SNP (Single Nucleotide Polymorphism) molecular marker related to sheep horn length character and application thereof

Abstract

The invention belongs to the field of SNP (Single Nucleotide Polymorphism) detection, and particularly provides an SNP molecular marker related to a sheep horn length character and a kit for detecting the SNP molecular marker. The kit provided by the invention is used for performing polymorphism detection on the SNP molecular genetic marker, namely the 30947874th site of the 10th chromosome, screening and determining the horn length character of the sheep, and selecting the horn length character to breed or assist in breeding horn-free sheep individuals, so that the collection of high-quality horn-free Tibetan sheep variety germplasm resources can be ensured, and the kit has a very excellent application prospect.

Description

Technical Field

[0001] The invention belongs to the field of SNP technology, and in particular relates to a SNP molecular marker related to sheep horn length trait and an application thereof. Background Art

[0002] Tibetan sheep, also known as Tibetan sheep and Tibetan sheep, is one of the ancient sheep breeds in China. Due to its wide distribution and different geographical and climatic characteristics, it is divided into some unique types. Qinghai Province divides it into three types: plateau-type (grassland-type) Tibetan sheep, valley-type Tibetan sheep and Euler-type Tibetan sheep, of which more than 90% belong to the plateau type. The horns of the plateau-type Tibetan sheep are thick, long and flat, spiral or twisted, with the tip outward and extending to the left and right. The horns of the ewe are flat, slightly smaller than the horns of the rams, mostly twisted, and some are small columnar horns. Some rams and ewes are hornless. Under modern intensive breeding conditions, large horns can easily cause fighting injuries to livestock, thus affecting the quality of livestock carcasses and fur, and are prone to infection. In addition, the horns require more nutrients, so the cultivation of hornless sheep varieties is of great significance to the development of animal husbandry.

[0003] Early studies believed that three alleles located on the autosomal Ho locus regulate the horn and hornless phenotypes of sheep, namely HoP, Ho+ and Hoh1, among which Ho+ is the horn allele, Hoh1 is the sex-linked horn allele, and HoP is the hornless allele (Dolling CHS. Breeding Merinos. Rigby, Adelaide, Australia, 1970). In conventional breeding, in order to cultivate hornless varieties, the test cross method is often used to eliminate dominant hornless heterozygous genotype individuals, but the method of determining the genotype by test cross has a long cycle, even taking several generations to complete, and is costly and laborious. Molecular marker-assisted selection will provide new ideas and methods for the exploration and utilization of this special germplasm resource. Using modern molecular biological technology to explore and collect germplasm resources of hornless Tibetan sheep varieties and carry out molecular breeding of this variety is an important way to ensure the progress of breeding, and it is also the first step in the long-term cultivation of new hornless Tibetan sheep varieties (lines).

[0004] At present, relevant reports have found that there is a 1833 bp genomic insertion fragment in the 3'-UTR region of the RXFP2 gene (UniProt accession number Q91ZZ5) that is associated with the hornless phenotype (Wiedemar N, CA 1.8-kbinsertion in the 3'-UTR of RXFP2 is associated with polledness in sheep. Anim Genet, 2015, 46(4): 457-461), while the insertion fragment in this region only appears in the horn phenotype of some sheep breeds (Lühken G, Krebs S, Rothammer S, Küpper J, B, Russ I, Medugorac I. The 1.78-kb insertion in the3'-untranslated region of RXFP2 does not segregate withhorn status in sheep breeds with variable horn status. Genet Sel Evol, 2016, 48(1):78).

[0005] Studies have shown that the length, base circumference and volume of sheep horns can be moderately inherited, which means that horn length will affect the overall size or presence of horns to a certain extent, but there are no reports of a correlation between the 30947874 site of the RXFP2 gene on chromosome 10 (NC_056063.1) and horn length. Summary of the invention

[0006] The purpose of the present invention is to provide a new SNP of RXFP2 gene and use it to select the horn length trait of sheep, so as to obtain hornless sheep.

[0007] The present invention provides a reagent for detecting SNP molecular genetic markers associated with sheep horn length traits for use in breeding or assisting in breeding sheep breeds or strains associated with sheep horn length traits.

[0008] Select or assist in selecting sheep with shorter / longer horns;

[0009] The SNP molecular genetic marker associated with the sheep horn length trait is located at position 30947874 of chromosome 10 of the sheep reference genome, and the polymorphism is C or T.

[0010] Further, the dominant allele at position 30947874 in the sheep horn length trait is the C allele; the dominant genotype is the CC genotype; sheep with the CC genotype have short horns.

