Application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus

Abstract

The present invention discloses the application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus. FCGRT and overexpression FCGRT Experiments have found that FcRn has a positive regulatory effect on porcine reproductive and respiratory syndrome virus (PRRSV) infection. Experiments using specific anti-FcRn IgG or normal IgG to block FcRn further revealed that blocking FcRn can inhibit PRRSV proliferation. Subsequently, CRISPR / Cas9 gene editing technology was used to knock out and restore FcRn. FcRn Experiments further confirmed that FcRn is an essential receptor for PRRSV infection. Subsequently, FcRn was identified as involved in PRRSV uncoating and found to interact with the M and N proteins of PRRSV in early endosomes. Therefore, FcRn may serve as a target for breeding PRRS-resistant pigs, as well as for developing antiviral vaccines and drugs.

Description

Technical Field

[0001] The present invention belongs to the fields of animal genetic engineering and biomedicine, and particularly relates to the application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a highly contagious disease caused by the PRRS virus (PRRSV), characterized by reproductive failure in sows and respiratory distress in pigs of all ages (Pejsak et al. 1997). Since its outbreak in North America and Europe in the late 1980s, the disease has caused significant losses to the global swine industry (Neumann et al. 2005, Tian et al. 2007). The current prevalence of PRRS in my country is as follows: Lineage 1 PRRSV (NADC30-like and NADC34-like) belonging to PRRSV-2 is the predominant strain, with Lineage 8, Lineage 5, and Lineage 3 PRRSV coexisting (Zhang Hongliang 2022). PRRSV-1 is circulating in many areas of China, but detection rates are low (Tan Feifei et al. 2022). PRRSV has high variability. Currently, commercial inactivated vaccines and live attenuated vaccines can only provide partial protection for pigs infected with Lineage 1 PRRSV (Wei et al 2019, Li et al 2022). Vaccines against NADC30-like and NADC34-like strains have not yet been developed. At the same time, my country has not yet approved a PRRSV-1 vaccine. The situation of PRRS prevention and control in my country is complex and severe.

[0003] Foreign research teams have developed gene-edited pigs that are resistant to PRRSV infection by lacking the CD163 SRCR5 gene (Whitworth et al. 2016) and have applied for a patent (Lillico et al. 2019). Therefore, the search for new host factors or receptors that are resistant to PRRSV infection has important scientific significance and great application value.

[0004] The neonatal Fc receptor (FcRn) is the sole transport receptor for IgG, and its biological function is achieved through a heterodimer composed of a heavy chain (the α chain encoded by the FCGRT gene) and a light chain (β2-microglobulin, β2m, encoded by the B2M gene) (Simister and Mostov 1989). Recent studies have found that FcRn is an uncoating receptor for some enteroviruses (Usoltseva et al 2019, Zhao et al 2019, Vandesande et al 2020, Chen et al 2022). However, whether FcRn affects PRRSV infection has not been reported in China. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The protection scope of the present invention includes:

[0008] Application of animal FcRn protein in controlling the infectivity of porcine reproductive and respiratory syndrome virus.

[0009] The applications mentioned above are as follows:

[0010] The invention relates to the use of an animal FcRn protein blocker or expression inhibitor in the preparation of a drug for resisting porcine reproductive and respiratory syndrome virus infection, wherein the FcRn protein is a neonatal Fc receptor protein.

[0011] In the above application, preferably, the animal FcRn protein blocker comprises: animal FcRn protein antibody or animal IgG;

[0012] In the above application, preferably, the animal IgG includes pig IgG, rabbit IgG and / or mouse IgG.

[0013] In the above application, preferably, the animal FcRn protein antibody is FCGRT and / or B2M antibody;

[0014] In the above-mentioned application, the inhibitor of animal FcRn protein expression targets inhibitors of genes encoding the heavy chain and / or light chain of animal FcRn protein.

[0015] In the above-mentioned application, the inhibitor is a gRNA, antisense RNA or small interfering RNA targeting the heavy chain and / or light chain encoding gene of the animal FcRn protein.

[0016] In the above application, preferably, the animals include pigs or green monkeys.

[0017] In the above application, preferably, the heavy chain is the porcine FCGRT gene, with GenBank accession number XM_021093554.1; the light chain is the porcine B2M gene, with GenBank accession number XR_002345118.1.

[0018] In the above application, preferably, the heavy chain is the FCGRT gene of the green monkey, with GenBank accession number XM_037991921.1; the light chain is the B2M gene of the green monkey, with GenBank accession number XM_038009930.1.

[0019] In the above application, preferably, the inhibitor against the gene encoding the heavy chain of the porcine FcRn protein is shRNA: GGAACAAGCAGAAGCTCTTTC, GCGAGGAGTTTATGAAGTTCG, GGTCGTCGCTAAC AGTCAAGA and GCTTCCTACTGCTCTTGATCG.

[0020] In the above-mentioned application, preferably, the inhibitor of the heavy chain encoding gene of the green monkey FcRn protein is sgRNA: CCTGAGCTACGATAGCCTG and / or the light chain encoding gene sgRNA: ACCCAGACACATAGCAATT C.

[0021] A method for preparing cells resistant to porcine reproductive and respiratory syndrome virus infection comprises knocking out or inhibiting the heavy chain and / or light chain encoding genes of FcRn protein in the cells.

[0022] A method for preparing cells susceptible to porcine reproductive and respiratory syndrome virus comprises overexpressing animal FcRn protein in the cells.

