 μM A83-01, 2.5 μM Y-27632 and 4% KOSR;

[0056] Organoid culture medium for haiTSCs: Advanced DMEM / F12 (Life Technologies, 12634010) as the basic medium, supplemented with 1×N2 Supplement (Life Technologies, 17502048), 1×B27 Supplement minus vitamin A (Life Technologies 12587010), 100ug / mL Primocin (Invivogen #ant-pm-1), 1.25mM N-acetyl-L-cysteine ​​(Sigma, A9165), 2mM L-glutamine (Life Technologies, 25030-024), 500nM A83-01, 1.5μM CHIR99021, 2μM Y-27632, 50ng / mL rhEGF (Peprotech, AF-100-15), 50ng / mL rhHGF (Peprotech, 100-39), 80ng / mL rhR-Spondin1 (Peprotech, 120-38), 100ng / mL rhFGF2 (Peprotech, 100-18B) and 2.5μMProstaglandin E2 (Millipore Sigma, P0409)];

[0057] The enzymes used for daily passage of hAG-ESCs were collagenase IV (Stem Cell, 07909); type I collagen: Yeason, 40125ES10; and the digestion reagent was Tryple Express enzyme (Gibco, 12604021);

[0058] Flow sorter Beckman, Moflo Astrios EQ; confocal microscope SP8, Leica.

[0059] The primer information of fluorescent quantitative polymerase chain reaction is as follows:

