SNP (Single Nucleotide Polymorphism) molecular marker related to sheep horn base perimeter character and application of SNP molecular marker

Abstract

The invention belongs to the field of SNP (Single Nucleotide Polymorphism) detection, and particularly provides an SNP molecular marker related to a sheep horn base perimeter character and a kit for detecting the SNP molecular marker. The kit disclosed by the invention is used for carrying out polymorphism detection on the SNP molecular genetic marker, namely the 30943037th site of the 10th chromosome, screening and determining the horn base perimeter character of the sheep, and selecting the horn base perimeter character to breed or assist to breed a horn-free sheep individual, so that a high-quality horn-free Tibetan sheep variety germplasm resource can be collected, and the kit has a very good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of SNP technology, and in particular relates to a SNP molecular marker related to sheep horn base circumference traits and an application thereof. Background Art

[0002] Tibetan sheep, also known as Tibetan sheep and Tibetan sheep, is one of the ancient sheep breeds in China. Due to its wide distribution and different geographical and climatic characteristics, it is divided into some unique types. Qinghai Province divides it into three types: plateau-type (grassland-type) Tibetan sheep, valley-type Tibetan sheep and Euler-type Tibetan sheep, of which more than 90% belong to the plateau type. The horns of the plateau-type Tibetan sheep are thick, long and flat, spiral or twisted, with the tip outward and extending to the left and right. The horns of the ewe are flat, slightly smaller than the horns of the rams, mostly twisted, and some are small columnar horns. Some rams and ewes are hornless. Under modern intensive breeding conditions, large horns can easily cause fighting injuries to livestock, thus affecting the quality of livestock carcasses and fur, and are prone to infection. In addition, the horns require more nutrients, so the cultivation of hornless sheep varieties is of great significance to the development of animal husbandry.

[0003] Early studies believed that three alleles located on the autosomal Ho locus regulate the horn and hornless phenotypes of sheep, namely HoP, Ho+ and Hoh1, among which Ho+ is the horn allele, Hoh1 is the sex-linked horn allele, and HoP is the hornless allele (Dolling CHS. Breeding Merinos. Rigby, Adelaide, Australia, 1970). In conventional breeding, in order to cultivate hornless varieties, the test cross method is often used to eliminate dominant hornless heterozygous genotype individuals, but the method of determining the genotype by test cross has a long cycle, even taking several generations to complete, and is costly and laborious. Molecular marker-assisted selection will provide new ideas and methods for the exploration and utilization of this special germplasm resource. Using modern molecular biological technology to explore and collect germplasm resources of hornless Tibetan sheep varieties and carry out molecular breeding of this variety is an important way to ensure the progress of breeding, and it is also the first step in the long-term cultivation of new hornless Tibetan sheep varieties (lines).

[0004] At present, relevant reports have found that there is a 1833 bp genomic insertion fragment in the 3'-UTR region of the RXFP2 gene (UniProt accession number Q91ZZ5) that is associated with the hornless phenotype (Wiedemar N, CA 1.8-kbinsertion in the 3'-UTR of RXFP2 is associated with polledness in sheep. Anim Genet, 2015, 46(4): 457-461), while the insertion fragment in this region only appears in the horn phenotype of some sheep breeds (Lühken G, Krebs S, Rothammer S, Küpper J, B, Russ I, Medugorac I. The 1.78-kb insertion in the3'-untranslated region of RXFP2 does not segregate withhorn status in sheep breeds with variable horn status. Genet Sel Evol, 2016, 48(1):78).

[0005] Studies have shown that the length, base circumference and volume of sheep horns can be moderately inherited, which means that the base circumference of the horn will affect the overall size or presence of the horn to a certain extent. However, there are no reports on the correlation between the 30943037 site of chromosome 10 (NC_056063.1) of the RXFP2 gene and the base circumference of the horn. Summary of the invention

[0006] The purpose of the present invention is to provide a new SNP of RXFP2 gene and use it to select the horn base circumference trait of sheep, so as to obtain hornless sheep.

[0007] The present invention provides a reagent for detecting SNP molecular genetic markers associated with sheep horn base circumference traits in breeding or assisting in breeding sheep breeds or strains associated with sheep horn base circumference traits, breeding or assisting in breeding sheep with short / long horn base circumferences;

[0008] The SNP molecular genetic marker associated with the sheep horn base circumference trait is located at position 30943037 of chromosome 10 of the sheep reference genome, and the polymorphism is G or A.