[0023] The cells prepared by the method described above are used to prepare a porcine reproductive and respiratory syndrome virus susceptible cell model.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] The present invention first discovered that FcRn has a positive regulatory effect on PRRS V infection through experiments specifically knocking down FCGRT and overexpressing FCGRT with shRNA. Then, experiments blocking FcRn with specific anti-FcRn IgG or normal IgG further revealed that blocking FcRn inhibited PRRSV proliferation. Then, experiments using CRISPR / Cas9 gene editing technology to knock out and complement FcRn confirmed that FcRn is an indispensable receptor for PRRSV infection. Subsequently, adsorption, internalization, and IFA experiments confirmed that FcRn is involved in PRRSV uncoating. Finally, confocal microscopy and immunoprecipitation experiments revealed that FcRn interacts with the M and N proteins of PRRSV in early endosomes. This invention provides a new target for the development of effective drugs for the prevention and treatment of PRRS and also provides a new candidate gene for breeding research on PRRS-resistant pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Effects of FcRn knockdown and overexpression on PRRSV infection

[0027] A: Western blot analysis of the efficiency of FCGRT knockdown by shRNAs and the effect of FCGRT knockdown on CD163 expression; B: Western blot analysis of the effect of FCGRT knockdown on nsp1α and N protein expression in PRRSV-2FJ strain; C: Western blot analysis of the effect of FCGRT knockdown on N protein expression in PRRSV-2SH strain; D: qPCR analysis of the effect of FCGRT knockdown on ORF7 gene expression in PRRSV-1SH2022 strain; E: Western blot analysis of the effect of pFCGR T overexpression on PRRSV N protein expression; F: Western blot analysis of the effect of mkFCGRT overexpression on PRRSV N protein expression. GAPDH was used as an internal control. Differences between groups were analyzed using a two-tailed unpaired t-test. ANOVA analysis was performed for three or more groups. "ns" indicates no significant difference (p>0.05) and "***" indicates p<0.001.

[0028] Figure 2 :Effects of specific anti-FcRn IgG and normal IgG blocking on PRRSV infection

[0029] Among them: A: Western blot detection of the effect of FCGRT polyclonal antibody on the expression of PRRSV-2FJ strain N protein in MARC-145 cells; B: Western blot detection of the effect of B2M monoclonal antibody on the expression of PRRSV-2FJ strain N protein in MARC-145 cells; C: Western blot detection of the effect of B2M monoclonal antibody on the expression of PRRSV-2FJ strain N protein in PAMs; D: Western blot detection of the effect of porcine IgG on the expression of PRRSV-2FJ strain N protein in PAMs; E: Western blot detection of the effect of rabbit IgG on the expression of PRRSV-2FJ strain N protein in PAMs; F: Western blot detection of the effect of mouse IgG on the expression of PRRSV-2FJ strain N protein in PAMs, GAPDH was used as an internal control.

[0030] Figure 3 :Effects of FcRn knockout on PRRSV infection

[0031] Among them: A: Western blot detection of FCGRT, B2M, and CD163 expressions in three monoclonal cells; B: Bright field observation of cell CPE and IFA detection of PRRSV-2FJ strain N protein expression; C: Western blot detection of PRRSV-2FJ strain N protein expression in supernatants and cell lysates of three single-gene knockout cells; D: qPCR detection of the copy number of PRRSV-2FJ strain ORF7 gene in three single-gene knockout cells; E: Western blot detection of PRRSV-2XJ strain, JXA1-R strain, and R98 strain N protein expression in three single-gene knockout cells; F: TCID 50 The proliferation of the PRRSV-2FJ strain in three single-gene knockout cell lines was examined. GAPDH was used as an internal control. Differences between groups were analyzed using a two-tailed unpaired t-test. ANOVA was used for analysis of three or more groups. "ns" indicates no significant difference (p > 0.05), and "****" indicates p < 0.0001.

[0032] Figure 4 :The effect of FcRn complementation on PRRSV proliferation

[0033] A: Western blot analysis of the expression of PRRSV N protein in FCGRT-KO and B2M-KO cells after complementation of FCGRT and B2M, respectively; B: Western blot analysis of the expression of PRRSV N protein in FCGRT-KO+FCGRT and B2M-KO+B2M cells; C: TCID 50 Detection of PRRSV titer in the supernatant of FCGRT-KO+FCGRT and B2M-KO+B2M cells; D: Western blot detection of the expression of FCGRT of different species after complementation in FCGRT-KO cells and the expression of N protein after PRRSV infection; E: TCID 50 PRRSV titers in the supernatant of FCGRT-KO cells were measured after complementation with FCGRT from different species. GAPDH was used as an internal control. Differences between groups were analyzed using a two-tailed unpaired t-test. ANOVA was used for analysis of three or more groups. "ns" indicates no significant difference (p > 0.05), "***" indicates p < 0.001, and "****" indicates p < 0.0001.

[0034] Figure 5 :FcRn is involved in PRRSV uncoating

[0035] A and C, respectively, examined the effects of FcRn knockout on PRRSV adhesion and internalization by qPCR; B and D, respectively, examined the effects of FCGRT knockout on PRRSV adhesion and internalization by LSCM; E: IFA assay of nsp2 expression in WT and three KO cells 24 hours after PRRSV infection. Differences between groups were analyzed using a two-tailed unpaired t-test. ANOVA was used for analyses involving three or more groups. "ns" indicates no significant difference (p > 0.05).

[0036] Figure 6 :FcRn interacts with PRRSV in early endosomes

[0037] Among them: A: LSCM detection of the localization of FcRn, EEA1, and PRRSV in MARC-145 cells; B: LSCM detection of the localization of FcRn, CD163, and PRRSV in MARC-145 cells; C: Co-IP detection of the interaction between FcRn and PRRSV protein at different pH values; D and E are Co-IP detections of the interaction between FcRn and PRRSV protein in MARC-145 cells and PAMs at pH 6.0, respectively; F: Co-IP detection of the interaction between Fc Rn and PRRSV N protein in HEK-293T cells transfected with plasmids; G: Co-IP verification of the lack of interaction between FcRn and CD163 in MARC-145 cells. DETAILED DESCRIPTION

[0038] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field; the reagents or materials described are all from commercial channels unless otherwise specified.