[0011] The present invention also provides a method for breeding or assisting in breeding a sheep breed or strain related to the sheep horn length trait, comprising the following steps:

[0012] Extract the total genomic DNA of the sheep sample to be tested, detect the deoxynucleotide at position 30947874 of chromosome 10 of the sheep reference genome, and measure the deoxynucleotide at position 30947874 to be T or C, and determine whether the genotype of the sheep is TT type, TC type or CC type;

[0013] The horns of sheep with CC genotype are shorter than those of sheep with TC genotype and TT genotype, and the horns of sheep with TC genotype are shorter than those of sheep with TT genotype.

[0014] Furthermore, the steps also include:

[0015] Take CC sheep individuals for the next step of breeding;

[0016] The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

[0017] Finally, the present invention provides a kit for detecting SNP molecular genetic markers related to the sheep horn length trait, which comprises a reagent for detecting the deoxynucleotide at position 30947874 of chromosome 10 of the sheep reference genome.

[0018] Furthermore, the reagent is a sequencing reagent, a PCR detection reagent, a reagent for a restriction fragment length polymorphism method, or a reagent for a single-stranded conformation polymorphism analysis.

[0019] Furthermore, the reagent is a competitive allele-specific PCR detection reagent, preferably including amplification primers shown in SEQ ID NO.1-2 and extension primers shown in SEQ ID NO.3.

[0020] The present invention also provides a use of the above-mentioned kit in breeding or assisting in breeding sheep breeds or strains related to sheep horn length traits.

[0021] Finally, the present invention provides a method for breeding sheep horn length traits using the above-mentioned kit, comprising the following steps:

[0022] 1) Extracting total genomic DNA from the sheep sample to be tested;

[0023] 2) using the aforementioned kit to perform PCR amplification on the total DNA obtained in step 1), and extending the amplified fragment;

[0024] 3) Sequencing the extended PCR product obtained in step 2) to determine whether the genotype of the sheep is TT, TC or CC based on the deoxynucleotide at position 30947874 on chromosome 10 of the sheep reference genome;

[0025] The horns of sheep with CC genotype are shorter than those of sheep with TC genotype and TT genotype, and the horns of sheep with TC genotype are shorter than those of sheep with TT genotype.

[0026] Furthermore, the steps also include:

[0027] Select individuals with CC type at position 30947874 on chromosome 10 of the sheep reference genome for the next step of breeding;

[0028] The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

[0029] The "breeding of sheep horn length traits" mentioned in the present invention refers to obtaining hornless sheep breeds by selecting and cultivating specific horn length trait characteristics during the breeding process.

[0030] The "hornless sheep" mentioned in the present invention include sheep that are completely hornless or have only residual horns.

[0031] The "rudimentary horn" mentioned in the present invention refers to an underdeveloped horn growing in the normal position on the skull where there is no horn. It is not attached to the skull and is in the shape of a bone protrusion.

[0032] The "horn length" mentioned in the present invention refers to the length of the arc from the base of the sheep's horn to the tip of the horn along the longitudinal edge on the back of the horn.

[0033] The present invention discovers for the first time that the polymorphism at the 30947874th site of the sheep reference genome chromosome 10 in the RXFP2 gene has a very strong correlation with the horn length of sheep (especially Tibetan sheep). The site can be used as a molecular genetic marker for the horn length trait of sheep. By detecting the SNP site, excellent sheep with short horn length traits can be screened, and hornless sheep can be bred or assisted in breeding, thereby effectively establishing a hornless Tibetan sheep population and constructing a sheep excellent horn length breeding system, providing precious genetic resources for the improvement of hornless sheep breeds, which is beneficial to improving the breeding process of high-quality hornless sheep breeds, and is also beneficial to improving the accuracy of hornless sheep selection.

[0034] The key to the present invention is to find that the polymorphism of the 30947874th site of the sheep reference genome chromosome 10 in the RXFP2 gene has a strong correlation with the horn length of sheep (especially Tibetan sheep). The horn length trait can be screened and determined by detecting the 30947874th site of the sheep reference genome chromosome 10, and then used for the breeding or auxiliary breeding of hornless sheep. Any method and reagent capable of detecting the 30947874th site of the sheep reference genome chromosome 10 can be used for the screening and determination of sheep with short horn length traits, and the transformation prospect is very broad.

[0035] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0036] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the overall technical flow chart for single nucleotide polymorphism detection of sheep RXFP2 gene.