[0009] Further, the dominant allele at position 30943037 in the sheep horn base circumference trait is the G allele; the dominant genotype is the GG genotype; and sheep with the GG genotype have a short horn base circumference.

[0010] The present invention also provides a method for breeding or assisting in breeding a sheep breed or strain related to the sheep horn base circumference trait, comprising the following steps:

[0011] Extract the total genomic DNA of the sheep sample to be tested, detect the deoxynucleotide at position 30943037 of chromosome 10 of the sheep reference genome, and measure the deoxynucleotide at position 30943037 to be G or A, and determine whether the genotype of the sheep is GG, GA or AA;

[0012] The horn base circumference of GG genotype sheep was shorter than that of GA genotype sheep and AA genotype sheep, and the horn base circumference of GA genotype sheep was shorter than that of AA genotype sheep.

[0013] Furthermore, the steps also include:

[0014] Take the GG sheep individuals for the next step of breeding;

[0015] The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

[0016] The present invention also provides a kit for detecting SNP molecular genetic markers related to the sheep horn base perimeter trait, which comprises a reagent for detecting deoxynucleotides at position 30943037 of chromosome 10 of the sheep reference genome.

[0017] Furthermore, the reagent is a sequencing reagent, a PCR detection reagent, a reagent for a restriction fragment length polymorphism method, or a reagent for a single-stranded conformation polymorphism analysis.

[0018] Furthermore, the reagent is a competitive allele-specific PCR detection reagent, preferably including amplification primers shown in SEQ ID NO.1-2.

[0019] The present invention also provides a use of the above-mentioned kit in breeding or assisting in breeding sheep breeds or strains related to sheep horn base circumference traits.

[0020] Finally, the present invention provides a method for breeding or assisting in breeding sheep breeds or strains related to the sheep horn base circumference trait using the above-mentioned kit, comprising the following steps:

[0021] 1) Extracting total genomic DNA from the sheep sample to be tested;

[0022] 2) using the aforementioned kit to perform PCR amplification on the total DNA obtained in step 1) to obtain a PCR amplification product;

[0023] 3) Sequencing the amplified PCR product obtained in step 2) to determine whether the genotype of the sheep is GG, GA or AA based on the deoxynucleotide at position 30943037 on chromosome 10 of the sheep reference genome;

[0024] The horn base circumference of GG genotype sheep was shorter than that of GA genotype sheep and AA genotype sheep, and the horn base circumference of GA genotype sheep was shorter than that of AA genotype sheep.

[0025] Furthermore, the steps also include:

[0026] Individuals with the GG type at locus 30943037 on chromosome 10 of the sheep reference genome were selected for the next step of breeding;

[0027] The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

[0028] The "breeding of sheep for horn base circumference traits" mentioned in the present invention refers to obtaining hornless sheep varieties by selecting and cultivating specific horn base circumference trait characteristics during the breeding process.

[0029] The "hornless sheep" mentioned in the present invention include sheep that are completely hornless or have only residual horns.

[0030] The "rudimentary horn" mentioned in the present invention refers to an underdeveloped horn growing in the normal position on the skull where there is no horn. It is not attached to the skull and is in the shape of a bone protrusion.

[0031] The horn base perimeter mentioned in the present invention refers to the perimeter or cross-sectional size of the base of the sheep horn (i.e., the part where the horn connects to the skull).

[0032] The present invention discovers for the first time that the polymorphism of the 30943037th site of the RXFP2 gene located on chromosome 10 of the sheep reference genome has a very strong correlation with the horn base circumference of sheep (especially Tibetan sheep). The site can be used as a molecular genetic marker for the horn base circumference trait of sheep. By detecting the SNP site, excellent sheep with short horn base circumference traits can be screened, and hornless sheep can be bred or assisted in breeding, thereby effectively forming a hornless Tibetan sheep population and constructing a sheep excellent horn length breeding system, providing precious genetic resources for the improvement of hornless sheep breeds, which is beneficial to improving the breeding process of high-quality hornless sheep breeds, and is also beneficial to improving the accuracy of hornless sheep selection.