[0039] Example 1: Effects of knockdown and overexpression of FcRn on PRRSV infection

[0040] 1. Effect of knocking down FcRn expression on PRRSV infection

[0041] 1.1 Construction of pFCGRT-shRNA recombinant lentiviral expression plasmid:

[0042] Primer design: shRNA sequences targeting porcine FCGRT (GenBank accession number: XM_021093554) were designed using the website (https: / / rnaidesigner.thermofisher.com / rnaiexpress / sort.do). Four pairs of sequences with high scores were selected and synthesized by Wuhan Qingke Biotechnology Co., Ltd. as follows:

[0043] pFCGRT target site sequence (5'-3'):

[0044] shRNA1:GGAACAAGCAGAAGCTCTTTC

[0045] shRNA2:GCGAGGAGTTTATGAAGTTCG

[0046] shRNA3:GGTCGTCGCTAACAGTCAAGA

[0047] shRNA4: GCTTCCTACTGCTCTTGATCG.

[0048] The primer sequences are shown in Table 1.

[0049] Table 1 shRNA primer sequences

[0050]

[0051] Obtaining DNA fragments: Short DNA fragments can be obtained by directly annealing the upstream and downstream primers of the shRNA sequence.

[0052] Linearization of the empty vector: Double digest the empty vector pLVX-shRNA2 (YouBio, VT1457) with restriction endonucleases (Takara, 1611 and 1605)

[0053] Recovery and enzyme ligation of the linearized empty vector: The shRNA short DNA fragment with sticky ends was ligated to pLVX-shRNA2 using T4 DNA ligase (Thermo Scientific, EL0014).

[0054] Transformation and identification of enzyme-linked products: Add 5 μL of ligation product to 50 μL of DH5α competent cells and mix thoroughly. Incubate on ice for 30 minutes, heat shock at 42°C for 90 seconds, and let stand on ice for 2 minutes. Add 600 μL of LB medium and incubate at 37°C at 200 rpm for 60 minutes. Evenly spread 200 μL of the bacterial solution onto an LA plate containing ampicillin. Once the liquid is fully absorbed, incubate inverted in a 37°C incubator for 12 hours, observing for the appearance of single white colonies. Select three clones from each plate and place them in a test tube. Add 2 mL of LB medium containing ampicillin and incubate at 37°C at 200 rpm for several hours. Once the culture medium becomes turbid, send the culture solution positive for PCR to Wuhan Qingke for sequencing.

[0055] Extraction of recombinant plasmids: Expand the culture of correctly sequenced monoclonal bacteria, preserve the bacterial solution, and extract the plasmid according to the instructions of the OMEGA endotoxin-free plasmid extraction kit. After measuring the plasmid concentration, store it in a -20°C refrigerator for later use. Thus, four recombinant lentiviral expression plasmids (named pFCGRT-shRNA1 to pFCGRT-shRNA4) and a group of non-target recombinant lentiviral expression plasmids (Non-target) were obtained.

[0056] 1.2 Packaging of recombinant lentivirus

[0057] Cell preparation: Before transfection, prepare 6-well plates of HEK-293T (human embryonic kidney) cells with vigorous growth, good morphology, and approximately 80% confluence.

[0058] Plasmid transfection: Using Lipofectamine 2000 (Invitrigen, 11668500), the recombinant lentiviral expression plasmid prepared in 1.1, the packaging plasmid psPAX2 (Addgene, 12260), and the envelope plasmid pMD2.G (Addgene, 12259) were mixed at a mass ratio of 3:2:1 (i.e., 9 μg of recombinant expression plasmid, 6 μg of psPAX2, and 3 μg of pMD2.G). The mixed plasmids were added to the liposomes and gently mixed until uniformly distributed. After stabilization, the mixture was slowly added dropwise to the cell culture medium.

[0059] To obtain lentiviral solution: Replace the cell growth medium 24 hours after transfection. 48 hours after transfection, collect the cell supernatant and store it in a 4°C refrigerator. Add fresh cell growth medium. 72 hours after transfection, collect the cell supernatant for the second time and mix it with the first supernatant. Filter through a 0.45μm filter (Millipore, SLHV033R) to remove impurities. Aliquot the recombinant lentiviral solution into 1mL / tubes. The virus solution can be used to infect the target cells immediately or stored in a -80°C refrigerator for future use.

[0060] 1.3 Detection of FcRn knockdown efficiency and CD163 expression level

[0061] Preparation of PAMs (porcine alveolar macrophages): Take out the PAMs (isolated and stored in our laboratory) frozen in liquid nitrogen and 6 The PAMs were evenly plated in a 12-well cell plate with a specification of 10 cells / well.

[0062] Lentiviral transduction of shRNA: After PAMs recovered for 24 h, the cell culture medium was discarded, the cells were washed once with PBS, and 500 μL of growth medium was added. Then, 500 μL of recombinant lentivirus expressing shRNA targeting pFCGRT or no target shRNA was added. At the same time, a cell control group (MOCK) without recombinant lentivirus was set up.

[0063] Sample collection and testing: 36 hours after lentiviral infection of PAMs, the cell supernatant was aspirated, the cells were washed once with PBS, and then harvested using RIPA. The expression of FCGRT and CD163 proteins was detected by Western blotting using a rabbit anti-porcine FCGRT cytoplasmic tail polyclonal antibody (prepared in our laboratory) and a mouse anti-CD163 monoclonal antibody (GeneTex, GTX42364). PAMs were treated similarly, and the cytotoxicity of PAMs 36 hours after lentiviral infection was detected using a CCK-8 kit (Biosharp, BS350A).

[0064] Results: shRNA showed no significant toxicity to PAMs; Figure 1 Middle A shows that after knocking down FCGRT expression with four groups of shRNAs, FCGRT expression was significantly reduced without affecting the expression of CD163.

[0065] 1.4 Detection of the effect of FcRn knockdown on PRRSV infection

[0066] The preparation of PAMs and lentiviral transduction of shRNA were the same as described in 1.3 of Example 1 of the present invention.

[0067] PRRSV inoculation of FCGRT-knockdown PAMs: 36 h after lentivirus infection of PAMs, the cell supernatant was discarded, the cells were washed once with PBS, and then 1 MOI of PRRSV-2FJ strain (Sublineage 8.7; isolated and preserved in this laboratory; GenBank accession number: OR102497), NAD30-like SH strain (Sublineage 1.8; isolated and preserved in this laboratory; GenBank accession number: OR102498), or PRRSV-1SH2022 strain (isolated and preserved in this laboratory; GenBank accession number: PQ306310) was added. The virus was adsorbed at 37°C for 1 h, the inoculum was discarded, and cell maintenance medium was added.