[0038] Figure 2 This is the electrophoresis diagram of the quality inspection of the Tibetan sheep sample genome DNA (in the figure: 073-094 is the sample number, M is the schematic diagram of the Marker band, and the right side is the positive and negative controls respectively).

[0039] Figure 3 These are the typing results for position 30947874 of chromosome 10 of the Tibetan sheep sample (CC, TC, TT genotypes) (in the figure: CC is a black single peak, TC is a red and black double peak, and TT is a red single peak).

[0040] Figure 4 is the ROC curve. DETAILED DESCRIPTION

[0041] In order to understand the present invention more clearly, the present invention is further described with reference to the following examples and drawings. The examples are only used for explanation and are not intended to limit the present invention in any way.

[0042] The experimental methods without specific conditions in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the manufacturer; the various chemical reagents used in the examples are commercially available, and the primers used are commissioned for synthesis.

[0043] Example 1: Kit for detecting SNP molecular genetic markers associated with sheep horn length traits according to the present invention

[0044] The components of the SNaPshot kit of the present invention include:

[0045] Using the partial fragment of the RXFP2 gene at position 30947874 of chromosome 10 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template, primers were designed online using the primer design tool Primer3 plus:

[0046] (1) Reaction primer:

[0047] A: Amplification primers:

[0048] RXFP2-Primer1-F (SEQ ID NO.1):

[0049] ACTCCAAGGTCTGTTCTCTG

[0050] RXFP2-Primer1-R (SEQ ID NO.2):

[0051] TGTCTACCTAGAGGAAGACC

[0052] B: Extension primer (SEQ ID NO.3):

[0053] GTTTTGCACAGCCACATTCA

[0054] (2) Other reagents for SNaPshot reaction: 2×Taq PCR Master Mix, Exonclease I, ShrimpAlkaline Phosphatase, final extension reagent SNaPshot Multiple kit, molecular weight internal standard GeneScan TM 120LIZ、Hi-Di TM Formamide, POP-7 TM Polymer, 3730 Running Buffer (10X) and water.

[0055] Example 2 Method for detecting SNP molecular genetic markers associated with sheep horn length traits

[0056] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0057] (2) The SNaPshot of Example 1 is used to detect the deoxynucleotide at position 30947874 of chromosome 10 of the sheep reference genome, and the deoxynucleotide at position 30947874 is detected to be T or C, thereby determining whether the genotype of the sheep is TT, TC or CC.

[0058] Example 3 Using SNP molecular genetic markers associated with sheep horn length traits to breed sheep horn length traits, thereby obtaining hornless sheep

[0059] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0060] (2) The SNaPshot of Example 1 was used to detect the genotype of site 30947874 of chromosome 10 of the sheep reference genome, and sheep with CC genotype were selected for the next step of breeding to obtain hornless sheep.

[0061] The beneficial effects of the present invention are further illustrated by test examples below:

[0062] Experimental Example 1: Verification of the SNP molecular genetic markers associated with the sheep horn length trait of the present invention

[0063] The polymorphism at position 30947874 of chromosome 10 of the sheep sample was detected by SNaPshot sequencing, and it was revealed that the site has one of the molecular markers that can be used as the hornless trait in sheep breeding. The present invention is further described in detail below in conjunction with the accompanying drawings and experiments (see the process Figure 1 ), comprising the following steps:

[0064] (1) Extraction of genomic DNA

[0065] Tibetan sheep were selected as the experimental material. Ear edge tissue the size of mung bean was collected using ear picking forceps and stored in 75% alcohol for subsequent extraction of genomic DNA.

[0066] (2) Extraction of genomic DNA

[0067] DNA was extracted from the ear margin tissue of Tibetan sheep using a genomic DNA kit ( TIANamp Genomic DNA Kit) was used for extraction, and the extraction was performed strictly according to the operating instructions.

[0068] (3) Sample DNA quality testing

[0069] The concentration of the extracted genomic DNA was measured using Thermo Scientific's NanoDrop 8000 ultra-micro spectrophotometer. The results showed that the sample concentrations were all above 100 ng / μL, and the A260 / A280 values ​​were between 1.8-2.0. Good DNA electrophoresis results should be: ① The main band is bright and clear, without dragging, and the main band size is around 10 kb; ② If the main band becomes wider and darker, it indicates that the DNA is slightly degraded. If it becomes a diffuse DNA band, it indicates that the DNA is severely degraded; ③ If there is no band in the electrophoresis, it indicates that the total amount and concentration of the extracted DNA are extremely low, which is likely to cause PCR amplification failure. The electrophoresis results show that the genomic DNA bands are clear and free of impurities ( Figure 2 ), indicating that the extracted genomic DNA had good integrity and met the standards for subsequent experiments.