[0060] SEQ ID No.1CGA F GTCACATTGTCGGTGTTTCTGC

[0061] SEQ ID No.2CGA R CTTCTTGGACCTTAGTGGAGTGG

[0062] SEQ ID No.3CGB F CAGCATCCTATCACCTCCTGGT

[0063] SEQ ID No.4CGB R CTGGAACATCTCCATCCTTGGT

[0064] SEQ ID No.5SDC1 F CCTCCAGTCAGCTCCCAGC

[0065] SEQ ID No.6SDC1 R GCACACAGCAAAGATGAGCCC

[0066] SEQ ID No.7CSH1 F CTAGAGGAAGGCATCCAAACGC

[0067] SEQ ID No.8CSH1 R CTCGACCTTGTCCATGTCCTTC

[0068] SEQ ID No.9CYP19A1 F GCACAGACTCGAGTTTTTCCCC

[0069] SEQ ID No.10CYP19A1 R GCCCAAAGCCAAATGGCTG

[0070] SEQ ID No.11GATA3 F AGGAATGCCAATGGGGACC

[0071] SEQ ID No.12GATA3 R GAAGTCCTCCAGTGAGTCATGC

[0072] SEQ ID No.13HSD3B1 F GATGTCTTCGGTGTCACTCACAG

[0073] SEQ ID No.14HSD3B1 R GGTGTAGATGAAGACTGGCACAC

[0074] SEQ ID No.15INHA F GCTTCACACACAGGGGCTC

[0075] SEQ ID No.16INHA R CCCTCTGGCAGCTGACTTG

[0076] SEQ ID No.17PSG1 F CGATATGGTGGCATCCGCAG

[0077] SEQ ID No.18PSG1 R AGGGTAAATTCTGGGGAGGTCTG

[0078] SEQ ID No.19HLAG F CCACCACCCTGTCTTTGACTAT

[0079] SEQ ID No.20HLAG R ACGTCCTGGGTCTGGTCCT

[0080] SEQ ID No.21CSH2 F CTCGGACAGCGATGACTATCA

[0081] SEQ ID No.22CSH2 R CACAGCTACCCTCTACAGAGC

[0082] SEQ ID No.23PSG2 F ACTGGATATTTCACCTTCACCTT

[0083] SEQ ID No.24PSG2 RGCACTCCCTGAGTTCCGTAT

[0084] SEQ ID No.25MMP2 F TGGCACCCATTTACACCTACAC

[0085] SEQ ID No.26MMP2 R ATGTCAGGAGAGGCCCCATAGA

[0086] Example 1: Construction of haiTSCs

[0087] hAG-ESCs were cultured on a gelatin-based feeder layer using human ESC culture medium. The daily culture conditions for hAG-ESCs were 37°C and 5% CO. 2 , 20% O 2; After one flow sorting in 15-20 days, the haploid ratio can be stably maintained. Specifically, the cells were digested with 0.05% trypsin for three minutes, and the digestion was stopped in a medium containing 5% serum. After being blown and mixed, they were centrifuged at 500g for five minutes. After removing the supernatant, 5μg / mL Hochest 33342 (Thermo Fisher Scientific, H3570) was added. The sample was placed in a 37°C water bath for staining for 15 minutes, the supernatant was removed by centrifugation, and the cells were resuspended in 500μL of culture medium, passed through a cell sieve to remove cell adhesion, and sorted for haploids.

[0088] The sorted haploid hAG-ESCs were digested with collagenase IV for 3 minutes and subcultured to two 35 mm dishes at a ratio of 1:6. After 3-4 days of subculture, the human ESC culture medium was replaced with human TSC culture medium. After 2-3 days of changing the culture medium, they were digested with Tryple for 10 minutes and subcultured to two six-well plates at a ratio of 1:6. They were induced in TSC culture medium until the TSC clone accounted for more than 50%. This process took about 7 days in total.

[0089] All cells in the induction process were digested with Tryple for 10 minutes, the digestion was stopped with the culture medium, the cells were collected by blowing into a centrifuge tube, the supernatant was discarded after centrifugation, 3 ml of culture medium was added, 1.5 μL of Hochest 33342 was added, and the tube was placed in a 37°C water bath for staining for 20 minutes. The supernatant was discarded after centrifugation; 1 mL of PBS was added for washing, the supernatant was discarded after centrifugation, and 100 μL of PBS was added to resuspend the cells; 0.5 μL of ITGA6 antibody stock solution was added to the cell mixture, and then haploid and IGTA6-positive cells were sorted by flow cytometry.

[0090] The ITGA6-positive cell population in the haploid was obtained by flow cytometry screening, and the screened cells were seeded in a 35 mm dish with type I collagen as the bottom. 800,000 living cells were inoculated in one 35 mm dish to prevent damage to the cells caused by flow cytometry and Hochest staining; they were then placed in TSC culture medium for acclimatization, and haiTSCs with a high haploid ratio were obtained after 2-3 days.

[0091] The haploid ratio before and after sorting is Figure 1 As shown in the figure, the haploid ratio (G0 / G1) peaks of the first and second sorting of haiTSC-1-1 were 11.2% and 36.2%, respectively, proving that the haploid ratio of haiTSCs obtained after flow sorting is very high. The haploid and IGTA6-positive cells obtained by screening can present classic TSC clones 1-2 days after being seeded back into the culture dish, and the cell morphology is as follows Figure 2 As shown, haiTSCs exhibited typical morphology of trophoblast-like cells.

[0092] The haploid properties of haiTSCs were identified. Karyotype analysis experiments verified that the obtained haiTSCs had only one set of chromosomes, and the results are shown in Figure 3. Multiple groups of haiTSCs were constructed using the above method, named haiTSC1-1 and haiTSC2-1, respectively, and then CNV data analysis was performed. The results are shown in Figure 3. Figure 4 As shown, no obvious gene mutation occurred in the different haiTSCs cell lines obtained in the experiment, which proved that this method has good repeatability and the prepared haiTSCs can be used as screening tool cells for subsequent research.