[0068] Sample collection and testing: 30 hours after PRRSV infection, cell supernatant was aspirated and stored for later use. Cells were washed once with PBS and harvested using RIPA. Western blotting was performed using rabbit anti-PRRSV nsp1α polyclonal antibody (GeneTex, GTX133695) and rabbit anti-PRRSV N protein polyclonal antibody (GeneTex, GTX135351). qPCR was used to detect the expression of the ORF7 gene in the PRRSV-1 SH2022 strain.

[0069] result: Figure 1 Middle B shows that knockdown of FCGRT inhibited the expression of nsp1α and N protein of PRRSV-2FJ strain; Figure 1Middle C shows that knockdown of FCGRT inhibits the expression of N protein of PRRSV-2SH strain (i.e., NADC30-like SH strain); Figure 1 Middle D shows that knockdown of FCGRT significantly inhibited the expression of ORF7 gene of PRRSV-1 SH2022 strain. These results indicate that knockdown of FCGRT inhibits the proliferation of PRRSV-1 and PRRSV-2 in PAMs.

[0070] 2. Effect of FcRn overexpression on PRRSV infection

[0071] 2.1 Construction of pCMV-Tag2B-FCGRT overexpression plasmid

[0072] Primer design: SnapGene software was used to design coding sequence (CDS) amplification primers for porcine FCGRT (GenBank accession number: XM_021093554) and green monkey FCGRT (GenBank accession number: XM_037991921), and a FLAG tag was added to the 3' end of the CDS.

[0073] The specific operations are as follows:

[0074] The cDNA derived from PAMs was amplified using primers (pFCGRT-F: ATGCGGGTCCCCCGGCCTCA, pFCGRT-R: AGATTCAGCATCCTTGGCCAGGTCG) to obtain the DNA fragment of pFCGRT; a FLAG tag was added to the C-terminus of pFCGRT using primers [pFCGRT-F(HR): GGGCTGCAGGaattcATGCGGGTCCCCCGGCCTC, pFCGRT-FLAG-R: CTTATCGTCGTCATCCTTGTAATCAGATTCAGCATCCTTGG]; and upstream and downstream homology arms were added to pFCGRT-FLAG using primers [pFCGRT-F(HR): GGGCTGCAGGaattcATGCGGGTCCCC CGGCCTC, pFCGRT-FLAG-R(HR): GGTATCGATAAGCTtCTTATCGTCGTCATCCTT GTAATC].

[0075] Following the same method, cDNA from MARC-145 cells (green monkey embryonic kidney epithelial cells) was amplified using primers (mkFCGRT-F: ATGAGGGTCCCGCGGCCTCAGCC, mk FCGRT-R: GGCAGTGGCTGGGATCACATTTA) to obtain the mkFCGRT DNA fragment; and mkFCGRT-FLAG-R: CTTATCGTC was amplified using primers [mkFCGRT-F(HR): GGGCTGCAGGAATTCATGAGGGTCCCGCGGCCTC, mkFCGRT-FLAG-R: CTTATCGTC GTCATCCTTGTAATCGGCAGTGGCTGGGATCACAT] to add a FLAG tag to the C-terminus of mkFCGRT; use primers [mkFCGRT-F(HR): GGGCTGCAGGAATTCATGAGGGTCCCGCGGCCTC, mkFCGRT-FLAG-R(HR): GGGCCCCCCCTCGAGTTACTTATCGTCGTCATCCTTGT] to add upstream and downstream homology arms to mkFCGRT-FLAG. Max DNA Polymerase (Takara, R045A) was used according to the instructions.

[0076] Ligation of target DNA fragments with empty vectors: First, linearize the empty vector pCMV-Tag2B with EcoRI and HindIII. Then, use homologous recombinase (ABclonal, RK21020) to clone the DNA fragments with homology arms (pFCGRT-FLAG and mkFCGRT-FLAG) into pCMV-Tag2B. Recombination with the linearized empty vector pCMV-Tag2B yields the recombinant plasmids pCMV-Tag2B-pFCGRT, which overexpresses the porcine FCGRT gene, and pCMV-Tag2B-mkFCGRT, which overexpresses the green monkey FCGRT gene.

[0077] The transformation of the ligation product, PCR identification, sequencing, and plasmid extraction were the same as described in 1.1 of Example 1 of the present invention.

[0078] 2.2 Detection of the effect of overexpressed FcRn on PRRSV infection

[0079] MARC-145 cells were transfected with 1.5 μg of plasmids (pCMV-Tag2B-pFCGRT, pCMV-Tag2B-mkFCGRT, and pCMV-Tag2B) in 12-well plates for 36 hours. These cells were infected with PRRSV-2FJ (MOI = 1) for the indicated times (12, 24, and 36 hours), and cell supernatants and cell lysates were collected. PRRSV N protein expression was assayed by Western blotting.

[0080] result: Figure 1 Middle E shows that overexpression of pFCGRT promotes the expression of N protein of PRRSV FJ strain; Figure 1 Middle F shows that overexpression of mkFCGRT promotes PRRSV N protein expression. These results indicate that overexpression of FcRn in MARC-145 cells promotes PRRSV proliferation 12 and 24 hours after infection, indicating that overexpression of the FCGRT gene can enhance PRRSV infection.

[0081] Example 2:

[0082] Effects of specific anti-FcRn IgG and normal IgG blocking on PRRSV infection

[0083] 1. Effect of FcRn Antibodies on PRRSV Infection

[0084] 1.1 Detection of cell toxicity of FcRn antibodies

[0085] Cell viability was detected using the CCK-8 kit. The specific steps are as follows:

[0086] Cell preparation: Prepare 96-well plates of PAMs or MARC-145 cells that are growing vigorously and in good condition.