[0070] (4) Primer design

[0071] Using the partial fragment of the RXFP2 gene at position 30947874 of chromosome 10 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template, primers were designed online using the primer design tool Primer3 plus:

[0072] Amplification primers:

[0073] RXFP2-Primer1-F:

[0074] ACTCCAAGGTCTGTTCTCTG

[0075] RXFP2-Primer1-R:

[0076] TGTCTACCTAGAGGAAGACC

[0077] Extension Primer:

[0078] GTTTTGCACAGCCACATTCA

[0079] (5) PCR amplification

[0080] The extracted genomic DNA was used as a template, and the synthesized forward primer RXFP2-Primer1-F and reverse primer RXFP2-Primer1-R were used as the experimental primer set for PCR amplification. The specific reaction system and reaction procedure were as follows:

[0081] The reaction system was 10 μL: including 1.0 μL of genomic DNA (20 ng / μL), 5 μL of 2×Taq PCR Master Mix, 1.0 μL of multiple mixed primers (concentration 10 pmol / μL), and 3 μL of water.

[0082] The reaction procedure was as follows: ① pre-denaturation at 94.0°C for 5 min, 1 cycle; ② denaturation at 94.0°C for 20 sec, annealing at 60°C for 30 sec, renaturation / extension at 72°C for 30 sec, 35 cycles; ③ final extension at 72.0°C for 3 min.

[0083] (6) Alkaline phosphatase treatment of product

[0084] The PCR products were treated with shrimp alkaline phosphatase SAP (shrimp alkaline phosphatase) and alkaline phosphatase (ExoI) to remove free dNTPs in the system.

[0085] SAP Mix reaction components: 0.75 μL of ddH20, 0.5 μL of SAP (1 U / μL), 0.15 μL of ExoI (5 U / μL), 0.6 μL of 10*SAP buffer, and 4.0 μL of PCR product.

[0086] SAP reaction program: 37°C for 40 min; 85°C for 15 min; 4°C∞. Place the 384-well reaction plate on the PCR instrument and start the program.

[0087] (7) Single base extension reaction

[0088] After the alkaline phosphatase treatment, a single base extension reaction was performed with a total reaction system volume of 5 μL.

[0089] The extension reaction program was as follows: ① pre-denaturation at 95.0°C for 30 sec, 1 cycle; ② denaturation at 95.0°C for 5 sec, annealing at 52°C for 5 sec, renaturation / extension at 60°C for 5 sec, 35 cycles; ③ final extension at 72.0°C for 3 min.

[0090] (8) Sequencing

[0091] 2 μL of SNaPshot reaction product was added to 8 μL of deionized formamide containing 0.8% LIZ120, denatured at 95°C for 5 minutes, then quenched at -20°C, and then sequenced on 3730xL.

[0092] (8) SNP typing results

[0093] The genotype of the 30947874th position of chromosome 10 was determined according to the sequencing peak analysis results. The typing results are as follows: Figure 3 shown.

[0094] (9) Association analysis between RXFP2 genotype and horn length in Tibetan sheep

[0095] SPSS software GLM statistical model was used to estimate the genotype effect value of the gene.

[0096] Statistical model: Yijkl=μ+Gi+Aj+γk+El+ε, where Yijkl is the phenotypic value of the trait, μ is the population mean of the trait, Gi is the genotype effect value, Aj is the individual age effect, γk is the interannual effect, El is the permanent environmental effect, and ε is the residual effect.

[0097] (10) Analysis of the significance of differences between RXFP2 genotype and horn length of Tibetan sheep

[0098] A total of 1,126 Tibetan sheep were measured for their horn lengths, and a correlation analysis was performed on the genotype at position 30,947,874 on chromosome 10.

[0099] The experimental results were expressed as mean ± standard deviation, and SPSS29.0 statistical software ANOVA was used for significance analysis, with P < 0.05 as the standard for significant difference and P < 0.01 as the standard for extremely significant difference.

[0100] The typing results showed that there were 72 CC genotypes, with morphological characteristics of bony protrusions or complete absence of horns, which were almost invisible; there were 418 TC genotypes, with morphological characteristics of incompletely developed horns; and there were 636 TT genotypes, with morphological characteristics of normal large horns.

[0101] Table 1 Analysis of association between 30947874 loci of RXFP2 and horn length

[0102]

[0103] Note: Different capital letters in the same data indicate extremely significant differences (P<0.01).