[0093] Then identify the molecular characteristics of haiTSCs. The obtained haiTSCs were spread and identified by immunofluorescence staining experiments, and antibodies to TEAD4, GATA3, TP63, and CDH1 were used as specific molecular markers. The differentiated haiTSCs were spread and sampled. After sample preparation, they were fixed with 4% PFA (PFA, Sigma, P6148) at room temperature for 10 minutes, then punched with 0.1% Triton (Sigma, T8787) for 30 minutes, and then blocked with 2% BSA for 1 hour. The samples were then incubated with the primary antibody at 4°C overnight, and haiTSCs were incubated with TSC molecular markers TEAD4 (Abcam, ab155244), TP63 (CST, 13109T), GATA3 (CST, 5852T), and CDH1 (Abcam, ab52454). After the primary antibody was finished, the slides were washed with PBS for 15 minutes each time, for a total of three times; then the corresponding secondary antibody was incubated at room temperature for two hours, and the slides were washed with PBS after the secondary antibody was finished, for a total of three times; then the cell nuclei were stained with Hochest33342 at room temperature for 10 minutes, and then washed three times with PBS, and the slides were sealed with anti-fluorescence quenching sealing agent and imaged with a confocal microscope. The staining results are shown in Figure 5 As shown, the TSC properties of haiTSCs were demonstrated.

[0094] During daily subculturing, haiTSCs are grown in a dish with type I collagen as the bottom, cultured in TSC culture medium, the medium is changed every two days, and subcultured every three days, with a subculture ratio of 1:3. In order to maintain the haploid ratio of haiTSCs, haiTSCs need to be enriched by flow cytometry every week.

[0095] Example 2: Differentiation of haiTSCs into STs

[0096] The obtained haiTSCs were subjected to in vitro differentiation of ST lineage. When the cell confluence reached 80%, the haiTSCs prepared in Example 1 were digested with Tryple for 10-15 min, and the digestion was terminated by dilution with medium.5 The starting cell amount of 10 cells was seeded into a 35mm cell culture dish, and the TSC culture medium was replaced with ST differentiation culture medium. The medium was changed on the 3rd day, and the differentiation was completed after 6 days. The cells were identified on the 6th day. It was found that about 70% of the cells in the dish successfully formed syncytial trophoblast cells STs.

[0097] The culture medium formula for STs differentiation is: based on DMEM / F12, supplemented with 0.1 mM 2-mercaptoethanol (Thermo, 21985023), 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 2.5 μM Y27632, 2 μM Forskolin and 4% KOSR.

[0098] The obtained cells were subjected to immunofluorescence staining for molecular markers SDC1 and CGB. The fluorescence staining process was the same as in Example 1, and EVTs were incubated with EVT molecular marker HLAG (Abcam, ab52454). Figure 6 As shown, it is proved that the cells obtained by differentiation experiment can express the molecular markers of ST.

[0099] Then, the ST lineage molecular markers CGA, CGB, CSH1, CYP19A1, GATA3, HSD3B1, INHA, PSG1, and SDC1 were detected by real-time fluorescence quantitative polymerase chain reaction (qPCR). Total RNA was extracted from each sample by RNAiso Plus (Takara, 9109), and cDNA was obtained by Prime ScriptTM RT Reagent Kit with gDNA Eraser (Takara, RR047A). The experiment was performed using HieffTM SYBR Green Master Mix (Yeasen, 11201ES08), and the relative expression was normalized with GAPDH. The mean and standard deviation (sd) were calculated by three independent experiments.

[0100] The results are as follows Figure 7 As shown in the results, the above molecular markers showed a significant increase in expression after ST differentiation, confirming the trophoblast stem cell properties of the obtained haiTSCs.

[0101] Example 3: Differentiation of haiTSCs into EVTs

[0102] The obtained haiTSCs were subjected to in vitro differentiation of the EVT lineage. When the cell confluence reached 80%, the haiTSCs prepared in Example 1 were digested with Tryple for 10-15 min, and the digestion was terminated by dilution with the culture medium. 0.75×10 5The cells were seeded into 35 mm dishes and cultured in EVTs differentiation medium; Matrigel basement membrane matrix (BD, 354230) with a final concentration of 2% was added to the culture medium, and NRG1 was removed from the culture medium during subculture after three days of culture, and the final concentration of Matrigel basement membrane matrix was changed to 0.5%. On the 5th to 6th day, the cells were subcultured to two 35 mm dishes at a ratio of 1:2, and KOSR was removed, and the final concentration of Matrigel was changed to 0.5%. After two to three days of culture, immunofluorescence staining experiments of EVTs molecular markers were performed to verify that the induced haiTSCs had the property of differentiating into EVTs.