[0087] Antibody incubation: The cell growth medium was aspirated and the antibodies [FCGRT rabbit polyclonal antibody (Proteintech, 16190-1-AP), B2M mouse monoclonal antibody (Proteintech, 66207-1-Ig)] were diluted to the specified concentrations (5, 10, 20, 40 μg / mL) and added to the cells in a 96-well plate. The cells were incubated in a cell culture incubator for 30 h.

[0088] Incubation with CCK-8 solution: Add 10 μL of CCK-8 solution per 100 μL of cell culture medium. Set up three groups: Group 1: cells, culture medium, antibody, and CCK-8 solution; Group 2: culture medium and CCK-8 solution without cells; and Group 3: cells, culture medium, CCK-8 solution without antibody. Place the 96-well plate in the incubator and incubate for 1 hour.

[0089] The absorbance of the cell supernatant was measured at 450 nm using a microplate reader (Thermo Fisher Scientific). 450 ).

[0090] Cell viability analysis: Calculate cell viability [OD 450 (One group)-OD 450 (Group 2)] / [OD 450 (Three groups)-OD 450(Group II)] × 100%, and then analyzed whether the antibodies had an effect on cell viability.

[0091] Results: FCGRT polyclonal antibody or B2M monoclonal antibody at concentrations of 40 μg / mL or below had no significant toxicity to MARC-145 cells, and B2M monoclonal antibody at concentrations of 40 μg / mL or below had no significant toxicity to PAMs.

[0092] Effect of FcRn Antibodies on PRRSV Infection

[0093] Cell preparation: Prepare MARC-145 cells and PAMs in 24-well plates that are growing vigorously and in good condition.

[0094] Antibody incubation: Add medium containing FCGRT polyclonal antibody or B2M monoclonal antibody at final concentrations of 5, 10, or 20 μg / mL to MARC-145 cells. Add medium containing B2M mAb at final concentrations of 5, 10, or 20 μg / mL to PAMs. Incubate at 37°C for 1 h. Also, add 20 μg / mL isotype control IgG.

[0095] Inoculation with PRRSV: cells were inoculated with PRRSV FJ strain (MOI=1), incubated at 37°C for 1 hour, the inoculum was discarded, and maintenance medium containing the corresponding concentration of antibody was added and cultured for another 30 hours.

[0096] Sample collection and detection: aspirate the cell supernatant, wash once with PBS, and then collect the cell lysate using RIPA. Use Western Blot to detect PRRSV N protein expression, TCID 50 The PRRSV titer of the cell supernatant was detected.

[0097] result: Figure 2 Middle A shows that FCGRT polyclonal antibody inhibits PRRSV N protein expression in MARC-145 cells; Figure 2 Middle B shows that B2M mAb inhibited PRRSV N protein expression in MARC-145 cells; Figure 2 Middle C shows that B2M mAb inhibits PRRSV N protein expression in PAMs. These results indicate that FcRn antibodies can block PRRSV proliferation in cells in a dose-dependent manner.

[0098] 2. Effect of IgG on PRRSV infection

[0099] 2.1 Detection of IgG cytotoxicity

[0100] The FcRn antibody was replaced with pig IgG (Bioss, bs-0309P) or rabbit IgG (ABclonal, AC042), and the experiment was performed using PAMs. The rest was the same as described in 1.1 of Example 2 of the present invention.

[0101] Results: Pig or rabbit IgG at concentrations of 40 μg / mL and below had no significant toxicity to PAMs.

[0102] 2.2 Effect of IgG on PRRSV infection

[0103] The FcRn antibody was replaced with pig IgG, rabbit IgG, and mouse IgG (proteintech, 66360-3-Ig), and the experiment was performed using PAMs. The rest was the same as described in 1.2 of Example 2 of the present invention.

[0104] result: Figure 2 Middle D shows that porcine IgG inhibited PRRSV N protein expression in PAMs; Figure 2 Middle E shows that rabbit IgG inhibited PRRSV N protein expression in PAMs; Figure 2 Figure F shows that mouse IgG2b inhibits the expression of PRRSV N protein in PAMs. These results indicate that normal animal IgG can block the proliferation of PRRSV in cells in a dose-dependent manner.

[0105] Example 3:

[0106] Effect of FcRn knockout on PRRSV infection

[0107] 1. Construction and verification of FcRn knockout MARC-145 cells

[0108] 1.1 Construction of the MARC-145 cell line stably expressing Cas9

[0109] Preparation of wild-type cells: Prepare MARC-145 cells in 6-well plates with vigorous growth, good morphology, and approximately 50% confluence.

[0110] Lentiviral transduction of Cas9: Aspirate the cell culture medium, wash twice with PBS, then add 1 mL of cell growth medium, followed by 1 mL of recombinant lentivirus expressing Cas9. After 24 hours of infection, add the lentivirus again and repeat the infection. At the same time, set up cells without lentivirus solution as a control. The recombinant lentivirus expressing Cas9 is prepared by co-transfecting 9 μg, 6 μg, and 3 μg of pLV-Cas9-Puro (lentiviral Cas9 expression vector), psPAX2 (packaging plasmid), and pMD2.G (envelope plasmid) into 6-well HEK-293T cells. Cell supernatants are collected 48 hours and 72 hours after transfection to obtain recombinant lentivirus expressing Cas9.

[0111] Screening of polyclonal cells: Aspirate and discard the virus inoculum, wash twice with PBS, add cell growth medium, and then add Puromycin (Beyotime, ST551) at a final concentration of 10 μg / mL and continue to culture for 1-3 days, during which the cell status is observed.

[0112] Screening of monoclonal cells: Use the limiting dilution method to further screen monoclonal cells from polyclonal cells. After culturing the cells for 7-14 days, find and label the monoclonal cells in a 96-well plate. Transfer the monoclonal cells to a 24-well plate for further culture, and then transfer the cells to a 6-well plate. After the cells have grown into a complete monolayer, remove a portion of the cells for detection and continue to culture the remaining cells.