[0033] The key to the present invention is to find that the polymorphism of the 30943037th site of the sheep reference genome chromosome 10 in the RXFP2 gene has a strong correlation with the horn base circumference of sheep (especially Tibetan sheep). The horn base circumference trait can be screened and determined by detecting the 30943037th site of the sheep reference genome chromosome 10, and then used for the breeding or auxiliary breeding of hornless sheep. Any method and reagent capable of detecting the 30943037th site of the sheep reference genome chromosome 10 can be used for the screening and determination of sheep with short horn base circumference traits, and the transformation prospects are very broad.

[0034] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0035] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the overall technical flow chart for single nucleotide polymorphism detection of sheep RXFP2 gene.

[0037] Figure 2 This is the electrophoresis diagram of the quality inspection of the Tibetan sheep sample genome DNA (in the figure: 073-094 is the sample number, M is the schematic diagram of the Marker band, and the right side is the positive and negative controls respectively).

[0038] Figure 3 Amplify the band.

[0039] Figure 4 This is the typing result of the 30943037th position of chromosome 10 of the Tibetan sheep sample (GG, GA, AA genotypes) (in the figure: GG is a black single peak, GA is a black-green double peak, and AA is a green single peak)

[0040] Figure 5 is the ROC curve. DETAILED DESCRIPTION

[0041] In order to understand the present invention more clearly, the present invention is further described with reference to the following examples and drawings. The examples are only used for explanation and are not intended to limit the present invention in any way.

[0042] The experimental methods without specific conditions in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the manufacturer; the various chemical reagents used in the examples are commercially available, and the primers used are commissioned for synthesis.

[0043] Example 1: Kit for detecting SNP molecular genetic markers associated with sheep horn base circumference traits of the present invention

[0044] The components of the Sanger kit of the present invention include:

[0045] Using the partial fragment of the RXFP2 gene at position 30943037 of chromosome 10 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template, primers were designed online using the primer design tool Primer3 plus:

[0046] (1) Sanger reaction primers:

[0047] RXFP2-Primer1-F (SEQ ID NO.1):

[0048] GACACATTAGCAATATAACC

[0049] RXFP2-Primer1-R (SEQ ID NO.2):

[0050] GTCGGTGATGCCATCCAATT

[0051] (2) Other reagents for Sanger reaction: PCR Master Mix.

[0052] Example 2 Method for detecting SNP molecular genetic markers associated with sheep horn base circumference trait

[0053] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0054] (2) The Sanger kit of Example 1 is used to detect the deoxynucleotide at position 30943037 of chromosome 10 of the sheep reference genome, and the deoxynucleotide at position 30943037 is detected to be G or A, thereby determining that the genotype of the sheep is GG, GA or AA.

[0055] Example 3 Using SNP molecular genetic markers associated with the sheep horn base circumference trait to breed sheep horn base circumference traits, thereby obtaining hornless sheep

[0056] (1) Extracting total genomic DNA from the sheep sample to be tested;

[0057] (2) The Sanger kit of Example 1 was used to detect the genotype of site 30943037 of chromosome 10 of the sheep reference genome, and sheep with the GG genotype were selected for the next step of breeding to obtain hornless sheep.

[0058] The beneficial effects of the present invention are further illustrated by test examples below:

[0059] Test Example 1: Verification of the SNP molecular genetic markers associated with the sheep horn base circumference trait of the present invention

[0060] The polymorphism at position 30943037 of chromosome 10 of sheep samples was detected by SNaPshot typing and sequencing technology, and it was revealed that the site has one of the molecular markers that can be used as the hornless trait in sheep breeding. The present invention is further described in detail below in conjunction with the accompanying drawings and experiments (see the process Figure 1 ), comprising the following steps:

[0061] (1) Extraction of genomic DNA

[0062] Tibetan sheep were selected as the experimental material. Ear edge tissue the size of mung bean was collected using ear picking forceps and stored in 75% alcohol for subsequent extraction of genomic DNA.

[0063] (2) Extraction of genomic DNA

[0064] DNA was extracted from the ear margin tissue of Tibetan sheep using a genomic DNA kit ( TIANamp Genomic DNA Kit) was used for extraction, and the extraction was performed strictly according to the operating instructions.