[0104] The results of the correlation analysis between the 30947874th position of the RXFP2 gene on chromosome 10 and the angular length are shown in Table 1. As can be seen from Table 1, the angular lengths associated with the three genotypes of the RXFP2 gene mutation site are different, and are extremely significantly correlated with the angular length. The angular length of the TT genotype is extremely significantly higher than that of the CC and TC genotypes (P<0.01). The data in Table 1 are analyzed by ROC curve ( Figure 4 ) showed that the 30947874th locus had strong recognition performance for horn length variation (area under the ROC curve was 0.763; 95% confidence interval: 0.734-0.793, P = 5.6403E-52; sensitivity 78.9%, specificity 72.0%). Therefore, individuals with CC genotype can be screened to effectively form a hornless Tibetan sheep population, further clarify the molecular markers of horn length, and construct a molecular breeding system for excellent horn length in sheep, thereby increasing the proportion of hornless traits in the population and achieving the purpose of hornless breeding of this variety.

[0105] In summary, the present invention provides a SNP molecular genetic marker associated with the sheep horn length trait, and a kit for detecting the SNP molecular genetic marker. By using the kit of the present invention to perform polymorphism detection on the SNP molecular genetic marker, i.e., the 30947874th site of chromosome 10, the sheep horn length trait is determined, and the individuals used for hornless sheep breeding or auxiliary breeding are determined based on the horn length trait, it is ensured that high-quality hornless Tibetan sheep breed germplasm resources are collected, which has a very good application prospect.

Claims

1. Use of a reagent for detecting SNP molecular genetic markers associated with sheep horn length traits in breeding or assisting in breeding sheep breeds or strains associated with sheep horn length traits, characterized in that: Select or assist in selecting sheep with shorter / longer horns; The SNP molecular genetic marker associated with the sheep horn length trait is located at position 30947874 of chromosome 10 of the sheep reference genome, and the polymorphism is C or T.

2. The use according to claim 1, characterized in that: The dominant allele at position 30947874 in the sheep horn length trait is the C allele; the dominant genotype is the CC genotype; sheep with the CC genotype have short horns.

3. A method for selecting or assisting in the selection of a sheep breed or strain associated with a sheep horn length trait, characterized in that: The steps include: Extract the total genomic DNA of the sheep sample to be tested, detect the deoxynucleotide at position 30947874 of chromosome 10 of the sheep reference genome, and measure the deoxynucleotide at position 30947874 to be T or C, and determine whether the genotype of the sheep is TT type, TC type or CC type; The horns of sheep with CC genotype are shorter than those of sheep with TC genotype and TT genotype, and the horns of sheep with TC genotype are shorter than those of sheep with TT genotype.

4. The method according to claim 3, characterized in that: The steps also include: Take CC sheep individuals for the next step of breeding; The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

5. A kit for detecting SNP molecular genetic markers associated with sheep horn length traits, characterized in that: It includes reagents for detecting deoxynucleotides at position 30947874 of chromosome 10 of the sheep reference genome.

6. The kit according to claim 5, characterized in that: The reagents are sequencing reagents, PCR detection reagents, reagents for restriction fragment length polymorphism methods or reagents for single-strand conformation polymorphism analysis.

7. The kit according to claim 6, characterized in that: The reagent is a competitive allele-specific PCR detection reagent, preferably including amplification primers shown in SEQ ID NO.1-2 and extension primers shown in SEQ ID NO.

3.

8. Use of the kit according to any one of claims 5 to 7 in breeding or assisting in breeding of sheep breeds or strains associated with sheep horn length traits.

9. A method for breeding sheep horn length traits using the kit according to any one of claims 5 to 7, characterized in that: The steps include: 1) Extracting total genomic DNA from the sheep sample to be tested; 2) using the kit according to any one of claims 5 to 7 to perform PCR amplification on the total DNA obtained in step 1), and extending the amplified fragment; 3) Sequencing the extended PCR product obtained in step 2) to determine whether the genotype of the sheep is TT, TC or CC based on the deoxynucleotide at position 30947874 on chromosome 10 of the sheep reference genome; The horns of sheep with CC genotype are shorter than those of sheep with TC genotype and TT genotype, and the horns of sheep with TC genotype are shorter than those of sheep with TT genotype.

10. The method according to claim 9, characterized in that: The steps also include: Select individuals with CC type at position 30947874 on chromosome 10 of the sheep reference genome for the next step of breeding; The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

Images