[0113] Detection of Cas9 protein: Rabbit anti-Cas9 polyclonal antibody (ABclonal, A14997) was used to detect the expression of Cas9 protein in monoclonal cell lines by Western Blot. Subsequently, monoclonal cells in good condition expressing Cas9 protein were expanded and preserved.

[0114] Detection of stable expression of Cas9 protein: A monoclonal B cell line was selected for serial passage. Cells were harvested and cell lysates were prepared at the 1st, 5th, 10th, 15th, 20th, and 30th passages, and Cas9 expression in cells of each passage was detected by Western Blot.

[0115] Results: Monoclonal cells A and B expressed Cas9 protein, and monoclonal cell B continued to express Cas9 protein after 30 consecutive passages. These results indicate the successful construction of a MARC-145 cell line stably expressing Cas9, namely MARC-Cas9 cells.

[0116] 1.2 Construction and verification of three single gene knockout cells: FCGRT, B2M, and CD163

[0117] 1.2.1 Construction of sgRNA recombinant lentiviral expression plasmid

[0118] Primer design: sgRNA sequences targeting green monkey FCGRT (GenBank accession number: XM_037991921), B2M (GenBank accession number: XM_038009930), and CD163 (GenBank accession number: JF753553) were designed using the website (http: / / crispor.tefor.net / crispor.py). The sequences with the highest scores were selected as follows:

[0119] Target site sequence (5'-3')

[0120] sgRNA for mkFCGRT: CCTGAGCTACGATAGCCTG

[0121] sgRNA for mkB2M: ACCCAGACACATAGCAATTC.

[0122] The primers were synthesized and the primer sequences are shown in Table 3.

[0123] Table 3 sgRNA primer sequences

[0124]

[0125] Obtaining short DNA fragments: Short DNA fragments can be obtained by directly annealing the upstream and downstream primers. The empty vector pLV-sgRNA-EGFP is modified from the empty vector pGL3-U6-sgRNA-EGFP (addgene#107721), that is, Bbs is added between the U6 promoter and the gRNA scaffold. Ⅰ Restriction sites. Linearization of pLV-sgRNA-EGFP and construction of recombinant plasmids were as described in 1.1 of Example 1 of the present invention. pLV-sgRNA-EGFP was linearized using the restriction endonuclease Bbs I (NEB, R0539) and then enzymatically ligated to obtain recombinant lentiviral expression plasmids pLV-mkFCGRT-sgRNA-EGFP, pLV-mkB2M-sgRNA-EGFP, and pLV-mkCD163-sgRNA-EGFP.

[0126] The recombinant lentivirus solution was obtained in the same manner as in Example 1.

[0127] 1.2.2 Construction and verification of three single gene knockout cells: FCGRT, B2M, and CD163

[0128] Cell preparation: Prepare 6-well plates of MARC-Cas9 cells that are growing vigorously and in good condition.

[0129] Lentiviral transduction of sgRNA: Aspirate the cell culture medium, wash twice with PBS, add 1 mL of cell growth medium, and then add 1 mL of recombinant lentiviral solution expressing sgRNA targeting green monkey FCGRT, B2M, and CD163 genes respectively. Infect for 48 hours. At the same time, set up cells without lentiviral solution as a control.

[0130] Screening of monoclonal cells: Observe the cells for green fluorescence under a fluorescence microscope (Olympus). If most cells show green fluorescence, select monoclonal cells using the limiting dilution method. Otherwise, repeat the infection of cells with the lentivirus from the previous step.

[0131] Sequencing of the target region: After expanding the cultured cells, extract genomic DNA, amplify the CRISPR / Cas9 target region by PCR, and then send it for sequencing. The primer sequences are shown in Table 4.

[0132] Detection of target protein: Monoclonal cells with a single peak and frameshift mutation in the previous sequencing step were used to prepare protein samples. The expression of green monkey FCGRT, B2M, and CD163 proteins was detected by Western Blot. Subsequently, monoclonal cells in good condition with successful knockout of the target gene were expanded and preserved.

[0133] Table 4 Genome sequencing primers

[0134]

[0135] result: Figure 3 Center A shows that the three single-gene knockout cells do not express FCGRT, B2M, or CD163 proteins. The results indicate that the three single-gene knockout MARC-145 cell lines (FCGRT-KO, B2M-KO, and CD163-KO) were successfully constructed.

[0136] 2. Effect of FcRn knockout on PRRSV proliferation

[0137] Cell preparation: Prepare FCGRT-KO, B2M-KO, CD163-KO and WTMARC-145 cells that are growing vigorously and in good condition.

[0138] Virus inoculation: PRRSV strains [FJ, XJ (isolated and preserved in our laboratory, belonging to sublineage 8.7 strains; GenBank accession number: OR102496), JXA1-R (an attenuated vaccine strain derived from JXA1, purchased from Wuhan Keqian Biological), and R98 (sublineage 5.1 strain; purchased from China Animal Husbandry Industry Co., Ltd.)] were inoculated into three single-gene knockout and WT cells at an MOI of 0.1 or 1, and samples were collected at the designated time points after inoculation.

[0139] Sample collection and testing: Use optical microscopy to observe the cell status 48 hours after inoculation with the FJ strain to determine whether CPE occurs; use IFA to detect the fluorescence signal of PRRSV N protein in the cells. Western blot was used to detect the expression of PRRSV N protein in the cell lysate and cell supernatant 48 hours after inoculation with the FJ strain; qPCR was used to detect the expression of PRRSV ORF7 gene mRNA in the cells 48 hours after inoculation with the FJ strain. Western blot was used to detect the expression of PRRSV N protein in the cell lysate 48 hours after inoculation with the XJ strain, JXA1-R strain, and R98 strain. TCID 50 The titer of FJ strain in three single gene knockout and WT cells was detected 12, 24, 36, 48, and 60 hours after inoculation.