[0065] (3) Sample DNA quality testing

[0066] The concentration of the extracted genomic DNA was measured using Thermo Scientific's NanoDrop 8000 ultra-micro spectrophotometer. The results showed that the sample concentrations were all above 100 ng / μL, and the A260 / A280 values ​​were between 1.8-2.0. Good DNA electrophoresis results should be: ① The main band is bright and clear, without dragging, and the main band size is around 10 kb; ② If the main band becomes wider and darker, it indicates that the DNA is slightly degraded. If it becomes a diffuse DNA band, it indicates that the DNA is severely degraded; ③ If there is no band in the electrophoresis, it indicates that the total amount and concentration of the extracted DNA are extremely low, which is likely to cause PCR amplification failure. The electrophoresis results show that the genomic DNA bands are clear and free of impurities ( Figure 2 ), indicating that the extracted genomic DNA had good integrity and met the standards for subsequent experiments.

[0067] (4) Primer design

[0068] Using the partial fragment of the RXFP2 gene at position 30943037 of chromosome 10 of the sheep reference genome ARS-UI_Ramb_v2.0 as a template, primers were designed online using the primer design tool Primer3 plus:

[0069] Amplification primers:

[0070] RXFP2-Primer1-F:

[0071] GACACATTAGCAATATAACC

[0072] RXFP2-Primer1-R:

[0073] GTCGGTGATGCCATCCAATT

[0074] (5) PCR amplification

[0075] The extracted genomic DNA was used as a template, and the synthesized forward primer RXFP2-Primer1-F and reverse primer RXFP2-Primer1-R were used as the experimental primer set for PCR amplification. The specific reaction system and reaction procedure were as follows:

[0076] The reaction system was 15 μL: including 1.0 μL of genomic DNA (20 ng / μL), 13 μL of 1×Taq PCR Master Mix, 0.5 μL of upstream primer (concentration 10 pmol / μL), and 0.5 μL of downstream primer (concentration 10 pmol / μL).

[0077] The reaction procedure was as follows: ① pre-denaturation at 95.0°C for 5 min, 1 cycle; ② denaturation at 95.0°C for 30 sec, annealing at 60°C for 30 sec, renaturation / extension at 72°C for 30 sec, 35 cycles; ③ final extension at 72.0°C for 3 min.

[0078] (6) PCR product electrophoresis identification

[0079] After PCR amplification, 2 μL of PCR product was taken for agarose gel electrophoresis (1% concentration). The amplified fragment was the same size as the target fragment and there was no non-specific amplified band ( Figure 3 ) to proceed to the next step.

[0080] (7) Sanger sequencing

[0081] According to the results of PCR product electrophoresis, the PCR products that met the target fragment size were subjected to Sanger sequencing, and the sequencing platform was ABI's 3730xL DNA Analyzer sequencer.

[0082] (8) SNP typing results

[0083] The genotype of the 30943037th position of chromosome 10 was determined according to the sequencing peak analysis results. The typing results are as follows: Figure 4 shown.

[0084] (9) Association analysis between RXFP2 genotype and horn base circumference of Tibetan sheep

[0085] SPSS software GLM statistical model was used to estimate the genotype effect value of the gene.

[0086] Statistical model: Yijkl=μ+Gi+Aj+γk+El+ε, where Yijkl is the phenotypic value of the trait, μ is the population mean of the trait, Gi is the genotype effect value, Aj is the individual age effect, γk is the interannual effect, El is the permanent environmental effect, and ε is the residual effect.

[0087] (10) Analysis of the significance of the difference between RXFP2 genotype and horn base circumference of Tibetan sheep

[0088] A total of 1008 Tibetan sheep were measured for their horn base circumferences, and a correlation analysis was performed on the genotype at position 30943037 of chromosome 10.

[0089] The experimental results were expressed as mean ± standard deviation, and SPSS29.0 statistical software ANOVA was used for significance analysis, with P < 0.05 as the standard for significant difference and P < 0.01 as the standard for extremely significant difference.

[0090] The typing results showed that there were 270 GG genotypes, with morphological traits of protruding horns or complete absence of horns, which were almost invisible; there were 433 GA genotypes, with morphological traits of incompletely developed horns; and there were 305 AA genotypes, with morphological traits of normal large horns.

[0091] Table 1 Correlation analysis between 30943037 loci of RXFP2 and angular base circumference

[0092]

[0093] Note: Different capital letters in the same data indicate extremely significant differences (P<0.01).