[0103] The formula of EVTs differentiation culture medium is: based on DMEM / F12, supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS additive, 100 ng / ml NRG1, 7.5 μM A83-01, 2.5 μM Y27632 and 4% KOSR.

[0104] Immunofluorescence staining of molecular markers HLAG and CGB was performed on cells differentiated for 6 days. The fluorescence staining process was the same as in Example 1. STs were incubated with ST molecular markers SDC1 (ABclonal, a4174) and CGB (Abcam, ab243743). The results are shown in Figure 2. Figure 8 The results show that the differentiated cells can express EVT molecular markers. Then, qPCR was used to detect EVT lineage molecular markers HLAG, MMP2, CGB, and CSH1. The results are shown in Fig. 9 As shown, the above molecular markers have a significant trend of increasing expression after EVT differentiation.

[0105] Example 4: Induction of haiTSCs into ha-TOs

[0106] The haiTSCs obtained in Example 1 were used to induce placental organoids in vitro. When the cell confluence reached 80%, the haiTSCs prepared in Example 1 were digested with Tryple for 10-15 min, and the digestion was terminated by diluting the culture medium. 4 The starting cell amount was mixed with 100 μL of 75% Matirgel basement membrane matrix, and the cells were dropped in the center of a 24-well plate at a rate of 30 μL per well. The wells were left to stand at room temperature for 2 minutes, incubated at 37°C for 30 minutes, and 500 μL of organoid culture medium was added to the 24 wells. After 6 days of induction, placental organoids were obtained, and the cell shape was as follows: Fig.10 As shown in Figure 2, it can be seen that the obtained organoids can be passaged, have the ability to proliferate and self-renew, and can still form new organoids after passage.

[0107] The formula of organoid culture medium is: based on Advanced DMEM / F12, supplemented with 1×N2Supplement, 1×B27 Supplement minus vitamin A, 100ug / mL Primocin, 1.25mM N-acetyl-L-cysteine, 2mML-glutamine, 500nM A83-01, 1.5μM CHIR99021, 2μM Y-27632, 50ng / mL rhEGF, 50ng / mLrhHGF, 80ng / mL rhR-Spondin1, 100ng / mL rhFGF2 and 2.5μM Prostaglandin E2.

[0108] The molecular biological properties of ha-TOs were identified by immunofluorescence staining. Fig.11 As shown in the figure, the cells positive for TSCs molecular marker CDH1 were found in the outer layer of the organoid, while the cells positive for STs molecular markers CGB and SDC1 were found in the inner layer of the organoid. The haploid ratio of placental organoids induced by ha-iTSCs was analyzed by flow cytometry. The results are shown in the figure. Fig.12 The results showed that ha-TOs still had a high proportion of haploids.

[0109] The haiTSCS and ha-TOs prepared by the method of the present invention have great theoretical and clinical value for drug target and genetic research.

[0110] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A human TSC culture medium, characterized in that: The culture medium was DMEM / F12, supplemented with 0.1 mM β-ME, 0.2% FBS, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 1.5 mg / ml L-ascorbic acid, 50 ng / mL human EGF protein, 2 mM CHIR99021, 0.5 mM A83-01, 1 mM SB431542, 0.8 mM VPA and 5 mM Y-27632.

2. A method for preparing human haploid trophoblast stem cells, characterized in that: The haploid embryonic stem cells are cultured in a human trophoblast stem cell culture system, and after the culture, ITGA6-positive cells in the haploid cells are flow-sorted and re-cultured in a human trophoblast stem cell culture system to obtain human haploid trophoblast stem cells; Wherein, the human trophoblast stem cell culture system includes the human TSC culture medium described in claim 1.