[0140] result: Figure 3 Middle B shows that FCGRT-KO, B2M-KO, and CD163-KO cells had no CPE and PRRSV N protein expression; Figure 3 Middle C shows that there is no PRRSV N protein expression in the supernatants and cell lysates of FCGRT-KO, B2M-KO, and CD163-KO cells; Figure 3 Middle D shows that the copy numbers of PRRSV ORF7 gene in FCGRT-KO, B2M-KO, and CD163-KO cells were significantly lower than those in WT cells; Figure 3 Middle E shows that there is no expression of PRRSV XJ strain, JXA1-R strain, and R98 strain N protein in FCGRT-KO, B2M-KO, and CD163-KO cells; Figure 3 Figure F shows that PRRSV FJ strain did not significantly proliferate in FCGRT-KO, B2M-KO, and CD163-KO cells. These results indicate that knocking out the FcRn protein gene can render MARC-145 cells resistant to PRRSV infection and confirm that intact FcRn molecules are required for PRRSV infection of cells.

[0141] Example 4: Effect of FcRn complementation on PRRSV proliferation

[0142] 1. Construction of gene complementation cell lines

[0143] Because the three single-gene knockout cells stably expressed Cas9 protein and target sgRNA, the PAM sequences in the CDS of green monkey FCGRT and B2M were subjected to synonymous mutations; the PAM sequences in the CDS of synthesized FCGRT of multiple species [human (GenBank accession number: U12255.1), mouse (GenBank accession number: BC003786.1), rat (GenBank accession number: BC061975.1), cattle (GenBank accession number: BC102159.1), and dog (GenBank accession number: XM_005616309.4)] were also subjected to synonymous mutations.

[0144] Construction of recombinant lentiviral plasmid: Primers were designed to perform synonymous mutations in the FCGRT and B2M CDS PA M sequences by Overlap PCR. The primer sequences are shown in Table 5.

[0145] Cell preparation: Prepare 6-well plates of FCGRT-KO and B2M-KO cells that are growing vigorously and in good condition.

[0146] Lentiviral transduction of CDS with mutated PAM sequence: Aspirate the cell culture medium, wash twice with PBS, and add 1 mL of cell growth medium. Add the recombinant lentiviral solution to the corresponding gene knockout cells and infect for 48 hours. At the same time, set up cells without recombinant lentiviral solution as a control.

[0147] Drug screening: 48 hours after lentiviral infection, discard the cell supernatant, wash twice with PBS, and add 2 mL of cell growth medium containing a final concentration of 1000 μg / mL Hygromycin B (Beyotime, ST1389). Continue culturing for 3-5 days. Observe the cell status daily. When all cells in the control group have died, proceed to the next step of the experiment.

[0148] Detection of complement genes: Western Blot was used to detect the expression of FCGRT and B2M proteins in the complement cell lines, and then the cells were expanded and cultured and preserved.

[0149] Table 5 Primers used to mutate FCGRT and B2M PAM sequences

[0150]

[0151] result: Figure 4 Middle A shows that FCGRT and B2M are successfully expressed in FCGRT-KO and B2M-KO cells; Figure 4 D shows the successful expression of FCGRT from different species in FCGRT-KO cells. These results indicate the successful construction of cells complementing FCGRT or B2M, including FCGRT-KO+mkFCGRT, FCGRT-KO+mkB2M, FCGR T-KO+pFCGRT, FCGRT-KO+hFCGRT, FCGRT-KO+mFCGRT, FCGRT-KO+rFCGRT, FCGRT-KO+bFCGRT, and FCGRT-KO+dFCGRT complementing cells.

[0152] 2. Effect of FcRn complementation on PRRSV proliferation

[0153] Cell preparation: Prepare vigorously growing and well-conditioned FCGRT-KO, B2M-KO, FCGRT-KO+mkFCGRT, FCGRT-KO+mkB2M, FCGRT-KO+pFCGRT, FCGRT-KO+hFCGRT, FCGRT-KO+mFCGRT, FCGRT-KO+rFCGRT, FCGRT-KO+bFCGRT, FCGRT-KO+dFCGRT and WT MA RC-145 cells, and set up FCGRT-KO+Vector cells as a control.

[0154] Virus inoculation: PRRSV FJ strain was inoculated into the above cells at an MOI of 1, and samples were collected 30 h after inoculation.

[0155] Sample collection and detection: Collect cell supernatant and use TCID50 The virus titer was detected; the cell lysate was collected and the expression of PRRSV N protein was detected by Western blot.

[0156] result: Figure 4 Middle B shows that complementation of FCGRT and B2M in FCGRT-KO and B2M-KO cells, respectively, can restore PRRSV N protein expression; Figure 4 Middle C shows that the PRRSV titer in the cell supernatant can be restored by replenishing FCGRT and B2M in FCGRT-KO and B2M-KO cells, respectively; Figure 4 Middle D shows that in FCGRT-KO cells, the complementation of pig, green monkey, human, and bovine FCGRT can completely restore the expression of PRRSV N protein, the complementation of mouse and rat FCGRT can partially restore the expression of PRRSV N protein, while the complementation of dog FCGRT cannot restore the expression of PRRSV N protein; Figure 4 Middle E shows that supplementation of FCGRT-KO cells with porcine, green monkey, human, and bovine FCGRT completely restored PRRSV titers in the supernatant. Supplementation with mouse and rat FCGRT partially restored PRRSV titers in the supernatant, while supplementation with canine FCGRT failed to do so. These results indicate that supplementation with FcRn can restore PRRSV proliferation, further confirming that FcRn is required for PRRSV infection of cells.

[0157] Example 5: Effect of FcRn knockout on PRRSV uncoating

[0158] 1. Effect of FcRn knockout on PRRSV cell adsorption

[0159] Cell pre-cooling: Pre-cool the WT, mkFCGRT-KO, mkB2M-KO cells in 12-well plates or the WT, mkFCG RT-KO cells in confocal dishes in a 4°C refrigerator for 1 hour.

[0160] Virus adsorption: Wash three times with cold PBS, inoculate the cells with PRRSV FJ strain (MOI=1), and place in a 4°C refrigerator for 2 h to allow virus adsorption.