[0094] The results of the correlation analysis between the 30943037 position genotype of chromosome 10 of the RXFP2 gene and the horn base perimeter are shown in Table 1. As can be seen from Table 1, the horn base perimeters associated with the three genotypes of the RXFP2 gene mutation site are different, and are extremely significantly correlated with the horn base perimeter. The horn base perimeter of the AA genotype is extremely significantly higher than that of the GG genotype and the GA genotype (P<0.01). The data in Table 1 are analyzed by ROC curve ( Figure 5 ) showed that the 30943037th locus had strong recognition performance for the variation of horn base circumference trait (area under the ROC curve was 0.711; 95% confidence interval: 0.678-0.743, P = 2.0123E-26; sensitivity 83.0%, specificity 57.0%). Therefore, individuals with the GG genotype can be screened to effectively form a hornless Tibetan sheep population, further clarify the molecular markers of horn base circumference, and construct a molecular breeding system for excellent horn base circumference of sheep, thereby increasing the proportion of hornless traits in the population and achieving the purpose of hornless breeding of this variety.

[0095] In summary, the present invention provides a SNP molecular genetic marker associated with the sheep horn base circumference trait, and a kit for detecting the SNP molecular genetic marker. By using the kit of the present invention to perform polymorphism detection on the SNP molecular genetic marker, i.e., the 30943037th site of chromosome 10, the sheep horn base circumference trait is further determined, and the individuals used for hornless sheep breeding or auxiliary breeding are determined based on the horn base circumference trait, it is ensured that high-quality hornless Tibetan sheep breed germplasm resources are collected, which has very good application prospects.

Claims

1. Use of a reagent for detecting SNP molecular genetic markers associated with sheep horn base circumference traits in breeding or assisting in breeding sheep breeds or strains associated with sheep horn base circumference traits, characterized in that: Select or assist in selecting sheep with shorter / longer horn base circumference; The SNP molecular genetic marker associated with the sheep horn base circumference trait is located at position 30943037 of chromosome 10 of the sheep reference genome, and the polymorphism is G or A.

2. The use according to claim 1, characterized in that: The dominant allele at position 30943037 for the sheep horn base circumference trait is the G allele; the dominant genotype is the GG genotype; sheep with the GG genotype have short horn base circumference.

3. A method for selecting or assisting in the selection of a sheep breed or strain associated with a sheep horn base circumference trait, characterized in that: The steps include: Extract the total genomic DNA of the sheep sample to be tested, detect the deoxynucleotide at position 30943037 of chromosome 10 of the sheep reference genome, and measure the deoxynucleotide at position 30943037 to be G or A, and determine whether the genotype of the sheep is GG, GA or AA; The horn base circumference of GG genotype sheep was shorter than that of GA genotype sheep and AA genotype sheep, and the horn base circumference of GA genotype sheep was shorter than that of AA genotype sheep.

4. The method according to claim 3, characterized in that: The steps also include: Take the GG sheep individuals for the next step of breeding; The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

5. A kit for detecting SNP molecular genetic markers associated with sheep horn base circumference traits, characterized in that: It includes reagents for detecting deoxynucleotides at position 30943037 of chromosome 10 of the sheep reference genome.

6. The kit according to claim 5, characterized in that: The reagents are sequencing reagents, PCR detection reagents, reagents for restriction fragment length polymorphism methods or reagents for single-strand conformation polymorphism analysis.

7. The kit according to claim 6, characterized in that: The reagent is a competitive allele-specific PCR detection reagent, preferably including amplification primers shown in SEQ ID NO.1-2.

8. Use of the kit according to any one of claims 5 to 7 in breeding or assisting in breeding of sheep breeds or strains associated with the sheep horn base circumference trait.

9. A method for breeding or assisting in breeding a sheep breed or strain related to the sheep horn base circumference trait using the kit according to any one of claims 5 to 7, characterized in that: The steps include: 1) Extracting total genomic DNA from the sheep sample to be tested; 2) using the kit according to any one of claims 5 to 7 to perform PCR amplification on the total DNA obtained in step 1) to obtain a PCR amplification product; 3) Sequencing the PCR amplification product obtained in step 2) to determine whether the genotype of the sheep is GG, GA or AA based on the deoxynucleotide at position 30943037 on chromosome 10 of the sheep reference genome; The horn base circumference of GG genotype sheep was shorter than that of GA genotype sheep and AA genotype sheep, and the horn base circumference of GA genotype sheep was shorter than that of AA genotype sheep.

10. The method according to claim 9, characterized in that: The steps also include: Individuals with the GG type at locus 30943037 on chromosome 10 of the sheep reference genome were selected for the next step of breeding; The sheep are Tibetan sheep, and preferably, the sheep are plateau Tibetan sheep.

Images