3. The method for preparing human haploid trophoblast stem cells according to claim 1, characterized in that: The specific steps are as follows: Step 1: Place haploid embryonic stem cells into human TSC culture medium for acclimatization and culture for 5-7 days; Step 2: When TSC clones account for more than 50% of the total cells in the culture system, cells that are both haploid and express the TSC molecular marker ITGA6 are sorted out by flow cytometry, and then inoculated into human TSC culture medium again and cultured for 2-3 days to obtain human haploid trophoblast stem cells; Step 3: During the culture process, haiTSCs are passaged every three days and flow sorted every 15-20 days to maintain the haploid ratio.

4. The method for preparing human haploid trophoblast stem cells according to claim 3, characterized in that: In step 1, haploid embryonic stem cells are routinely cultured in human ESC culture medium under the conditions of 37°C, 5% CO2, and 20% O2; The culture medium of human ESC is based on knockout DMEM, supplemented with 20% KOSR, 2mM L-alanyl-L-glutamine solution, 0.5% penicillin-streptomycin, 0.1mM β-mercaptoethanol and 10ng / ml basic fibroblast growth factor.

5. Human haploid trophoblast stem cells prepared by the method for preparing human haploid trophoblast stem cells according to any one of claims 2 to 4.

6. A method for preparing human haploid placental organoids, characterized in that: The human haploid trophoblast stem cells according to claim 5 are placed in an organoid culture medium to differentiate into human haploid placental organoids.

7. The method for preparing human haploid placental organoids according to claim 6, characterized in that: Human haploid trophoblast stem cells were used. When the cell confluence reached 80%, they were digested with Tryptone and cultured at 1 × 10 4 The starting cell amount was mixed in 100 μL of 75% Matirgel basement membrane matrix, and the cells were dropped in the center of a 24-well plate at a rate of 30 μL per well. The wells were left to stand at room temperature for 2 min, incubated at 37°C for 30 min, and 500 μL of organoid culture medium was added to the 24 wells. After 6 days of induction, human haploid placental organoids were obtained. Preferably, the organoid culture medium is based on Advanced DMEM / F12, supplemented with 1×N2 Supplement, 1×B27 Supplement minus vitamin A, 100ug / mL Primocin, 1.25mM N-acetyl-L-cysteine, 2mM L-glutamine, 500nM A83-01, 1.5μM CHIR99021, 2μM Y-27632, 50ng / mL rhEGF, 50ng / mLrhHGF, 80ng / mL rhR-Spondin1, 100ng / mL rhFGF2 and 2.5μM Prostaglandin E2.

8. The human haploid placental organoid prepared by the method for preparing human haploid placental organoid according to claim 6 or 7; Preferably, cells positive for the TSCs molecular marker CDH1 are located in the outer layer of the organoid, and cells positive for the STs molecular markers CGB and SDC1 are located in the inner layer of the organoid.

9. The method for differentiating human haploid trophoblast stem cells according to claim 5, characterized in that: Differentiate human haploid trophoblast stem cells into STs or into EVTs; Preferably, human haploid trophoblast stem cells are placed in a culture medium for STs differentiation to differentiate and obtain cell clusters with STs-specific molecular markers; Alternatively, human haploid trophoblast stem cells are placed in a culture medium for differentiation of EVTs to differentiate and obtain cell clusters with EVTs-specific molecular markers; Among them, the culture medium for STs differentiation was based on DMEM / F12, supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 2.5 μM Y27632, 2 μM Forskolin, and 4% KOSR; The EVTs differentiation medium was based on DMEM / F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.5% penicillin-streptomycin, 0.3% BSA, 1% ITS supplement, 100 ng / ml NRG1, 7.5 μM A83-01, 2.5 μM Y27632 and 4% KOSR.

10. Use of the human haploid trophoblast stem cells described in claim 5 and / or the human haploid placental organoids described in claim 8 in drug target research and genetic research.

Images