[0161] Sample collection and detection: Wash three times with cold PBS to remove unadsorbed viruses, collect samples with Trizol and extract total RNA, and detect the PRRSV ORF7 content by qPCR; or fix cells with 4% paraformaldehyde, observe the amount of PRRSV on the cell surface under a confocal fluorescence microscope, and then quantify the fluorescence intensity using ImageJ software.

[0162] result: Figure 5 Middle A shows that knockout of FcRn does not affect the abundance of PRRSV ORF7 gene on the cell surface; Figure 5Middle B shows that knocking out FcRn does not affect the abundance of PRRSV N protein on the cell surface. These results indicate that knocking out FcRn does not affect the adsorption of PRRSV.

[0163] 2. Effect of FcRn knockout on PRRSV internalization into cells

[0164] Cell pre-cooling: Pre-cool the WT, mkFCGRT-KO, mkB2M-KO cells in 12-well plates or the WT, mkFCG RT-KO cells in confocal dishes in a 4°C refrigerator for 1 hour.

[0165] Virus adsorption: Wash three times with cold PBS, inoculate cells with PRRSV FJ strain (MOI=1), and place in a 4°C refrigerator for 1 h to allow virus adsorption and limit internalization.

[0166] Virus internalization: Wash three times with PBS to remove unadsorbed virus, add 1 mL of cell maintenance medium, and incubate the cells at 37°C for 30 min to allow virus internalization.

[0167] Sample collection and detection: Wash the cells three times with PBS to remove uninternalized viruses, collect the samples with Trizol, extract total RNA, and detect the PRRSV ORF7 content by qPCR; alternatively, fix the cells with 4% paraformaldehyde, observe the amount of PRRSV in the cells under a confocal fluorescence microscope, and then quantify the fluorescence intensity using ImageJ software.

[0168] result: Figure 5 Middle C shows that knocking out FcRn does not affect the abundance of PRRSV ORF7 gene in cells; Figure 5 Middle B shows that knocking out FcRn does not affect the abundance of PRRSV N protein in cells. These results indicate that knocking out FcRn does not affect the internalization of PRRSV.

[0169] 3. Effect of FcRn knockout on the formation of PRRSV replication-transcription complexes (RTCs)

[0170] nsp2 is usually used as a marker of PRRSV RTCs, and the formation of RTCs is a sign that the virus has begun to replicate.

[0171] Cell preparation: Prepare FCGRT-KO, B2M-KO, CD163-KO and WTMARC-145 cells that are growing vigorously and in good condition.

[0172] Virus inoculation: PRRSV-2FJ strain was inoculated into three single gene knockout and WT cells at an MOI dose of 1, and samples were collected 24 hours after inoculation.

[0173] Sample collection and detection: Use IFA to detect whether PRRSV nsp2 is expressed in the cells.

[0174] result: Figure 5 Middle E shows that the expression of PRRSV nsp2 was undetectable in FcRn-KO cells. This result indicates that knocking out FcRn prevents the release of PRRSV genomic RNA.

[0175] The above results indicate that FcRn is involved in the uncoating of PRRSV.

[0176] Example 6: Interaction between FcRn and PRRSV

[0177] 1. Subcellular localization of FcRn and PRRSV

[0178] First, PRRSV FJ strain (MOI = 1) was inoculated into MARC-145 cells and placed at 4°C for 1 h to allow full adsorption of the virus. The cells were then transferred to 37°C and infected at 37°C for 30 min to allow PRRSV internalization before samples were collected. Finally, confocal microscopy was used to detect the subcellular localization of FcRn, PRRSV particles, and the early endosomal marker protein EEA1.

[0179] result: Figure 6 A in the middle shows the co-localization of FcRn, EEA1, and PRRSV. This result indicates that internalized PRRSV enters the FcRn-positive early endosome.

[0180] 2. Co-localization of FcRn and CD163

[0181] First, PRRSV FJ strain (MOI = 1) was inoculated into MARC-145 cells and placed at 4°C for 1 h to allow full adsorption of the virus. The cells were then transferred to 37°C and infected at 37°C for 30 min to allow PRRSV internalization before samples were collected. Finally, the localization of FcRn, PRRSV particles, and CD163 was detected using confocal microscopy.

[0182] result: Figure 6 Middle B shows the co-localization of FcRn, CD163, and PRRSV. The results indicate that internalized PRRSV enters CD163-positive and FcRn-positive early endosomes.

[0183] 3. Interaction of FcRn with PRRSV and CD163

[0184] PRRSV FJ strain (MOI = 5) was inoculated into MARC-145 cells and PAMs, and samples were collected for testing 0.5 h after virus infection at 37°C. HEK-293T cells were co-transfected with pFCGRT, pB2M, and PRRSV-N plasmids, and samples were collected 48 h after transfection to detect protein interactions.

[0185] result: Figure 6Middle C shows that FcRn interacts with PRRSV M and N proteins, and the interaction is stronger at pH 6.0 than at pH 7.4, but FcRn does not interact with GP3 and GP5; Figure 6 Figures D and E show the interaction of green monkey FcRn (Figure 6D) and porcine FcRn (Figure 6E) with PRRSV M and N proteins at pH 6.0, respectively; Figure 6 Middle F shows the interaction between porcine FcRn and PRRSV N protein in HEK-293T; Figure 6 Center G shows that FcRn does not interact with CD163 regardless of PRRSV infection. These results indicate that FcRn interacts with PRRSV in the early endosome.

Claims

1. Application of an inhibitor of animal FcRn protein expression in the preparation of drugs for preventing porcine reproductive and respiratory syndrome virus infection; When the animal is a pig, the inhibitor against the gene encoding the heavy chain of the pig FcRn protein is shRNA: GGAACAAGCAGAAGCTCTTTC, GCGAGGAGTTTATGAAGTTCG, GGTCGTCGCTAACAGTCAAGA and GCTTCCTACTGCTCTTGATCG; When the animal is a green monkey, the inhibitor of the heavy chain encoding gene of the green monkey FcRn protein is sgRNA: CCTGAGCTACGATAGCCTG and / or the inhibitor of the light chain encoding gene is sgRNA: ACCCAGACACATAGCAATTC.

Images